SHISA5

Summary

SHISA5 (shisa family member 5, HGNC:30376) is a protein-coding gene on chromosome 3p21.31, encoding Protein shisa-5 (Q8N114). Can induce apoptosis in a caspase-dependent manner and plays a role in p53/TP53-dependent apoptosis.

This gene encodes a member of the shisa family. The encoded protein is localized to the endoplasmic reticulum, and together with p53 induces apoptosis in a caspase-dependent manner. Alternative splicing results in multiple transcript variants. Related pseudogenes of this gene are found on chromosome X.

Source: NCBI Gene 51246 — RefSeq curated summary.

At a glance

• GWAS associations: 11
• Clinical variants (ClinVar): 35 total
• MANE Select transcript: NM_016479

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:30376
Approved symbol	SHISA5
Name	shisa family member 5
Location	3p21.31
Locus type	gene with protein product
Status	Approved
Aliases	SCOTIN, hShisa5
Ensembl gene	ENSG00000164054
Ensembl biotype	protein_coding
OMIM	607290
Entrez	51246

Gene structure

Transcript identifiers

Ensembl transcripts: 23 — 11 protein_coding, 5 protein_coding_CDS_not_defined, 4 nonsense_mediated_decay, 3 retained_intron

ENST00000296444, ENST00000415268, ENST00000417841, ENST00000417962, ENST00000424965, ENST00000426002, ENST00000441507, ENST00000442747, ENST00000443308, ENST00000444115, ENST00000460758, ENST00000465449, ENST00000466424, ENST00000486344, ENST00000490864, ENST00000494854, ENST00000496408, ENST00000497863, ENST00000619810, ENST00000929322, ENST00000949298, ENST00000949299, ENST00000949300

RefSeq mRNA: 7 — MANE Select: NM_016479 NM_001272065, NM_001272066, NM_001272067, NM_001272068, NM_001272082, NM_001272083, NM_016479

CCDS: CCDS2770, CCDS63621, CCDS63622, CCDS63623

Canonical transcript exons

ENST00000296444 — 6 exons

Exon	Start	End
ENSE00001858548	48504019	48504174
ENSE00003461144	48467876	48469186
ENSE00003466796	48479177	48479257
ENSE00003543932	48501137	48501293
ENSE00003632430	48469361	48469573
ENSE00003789416	48469728	48469843

Expression profiles

Bgee: expression breadth ubiquitous, 264 present calls, max score 99.22.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 77.9936 / max 587.4527, expressed in 1819 samples.

FANTOM5 promoters (17 alternative TSS)

Promoter ID	TPM avg	Samples expressed
42123	24.4028	1802
42122	24.3308	1795
42138	23.8249	1759
42139	1.5916	866
42129	0.7741	145
42137	0.7392	505
42124	0.6825	396
42128	0.4384	146
42125	0.3575	129
42135	0.2419	73

Top tissues by expression

264 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
oviduct epithelium	UBERON:0004804	99.22	gold quality
granulocyte	CL:0000094	98.52	gold quality
stromal cell of endometrium	CL:0002255	98.52	gold quality
blood	UBERON:0000178	98.24	gold quality
nasal cavity epithelium	UBERON:0005384	97.92	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	97.84	gold quality
left uterine tube	UBERON:0001303	97.77	gold quality
right coronary artery	UBERON:0001625	97.76	gold quality
thoracic aorta	UBERON:0001515	97.64	gold quality
ascending aorta	UBERON:0001496	97.63	gold quality
descending thoracic aorta	UBERON:0002345	97.63	gold quality
prostate gland	UBERON:0002367	97.59	gold quality
esophagus mucosa	UBERON:0002469	97.59	gold quality
ectocervix	UBERON:0012249	97.57	gold quality
fallopian tube	UBERON:0003889	97.55	gold quality
leukocyte	CL:0000738	97.54	gold quality
esophagus	UBERON:0001043	97.46	gold quality
monocyte	CL:0000576	97.42	gold quality
upper lobe of left lung	UBERON:0008952	97.40	gold quality
upper lobe of lung	UBERON:0008948	97.36	gold quality
lower esophagus	UBERON:0013473	97.36	gold quality
lower esophagus muscularis layer	UBERON:0035833	97.36	gold quality
gall bladder	UBERON:0002110	97.34	gold quality
body of uterus	UBERON:0009853	97.34	gold quality
left coronary artery	UBERON:0001626	97.32	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	97.32	gold quality
endocervix	UBERON:0000458	97.31	gold quality
aorta	UBERON:0000947	97.27	gold quality
spleen	UBERON:0002106	97.26	gold quality
right uterine tube	UBERON:0001302	97.25	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-MTAB-3929	yes	1876.81
E-MTAB-8498	yes	10.00
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): ESR1, NKX3-1, TP53, TP73

miRNA regulators (miRDB)

