SH3BP5

Summary

SH3BP5 (SH3 domain binding protein 5, HGNC:10827) is a protein-coding gene on chromosome 3p25.1, encoding SH3 domain-binding protein 5 (O60239). Functions as a guanine nucleotide exchange factor (GEF) with specificity for RAB11A and RAB25.

Enables guanyl-nucleotide exchange factor activity and protein kinase inhibitor activity. Acts upstream of or within intracellular signal transduction. Located in cytoplasmic vesicle membrane and nuclear body.

Source: NCBI Gene 9467 — RefSeq curated summary.

At a glance

• GWAS associations: 4
• Clinical variants (ClinVar): 63 total
• MANE Select transcript: NM_004844

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:10827
Approved symbol	SH3BP5
Name	SH3 domain binding protein 5
Location	3p25.1
Locus type	gene with protein product
Status	Approved
Aliases	Sab
Ensembl gene	ENSG00000131370
Ensembl biotype	protein_coding
OMIM	605612
Entrez	9467

Gene structure

Transcript identifiers

Ensembl transcripts: 20 — 16 protein_coding, 2 nonsense_mediated_decay, 2 protein_coding_CDS_not_defined

ENST00000366391, ENST00000383791, ENST00000408919, ENST00000412806, ENST00000417936, ENST00000426925, ENST00000450625, ENST00000459627, ENST00000465894, ENST00000885923, ENST00000885924, ENST00000885925, ENST00000885926, ENST00000885927, ENST00000885928, ENST00000947042, ENST00000947043, ENST00000947044, ENST00000947045, ENST00000947046

RefSeq mRNA: 2 — MANE Select: NM_004844 NM_001018009, NM_004844

CCDS: CCDS2625, CCDS43055

Canonical transcript exons

ENST00000383791 — 9 exons

Exon	Start	End
ENSE00001239283	15332271	15332586
ENSE00001577192	15259761	15259803
ENSE00001588722	15262159	15262289
ENSE00001589177	15258831	15259050
ENSE00001902227	15254353	15256303
ENSE00003478513	15330504	15330566
ENSE00003520958	15269713	15269877
ENSE00003562301	15256853	15257113
ENSE00003669546	15304103	15304231

Expression profiles

Bgee: expression breadth ubiquitous, 293 present calls, max score 99.36.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 39.2012 / max 1249.4840, expressed in 1791 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
41260	38.6719	1791
41263	0.3048	104
41259	0.1249	73
41262	0.0755	10
41261	0.0240	5

Top tissues by expression

295 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
adrenal tissue	UBERON:0018303	99.36	gold quality
endothelial cell	CL:0000115	98.88	gold quality
germinal epithelium of ovary	UBERON:0001304	98.77	gold quality
trigeminal ganglion	UBERON:0001675	98.74	gold quality
cortical plate	UBERON:0005343	98.61	gold quality
pericardium	UBERON:0002407	98.57	gold quality
visceral pleura	UBERON:0002401	98.36	gold quality
secondary oocyte	CL:0000655	98.28	gold quality
adrenal cortex	UBERON:0001235	98.28	gold quality
tendon of biceps brachii	UBERON:0008188	98.26	gold quality
left adrenal gland cortex	UBERON:0035825	98.25	gold quality
adrenal gland	UBERON:0002369	98.22	gold quality
dorsal root ganglion	UBERON:0000044	98.10	gold quality
sural nerve	UBERON:0015488	98.09	gold quality
left adrenal gland	UBERON:0001234	98.08	gold quality
cerebellar vermis	UBERON:0004720	98.07	gold quality
synovial joint	UBERON:0002217	98.05	gold quality
pleura	UBERON:0000977	97.99	gold quality
right adrenal gland cortex	UBERON:0035827	97.93	gold quality
lower lobe of lung	UBERON:0008949	97.92	gold quality
right adrenal gland	UBERON:0001233	97.86	gold quality
epithelium of nasopharynx	UBERON:0001951	97.85	gold quality
left uterine tube	UBERON:0001303	97.79	gold quality
parietal pleura	UBERON:0002400	97.79	gold quality
olfactory bulb	UBERON:0002264	97.67	gold quality
left ovary	UBERON:0002119	97.63	gold quality
urethra	UBERON:0000057	97.49	gold quality
cranial nerve II	UBERON:0000941	97.45	gold quality
pons	UBERON:0000988	97.41	gold quality
mammary duct	UBERON:0001765	97.38	gold quality

Single-cell (SCXA)

Detected in 9 experiment(s), a significant marker in 9.

Experiment	Marker?	Max mean expression
E-MTAB-6701	yes	84.03
E-MTAB-10287	yes	64.17
E-MTAB-10553	yes	46.21
E-HCAD-10	yes	36.66
E-HCAD-5	yes	14.84
E-HCAD-9	yes	14.37
E-CURD-112	yes	11.04
E-MTAB-6678	yes	6.35
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

79 targeting SH3BP5, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-656-3P	100.00	72.15	2788
HSA-MIR-3692-3P	99.98	70.27	2139
HSA-MIR-568	99.98	69.86	2084
HSA-MIR-5696	99.98	72.36	4487
HSA-MIR-103A-3P	99.98	69.14	1595
HSA-MIR-107	99.98	69.14	1595
HSA-MIR-3688-3P	99.97	72.02	2834
HSA-MIR-96-5P	99.95	72.80	2140
HSA-MIR-335-3P	99.93	73.36	4958
HSA-MIR-12133	99.92	71.82	2006
HSA-MIR-6508-5P	99.92	70.67	2465
HSA-MIR-1271-5P	99.91	71.99	1972
HSA-MIR-5680	99.91	69.83	3421
HSA-MIR-106A-5P	99.90	73.94	2683
HSA-MIR-17-5P	99.89	73.83	2665
HSA-MIR-106B-5P	99.88	74.72	2795
HSA-MIR-20A-5P	99.88	74.76	2769
HSA-MIR-20B-5P	99.88	74.01	2621
HSA-MIR-519D-3P	99.88	73.97	2607
HSA-MIR-526B-3P	99.88	74.06	2587
HSA-MIR-93-5P	99.88	73.98	2606
HSA-MIR-3919	99.87	69.45	2489
HSA-MIR-8067	99.86	69.59	2260
HSA-MIR-556-3P	99.74	68.75	1203
HSA-MIR-3059-5P	99.70	69.93	2491
HSA-MIR-4729	99.69	72.18	4233
HSA-MIR-586	99.65	70.40	2051

Literature-anchored findings (GeneRIF, showing 11)

• mitochondrial protein Sab is phosphorylated by stress-activated protein kinase 3 (PMID:15158451)
• SH3BP5 binds to JNK and directly inhibits JNK through its two putative mitogen-activated protein kinase interaction motifs (KIMs). (PMID:23861391)
• The interplay of p-JNK with mitochondrial Sab leads to impaired respiration, ROS production, sustained JNK activation, and apoptosis. (PMID:25666017)
• REI/SH3BP5 protein family is conserved in evolution and is a group of new guanine nucleotide exchange factors for Rab11. (PMID:26745340)
• SH3BP5, LMO3, and SNAP25 were expressed in diffuse large B-cell lymphoma cells and associated with clinical features. (PMID:27184832)
• SH3 domain binding protein 5 (Sab) expression is reduced in ovarian cancer (OC), suggesting that Sab may be a prognostic biomarker to discern personalized treatments for OC patients. (PMID:30322886)
• Study found that expression of SH3BP5 was enhanced in acute myeloid leukemia (AML) cells and was negatively correlated with patients survival. Elevated expression of SH3BP5 was an independent prognostic factor for AML patients. Furthermore, SH3BP5-mediated activation of JNK-BAD signaling contributes to the survival of AML cells. (PMID:31546831)
• trans-Fatty acids facilitate DNA damage-induced apoptosis through the mitochondrial JNK-Sab-ROS positive feedback loop. (PMID:32066809)
• Tankyrase regulates epithelial lumen formation via suppression of Rab11 GEFs. (PMID:34128958)
• Novel blood-based hypomethylation of SH3BP5 is associated with very early-stage lung adenocarcinoma. (PMID:34783986)
• METTL3 suppresses invasion of lung cancer via SH3BP5 m6A modification. (PMID:38141906)