28 targeting SHISA5, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-432-3P	100.00	67.86	705
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-7978	99.86	66.90	856
HSA-MIR-6764-5P	99.75	67.89	2304
HSA-MIR-494-3P	99.70	71.45	2795
HSA-MIR-5003-5P	99.61	69.13	1624
HSA-MIR-510-3P	99.54	70.06	2965
HSA-MIR-671-5P	99.52	67.11	1277
HSA-MIR-3128	99.50	67.85	1258
HSA-MIR-133A-3P	99.27	71.53	1270
HSA-MIR-133B	99.27	71.53	1270
HSA-MIR-3925-5P	99.21	67.90	1466
HSA-MIR-6809-5P	99.13	68.45	1223
HSA-MIR-4742-5P	98.89	68.41	1542
HSA-MIR-4711-5P	98.89	68.00	965
HSA-MIR-7155-5P	98.65	66.14	1290
HSA-MIR-4710	98.61	65.96	1048
HSA-MIR-6873-5P	98.45	66.14	1417
HSA-MIR-4299	98.28	66.96	850
HSA-MIR-12120	98.05	68.44	1768
HSA-MIR-7112-3P	97.67	68.77	948
HSA-MIR-6793-3P	97.66	65.78	1084
HSA-MIR-4456	97.50	64.88	1678
HSA-MIR-320E	97.49	65.96	865
HSA-MIR-96-3P	97.47	68.03	839
HSA-MIR-4640-5P	97.42	66.33	1543
HSA-MIR-663B	97.40	62.91	664
HSA-MIR-1224-3P	97.24	65.92	851

Literature-anchored findings (GeneRIF, showing 3)

• Scotin plays a role in p53-dependent apoptosis (PMID:12135983)
• ALG-2 binding to Scotin is strictly calcium dependent, indicating a role of this interaction in calcium signaling pathways (PMID:17889823)
• IFN-beta-induced SCOTIN recruits the HCV NS5A protein to autophagosomes for degradation, thereby restricting HCV replication. (PMID:26868272)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Shisa5	ENSMUSG00000025647
rattus_norvegicus	Shisa5	ENSRNOG00000020667

Paralogs (2): UHRF2 (ENSG00000147854), UHRF1 (ENSG00000276043)

Protein

Protein identifiers

Protein shisa-5 — Q8N114 (reviewed: Q8N114)

Alternative names: Putative NF-kappa-B-activating protein 120, Scotin

All UniProt accessions (6): C9IZ46, Q8N114, F8WCE2, F8WDS1, F8WFD9, H7C2R0

UniProt curated annotations — full annotation on UniProt →

Function. Can induce apoptosis in a caspase-dependent manner and plays a role in p53/TP53-dependent apoptosis.

Subunit / interactions. Interacts with PDCD6; PDCD6 can stabilize SHISA5.

Subcellular location. Endoplasmic reticulum membrane. Nucleus membrane.

Domain organisation. The proline-rich region is required for endoplasmic reticulum localization.

Induction. Induced in a p53/TP53-dependent manner in response to cellular stress.

Similarity. Belongs to the shisa family.

Isoforms (5)

UniProt ID	Names	Canonical?
Q8N114-1	1	yes
Q8N114-2	2
Q8N114-3	3
Q8N114-4	4
Q8N114-5	5

RefSeq proteins (7): NP_001258994, NP_001258995, NP_001258996, NP_001258997, NP_001259011, NP_001259012, NP_057563* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR026910	Shisa	Family
IPR053891	Shisa_N	Domain

Pfam: PF13908

UniProt features (11 total): splice variant 5, topological domain 2, signal peptide 1, chain 1, sequence variant 1, transmembrane region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8N114-F1	58.65	0.02

Function

Pathways and Gene Ontology

Reactome pathways

4 pathways

ID	Pathway
R-HSA-381426	Regulation of Insulin-like Growth Factor (IGF) transport and uptake by Insulin-like Growth Factor Binding Proteins (IGFBPs)
R-HSA-8957275	Post-translational protein phosphorylation
R-HSA-392499	Metabolism of proteins
R-HSA-597592	Post-translational protein modification

MSigDB gene sets: 211 (showing top): GOBP_INTRINSIC_APOPTOTIC_SIGNALING_PATHWAY_IN_RESPONSE_TO_DNA_DAMAGE_BY_P53_CLASS_MEDIATOR, RORA1_01, GOBP_RESPONSE_TO_ENDOPLASMIC_RETICULUM_STRESS, GOBP_CANONICAL_NF_KAPPAB_SIGNAL_TRANSDUCTION, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_UP, GOBP_VESICLE_MEDIATED_TRANSPORT, GOBP_CELLULAR_RESPONSE_TO_TOPOLOGICALLY_INCORRECT_PROTEIN, GOBP_REGULATION_OF_VESICLE_MEDIATED_TRANSPORT, GOBP_ENDOPLASMIC_RETICULUM_TO_GOLGI_VESICLE_MEDIATED_TRANSPORT, GOBP_APOPTOTIC_SIGNALING_PATHWAY, GOBP_REGULATION_OF_CELLULAR_LOCALIZATION, GOBP_REGULATION_OF_RESPONSE_TO_STRESS, GOBP_INTRINSIC_APOPTOTIC_SIGNALING_PATHWAY_IN_RESPONSE_TO_DNA_DAMAGE, GOBP_DNA_DAMAGE_RESPONSE, TGANTCA_AP1_C

GO Biological Process (8): intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771), positive regulation of canonical NF-kappaB signal transduction (GO:0043123), regulation of ER to Golgi vesicle-mediated transport (GO:0060628), regulation of COPII vesicle uncoating (GO:0090111), positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103), positive regulation of response to endoplasmic reticulum stress (GO:1905898), apoptotic process (GO:0006915), intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)

GO Molecular Function (3): WW domain binding (GO:0050699), molecular condensate scaffold activity (GO:0140693), protein binding (GO:0005515)

GO Cellular Component (7): endoplasmic reticulum (GO:0005783), endoplasmic reticulum lumen (GO:0005788), endoplasmic reticulum membrane (GO:0005789), nuclear membrane (GO:0031965), nucleus (GO:0005634), nuclear envelope (GO:0005635), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-2 pathways:

Category	Pathways
Metabolism of proteins	2
Post-translational protein modification	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
positive regulation of intracellular signal transduction	2
endomembrane system	2
intracellular membrane-bounded organelle	2
organelle membrane	2
nucleus	2
intrinsic apoptotic signaling pathway in response to DNA damage	1
intrinsic apoptotic signaling pathway by p53 class mediator	1
canonical NF-kappaB signal transduction	1
regulation of canonical NF-kappaB signal transduction	1
endoplasmic reticulum to Golgi vesicle-mediated transport	1
regulation of intracellular transport	1
regulation of vesicle-mediated transport	1
COPII vesicle uncoating	1
regulation of protein depolymerization	1
endoplasmic reticulum unfolded protein response	1
regulation of endoplasmic reticulum unfolded protein response	1
positive regulation of response to endoplasmic reticulum stress	1
response to endoplasmic reticulum stress	1
positive regulation of cellular process	1
positive regulation of response to stimulus	1
regulation of response to endoplasmic reticulum stress	1
programmed cell death	1
apoptotic signaling pathway	1
execution phase of apoptosis	1
signal transduction by p53 class mediator	1
intrinsic apoptotic signaling pathway	1
protein domain specific binding	1
protein-macromolecule adaptor activity	1
binding	1
cytoplasm	1
endoplasmic reticulum	1
intracellular organelle lumen	1
nuclear outer membrane-endoplasmic reticulum membrane network	1
endoplasmic reticulum subcompartment	1
nuclear envelope	1
organelle envelope	1
cellular anatomical structure	1

Protein interactions and networks

STRING

1200 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SHISA5	TP53	P04637	532
SHISA5	CDKN1A	P38936	496
SHISA5	CD34	P28906	495
SHISA5	PIDD1	Q9HB75	493
SHISA5	PERP	Q96FX8	433
SHISA5	GSG1L2	A8MUP6	418
SHISA5	APEH	P13798	374
SHISA5	SHISA8	B8ZZ34	372
SHISA5	SHISA9	B4DS77	360
SHISA5	LGALS8	O00214	349
SHISA5	EI24	O14681	345
SHISA5	UBE2D1	P51668	344
SHISA5	PLSCR3	Q9NRY6	342
SHISA5	RPRM	Q9NS64	341
SHISA5	TP73	O15350	329