Cross-species orthologs

7 orthologs

Organism	Symbol	Gene ID
danio_rerio	sh3bp5a	ENSDARG00000100529
danio_rerio	sh3bp5b	ENSDARG00000103978
mus_musculus	Sh3bp5	ENSMUSG00000021892
rattus_norvegicus	Mettl6	ENSRNOG00000052391
drosophila_melanogaster	pcs	FBGN0033988
caenorhabditis_elegans		WBGENE00007270
caenorhabditis_elegans		WBGENE00019365

Paralogs (1): SH3BP5L (ENSG00000175137)

Protein

Protein identifiers

SH3 domain-binding protein 5 — O60239 (reviewed: O60239)

Alternative names: SH3 domain-binding protein that preferentially associates with BTK

All UniProt accessions (5): C9J140, C9JK30, C9JNW0, O60239, F8WDU8

UniProt curated annotations — full annotation on UniProt →

Function. Functions as a guanine nucleotide exchange factor (GEF) with specificity for RAB11A and RAB25. Inhibits the auto- and transphosphorylation activity of BTK. Plays a negative regulatory role in BTK-related cytoplasmic signaling in B-cells. May be involved in BCR-induced apoptotic cell death.

Subunit / interactions. Interacts with BTK. Interacts with all isoforms of MAPK8, MAPK9, MAPK10 and MAPK12. Interacts with GDP-bound and nucleotide-free forms of RAB11A.

Subcellular location. Cytoplasmic vesicle membrane. Mitochondrion.

Tissue specificity. Highly expressed in testis and ovaries. It is also expressed in a variety of tissues including spleen, lymph node, thymus, bone marrow, fetal liver, colon, small intestine and prostate.

Domain organisation. The N-terminal half of the protein mediates interaction with RAB11A and functions as a guanine nucleotide exchange factor. Four long alpha-helices (interrupted by a central kink) assemble into coiled coils, giving rise to a ‘V’ shape.

Similarity. Belongs to the SH3BP5 family.

Isoforms (2)

UniProt ID	Names	Canonical?
O60239-1	1	yes
O60239-2	2

RefSeq proteins (2): NP_001018009, NP_004835* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR007940	SH3BP5	Family

Pfam: PF05276

UniProt features (36 total): compositionally biased region 7, mutagenesis site 6, helix 6, region of interest 5, modified residue 5, coiled-coil region 4, chain 1, splice variant 1, turn 1

Structure

Experimental structures (PDB)

6 structures.

PDB	Method	Resolution (Å)
4H3B	X-RAY DIFFRACTION	2.08
6DJL	X-RAY DIFFRACTION	3.1
6IXE	X-RAY DIFFRACTION	3.35
6IXF	X-RAY DIFFRACTION	3.6
6IXV	X-RAY DIFFRACTION	3.8
6IXG	X-RAY DIFFRACTION	3.8

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O60239-F1	72.22	0.47

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (5): 351, 375, 376, 418, 421

Mutagenesis-validated functional residues (6):

Position	Phenotype
52–54	loss of guanine nucleotide exchange factor activity.
250–251	loss of guanine nucleotide exchange factor activity.
347	loss of phosphorylation and binding by phospho-jnk; when associated with a-349.
349	loss of phosphorylation and binding by phospho-jnk; when associated with a-347.
434	no change of phosphorylation or binding by phospho-jnk; when associated with a-436.
436	no change of phosphorylation or binding by phospho-jnk; when associated with a-434.