IntAct

10 interactions, top by confidence:

A	B	Type	Score
SHISA5	Pdcd6	psi-mi:“MI:0407”(direct interaction)	0.600
SHISA5	Pdcd6	psi-mi:“MI:0915”(physical association)	0.600
WWOX	SHISA5	psi-mi:“MI:0915”(physical association)	0.520
SHISA5	WWOX	psi-mi:“MI:0915”(physical association)	0.520
TFAP2C	SHISA5	psi-mi:“MI:0915”(physical association)	0.370
COPS5	SHISA5	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (13): SHISA5 (Affinity Capture-Western), SHISA5 (Two-hybrid), SHISA5 (Two-hybrid), ARL6IP1 (Two-hybrid), SCAND1 (Two-hybrid), TVP23B (Two-hybrid), SGTB (Two-hybrid), SHISA5 (Affinity Capture-RNA), SHISA5 (Affinity Capture-RNA), SHISA5 (Two-hybrid), SHISA5 (Reconstituted Complex), SHISA5 (Affinity Capture-Western), SHISA5 (Two-hybrid)

ESM2 similar proteins: A0A0U1RQ45, A0A1B0GWB2, A2A9T0, A6QPA0, A7MCY6, D3ZFB6, E9PUL5, E9Q0B3, F5GYI3, F5H4A9, J3QNX5, O70142, P0C1G7, P81408, P97764, P98077, Q148V8, Q15654, Q2KI80, Q3SX26, Q3SZL6, Q4V9L6, Q5FVJ4, Q5FW56, Q5RAC1, Q5T7N3, Q6DG50, Q6PAJ3, Q6PJ61, Q6ZMQ8, Q6ZNR0, Q6ZRV2, Q75VX8, Q7Z6L0, Q86UK7, Q86VE0, Q8BGW2, Q8BRJ3, Q8BX43, Q8C0R7

Diamond homologs: Q3T0A9, Q5RDV6, Q5XIH2, Q5ZIS9, Q8N114, Q9D7I0, A2RV66

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

35 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	20
Likely benign	1
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

684 predictions. Top by Δscore:

Variant	Effect	Δscore
3:48469570:ACCG:A	acceptor_gain	1.0000
3:48469571:CCG:C	acceptor_gain	1.0000
3:48469571:CCGC:C	acceptor_gain	1.0000
3:48469572:CG:C	acceptor_gain	1.0000
3:48469572:CGC:C	acceptor_gain	1.0000
3:48469574:C:CC	acceptor_gain	1.0000
3:48469727:CGA:C	donor_gain	1.0000
3:48469569:AACCG:A	acceptor_gain	0.9900
3:48469571:CCGCT:C	acceptor_loss	0.9900
3:48469572:CGCTG:C	acceptor_loss	0.9900
3:48469573:GCTG:G	acceptor_loss	0.9900
3:48469574:C:A	acceptor_loss	0.9900
3:48469575:T:G	acceptor_loss	0.9900
3:48469680:C:A	donor_gain	0.9900
3:48469726:A:AC	donor_gain	0.9900
3:48469727:C:CC	donor_gain	0.9900
3:48469746:T:TA	donor_gain	0.9900
3:48469840:GAACC:G	acceptor_loss	0.9900
3:48473128:T:A	donor_gain	0.9900
3:48473131:T:TA	donor_gain	0.9900
3:48469686:C:CT	donor_gain	0.9800
3:48469727:CG:C	donor_gain	0.9800
3:48469727:CGACG:C	donor_gain	0.9800
3:48469839:CGAAC:C	acceptor_gain	0.9800
3:48469844:C:CC	acceptor_gain	0.9800
3:48473069:C:A	donor_gain	0.9800
3:48473086:A:AC	donor_gain	0.9800
3:48473087:G:C	donor_gain	0.9800
3:48469721:CG:C	donor_gain	0.9700
3:48473125:ATCT:A	donor_gain	0.9700