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 336 (showing top): PID_BCR_5PATHWAY, WAMUNYOKOLI_OVARIAN_CANCER_LMP_DN, AAGCAAT_MIR137, TGCACTT_MIR519C_MIR519B_MIR519A, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, FOXO4_01, FOXO1_01, SP1_Q2_01, CREIGHTON_ENDOCRINE_THERAPY_RESISTANCE_1, CHEOK_RESPONSE_TO_MERCAPTOPURINE_DN, DELYS_THYROID_CANCER_DN, SCHAEFFER_PROSTATE_DEVELOPMENT_48HR_DN, AACTTT_UNKNOWN, LEF1_Q6, DOUGLAS_BMI1_TARGETS_UP

GO Biological Process (2): signal transduction (GO:0007165), intracellular signal transduction (GO:0035556)

GO Molecular Function (4): protein kinase inhibitor activity (GO:0004860), guanyl-nucleotide exchange factor activity (GO:0005085), SH3 domain binding (GO:0017124), protein binding (GO:0005515)

GO Cellular Component (7): nucleoplasm (GO:0005654), cytoplasm (GO:0005737), mitochondrion (GO:0005739), nuclear body (GO:0016604), cytoplasmic vesicle membrane (GO:0030659), membrane (GO:0016020), cytoplasmic vesicle (GO:0031410)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
intracellular anatomical structure	2
cytoplasm	2
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
signal transduction	1
protein kinase activity	1
kinase inhibitor activity	1
protein kinase regulator activity	1
GTP binding	1
GDP binding	1
GTPase regulator activity	1
protein domain specific binding	1
binding	1
nuclear lumen	1
intracellular membrane-bounded organelle	1
nucleoplasm	1
intracellular membraneless organelle	1
vesicle membrane	1
cytoplasmic vesicle	1
intracellular vesicle	1

Protein interactions and networks

STRING

826 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SH3BP5	USP10	Q14694	926
SH3BP5	G3BP1	Q13283	885
SH3BP5	BTK	Q06187	858
SH3BP5	ATP2B4	P23634	639
SH3BP5	DHPS	P49366	637
SH3BP5	SH3BP2	P78314	622
SH3BP5	RAB11A	P24410	580
SH3BP5	SRC	P12931	553
SH3BP5	MAPK8	P45983	521
SH3BP5	USP1	O94782	491
SH3BP5	SPAG9	O60271	478
SH3BP5	TRAPPC10	P48553	457
SH3BP5	EFNA5	P52803	447
SH3BP5	SH3BP4	Q9P0V3	447
SH3BP5	TRAPPC11	Q7Z392	445

IntAct

41 interactions, top by confidence:

A	B	Type	Score
RAB11B	SH3BP5	psi-mi:“MI:0914”(association)	0.640
SH3BP5	NAP1L2	psi-mi:“MI:0915”(physical association)	0.560
SH3BP5	IFT20	psi-mi:“MI:0915”(physical association)	0.560
RAB11A	SH3BP5	psi-mi:“MI:0914”(association)	0.530
BTK	SH3BP5	psi-mi:“MI:0915”(physical association)	0.520
SH3BP5	BTK	psi-mi:“MI:0915”(physical association)	0.520
Tnks	SDC2	psi-mi:“MI:0914”(association)	0.350
LIMA1	PLEKHG3	psi-mi:“MI:0914”(association)	0.350
Xpo1	IFT56	psi-mi:“MI:0914”(association)	0.350
ALB	SH3BP5	psi-mi:“MI:0914”(association)	0.350
SH3BP5	DISC1	psi-mi:“MI:0915”(physical association)	0.000
SH3BP5	EXOC1	psi-mi:“MI:0915”(physical association)	0.000
SOS1	SH3BP5	psi-mi:“MI:0915”(physical association)	0.000
TNKS	SH3BP5	psi-mi:“MI:0915”(physical association)	0.000
SH3BP5	HPS5	psi-mi:“MI:0915”(physical association)	0.000
SH3BP5	SYNE2	psi-mi:“MI:0915”(physical association)	0.000
SH3BP5	SYNE1	psi-mi:“MI:0915”(physical association)	0.000
SH3BP5	MAN1A1	psi-mi:“MI:0915”(physical association)	0.000
SH3BP5	ING4	psi-mi:“MI:0915”(physical association)	0.000
SH3BP5	SOS1	psi-mi:“MI:0915”(physical association)	0.000
SH3BP5	DST	psi-mi:“MI:0915”(physical association)	0.000
SH3BP5	SPTBN1	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (44): SH3BP5 (Affinity Capture-RNA), SH3BP5 (Affinity Capture-RNA), SH3BP5 (Affinity Capture-MS), SH3BP5 (Affinity Capture-MS), SH3BP5 (Affinity Capture-MS), SH3BP5 (Affinity Capture-MS), SH3BP5 (Affinity Capture-MS), SH3BP5 (Affinity Capture-MS), SH3BP5 (Two-hybrid), NAP1L2 (Two-hybrid), MAPK8 (Reconstituted Complex), SH3BP5 (Two-hybrid), SH3BP5 (Biochemical Activity), MAPK9 (Reconstituted Complex), MAPK10 (Reconstituted Complex)

ESM2 similar proteins: A0PJT0, A1YB07, A2A6T1, A4IH82, B1A193, D3ZD05, O14526, O60239, O75145, O75335, O94876, P60469, P84903, Q0V8K7, Q13136, Q1LU99, Q1LZH7, Q2QL82, Q2QLG9, Q3TBD2, Q495M9, Q58CP9, Q5R9X9, Q5RB40, Q5U4W1, Q5U584, Q63ZY3, Q69ZZ6, Q6AYB8, Q6DIS8, Q6NZT2, Q6P402, Q7L8J4, Q80T11, Q86YS3, Q8BIJ7, Q8BQP8, Q8BX02, Q8CJ96, Q91Y80

Diamond homologs: A4IH82, O60239, Q0V8K7, Q21194, Q5R9X9, Q5U584, Q7L8J4, Q91Y80, Q99LH9, Q9V785, Q9Z131, P42171

SIGNOR signaling

3 interactions.

A	Effect	B	Mechanism
MAPK12	unknown	SH3BP5	phosphorylation
MAPK9	unknown	SH3BP5	phosphorylation

Disease & clinical

Clinical variants and AI predictions

ClinVar

63 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	46
Likely benign	1
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

2086 predictions. Top by Δscore:

Variant	Effect	Δscore
3:15256848:CTCA:C	donor_loss	1.0000
3:15256849:TCA:T	donor_loss	1.0000
3:15256850:CACC:C	donor_loss	1.0000
3:15256851:A:AC	donor_gain	1.0000
3:15256851:AC:A	donor_gain	1.0000
3:15256851:ACC:A	donor_loss	1.0000
3:15256851:ACCT:A	donor_gain	1.0000
3:15256852:C:CC	donor_gain	1.0000
3:15256852:CC:C	donor_gain	1.0000
3:15256852:CCT:C	donor_gain	1.0000
3:15256852:CCTC:C	donor_gain	1.0000
3:15257109:GGCCA:G	acceptor_gain	1.0000
3:15257110:GCCA:G	acceptor_gain	1.0000
3:15257111:CCA:C	acceptor_gain	1.0000
3:15257111:CCAC:C	acceptor_gain	1.0000
3:15257112:CA:C	acceptor_gain	1.0000
3:15257112:CAC:C	acceptor_gain	1.0000
3:15257113:AC:A	acceptor_loss	1.0000
3:15257114:C:CC	acceptor_gain	1.0000
3:15257115:T:G	acceptor_loss	1.0000
3:15257119:T:TC	acceptor_gain	1.0000
3:15258826:CTTA:C	donor_loss	1.0000
3:15258827:TTACC:T	donor_loss	1.0000
3:15258828:TA:T	donor_loss	1.0000
3:15258829:A:AC	donor_gain	1.0000
3:15258829:AC:A	donor_gain	1.0000
3:15258830:C:CA	donor_gain	1.0000
3:15258830:CC:C	donor_gain	1.0000
3:15258830:CCAG:C	donor_gain	1.0000
3:15258830:CCAGA:C	donor_gain	1.0000