AlphaMissense

1526 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
3:48469779:A:G	C127R	0.990
3:48501229:G:C	F47L	0.988
3:48501229:G:T	F47L	0.988
3:48501231:A:G	F47L	0.988
3:48501197:C:G	C58S	0.987
3:48501198:A:T	C58S	0.987
3:48501222:C:A	G50C	0.986
3:48501224:C:G	C49S	0.985
3:48501225:A:T	C49S	0.985
3:48501200:C:G	C57S	0.978
3:48501201:A:T	C57S	0.978
3:48501224:C:T	C49Y	0.978
3:48501227:C:G	C48S	0.978
3:48501228:A:T	C48S	0.978
3:48469821:C:G	G113R	0.977
3:48501197:C:T	C58Y	0.977
3:48501196:G:C	C58W	0.975
3:48469820:C:T	G113D	0.973
3:48501198:A:G	C58R	0.973
3:48501230:A:C	F47C	0.972
3:48501239:C:G	C44S	0.970
3:48501240:A:T	C44S	0.970
3:48501223:A:C	C49W	0.966
3:48469778:C:T	C127Y	0.965
3:48501221:C:A	G50V	0.965
3:48501225:A:G	C49R	0.965
3:48469770:A:G	C130R	0.963
3:48501227:C:T	C48Y	0.963
3:48501228:A:G	C48R	0.961
3:48501239:C:T	C44Y	0.961

dbSNP variants (sampled 300 via entrez): RS1000152204 (3:48493634 G>A), RS1000182213 (3:48493180 G>A), RS1000252959 (3:48485673 T>C), RS1000483816 (3:48495129 G>T), RS1000495829 (3:48476916 G>A), RS1000514465 (3:48494778 G>A), RS1000528069 (3:48500727 C>T), RS1000638238 (3:48481470 A>ATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAC,ATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAC,ATAAAATAAAATAAAATAAAATAAAATAAAATAAAC,ATAAAATAAAATAAAATAAAATAAAC), RS1000692859 (3:48489032 G>A), RS1000724409 (3:48488154 T>C), RS1000743267 (3:48488538 G>C), RS1000790818 (3:48485974 G>A), RS1000808428 (3:48481167 G>A), RS1000991317 (3:48475061 G>A), RS1001089489 (3:48475291 C>T)

Disease associations

OMIM: gene MIM:607290 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

11 associations (top):

Study	Trait	p-value
GCST004131_23	Inflammatory bowel disease	1.000000e-33
GCST004132_17	Crohn’s disease	3.000000e-23
GCST004133_11	Ulcerative colitis	8.000000e-20
GCST010698_80	Subcortical volume (min-P)	3.000000e-24
GCST010699_110	Brain morphology (min-P)	4.000000e-08
GCST010701_52	Cortical surface area (MOSTest)	1.000000e-16
GCST010702_36	Subcortical volume (MOSTest)	1.000000e-10
GCST010703_262	Brain morphology (MOSTest)	2.000000e-13
GCST90020024_1143	A body shape index	4.000000e-14
GCST90020029_1171	Waist circumference adjusted for body mass index	1.000000e-17
GCST90020029_1172	Waist circumference adjusted for body mass index	4.000000e-08

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0004346	neuroimaging measurement
EFO:0007789	BMI-adjusted waist circumference

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

30 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
triphenyl phosphate	affects expression	1
bisphenol A	increases expression	1
beta-lapachone	increases expression	1
sodium arsenite	decreases expression	1
chloropicrin	increases expression	1
pinostrobin	increases expression	1
ICG 001	increases expression	1
eprenetapopt	affects reaction, increases expression	1
(+)-JQ1 compound	decreases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	decreases expression	1
Temozolomide	increases expression	1
Sunitinib	decreases expression	1
Vorinostat	decreases expression	1
Acetaminophen	decreases expression	1
Atrazine	increases expression	1
Vehicle Emissions	increases abundance, increases expression	1
Cadmium	decreases expression, increases abundance	1
Chelating Agents	affects binding, decreases expression	1
Copper	affects binding, decreases expression	1
Diazinon	increases methylation	1
Smoke	decreases expression	1
Tetrachlorodibenzodioxin	affects expression	1
Thimerosal	decreases expression	1
Thiram	decreases expression	1
Tretinoin	increases expression	1
Valproic Acid	decreases expression	1
Cyclosporine	decreases expression	1
Cadmium Chloride	decreases expression, increases abundance	1
Copper Sulfate	decreases expression	1
Particulate Matter	increases abundance, increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.