AlphaMissense

3003 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
3:15258971:A:G	L250P	1.000
3:15258971:A:T	L250Q	1.000
3:15258980:A:G	L247P	1.000
3:15259799:A:C	Y211D	1.000
3:15262280:C:G	A169P	1.000
3:15269724:C:G	A162P	1.000
3:15269728:A:C	N160K	1.000
3:15269728:A:T	N160K	1.000
3:15269732:A:G	L159P	1.000
3:15269745:A:G	W155R	1.000
3:15269745:A:T	W155R	1.000
3:15269792:G:T	A139D	1.000
3:15269795:A:G	L138P	1.000
3:15269813:G:T	A132D	1.000
3:15269814:C:G	A132P	1.000
3:15269822:A:G	L129P	1.000
3:15269835:C:G	A125P	1.000
3:15269865:C:G	A115P	1.000
3:15304123:C:G	A104P	1.000
3:15304132:A:C	Y101D	1.000
3:15304195:C:G	A80P	1.000
3:15330508:A:G	L66P	1.000
3:15330550:A:G	L52S	1.000
3:15330559:A:G	L49P	1.000
3:15330559:A:T	L49Q	1.000
3:15258948:G:C	H258D	0.999
3:15258960:A:G	S254P	0.999
3:15258962:A:C	I253S	0.999
3:15258993:A:C	Y243D	0.999
3:15258993:A:G	Y243H	0.999

dbSNP variants (sampled 300 via entrez): RS1000062355 (3:15336473 AGGAGATCCATTAGCCTGAT>A), RS1000105699 (3:15305798 G>T), RS1000140124 (3:15260004 A>C,G), RS1000174705 (3:15304504 G>T), RS1000175717 (3:15257496 C>G), RS1000214358 (3:15332962 A>G), RS1000215422 (3:15294378 G>A,C), RS1000290638 (3:15281026 C>A), RS1000308914 (3:15305534 A>G), RS1000383704 (3:15270374 T>A,C), RS1000390618 (3:15301753 C>T), RS1000401067 (3:15275758 C>T), RS1000405294 (3:15335658 C>A), RS1000436700 (3:15341943 G>A,T), RS1000481563 (3:15288395 T>A,C)

Disease associations

OMIM: gene MIM:605612 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

4 associations (top):

Study	Trait	p-value
GCST001254_1	Alcohol dependence	3.000000e-06
GCST001471_3	Alcohol and nicotine co-dependence	4.000000e-07
GCST002579_22	Heschl’s gyrus morphology	1.000000e-06
GCST004639_2	Prudent dietary pattern	1.000000e-06

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0008111	diet measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

49 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, increases expression	5
Acetaminophen	decreases expression, increases expression	4
diethyl maleate	increases expression, affects expression	2
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	increases expression, affects cotreatment	2
Benzo(a)pyrene	decreases methylation, increases expression	2
Phenylmercuric Acetate	increases expression, affects cotreatment	2
Tretinoin	increases expression	2
Cyclosporine	decreases expression, increases expression	2
Aflatoxin B1	affects expression, increases expression	2
bisphenol F	affects cotreatment, decreases expression	1
triphenyl phosphate	affects expression	1
methylselenic acid	affects expression	1
ascorbate-2-phosphate	affects binding, affects cotreatment, increases expression	1
sodium arsenite	decreases expression	1
cobaltous chloride	increases expression	1
butyraldehyde	decreases expression	1
benzo(e)pyrene	decreases methylation	1
4-(2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl)benzoic acid	affects cotreatment, increases expression	1
perfluoro-n-nonanoic acid	increases expression	1
2-palmitoylglycerol	increases expression	1
nickel acetate	affects expression	1
bardoxolone methyl	affects expression	1
Chir 99021	affects cotreatment, increases expression, affects binding, decreases expression	1
dorsomorphin	affects cotreatment, increases expression	1
XAV939	increases expression, decreases expression, affects binding, affects cotreatment	1
LDN 193189	affects cotreatment, increases expression	1
(+)-JQ1 compound	decreases expression	1
3-(4-pyridyl)-1H-indole	affects cotreatment, increases expression	1
Resveratrol	affects cotreatment, increases expression	1
Ascorbic Acid	decreases expression, affects binding, affects cotreatment	1

Cellosaurus cell lines

3 cell lines: 3 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_TK94	HAP1 SH3BP5 (-) 1	Cancer cell line	Male
CVCL_XS74	HAP1 SH3BP5 (-) 2	Cancer cell line	Male
CVCL_XS75	HAP1 SH3BP5 (-) 3	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.