SIGLEC16

Summary

SIGLEC16 (sialic acid binding Ig like lectin 16 (gene/pseudogene), HGNC:24851) is a protein-coding gene on chromosome 19q13.33, encoding Sialic acid-binding Ig-like lectin 16 (A6NMB1). Putative adhesion molecule that mediates sialic-acid dependent binding to cells.

Predicted to enable sialic acid binding activity. Involved in positive regulation of defense response to bacterium and positive regulation of interleukin-6 production. Predicted to be located in membrane. Predicted to be active in plasma membrane.

Source: NCBI Gene 400709 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 10 total

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:24851
Approved symbol	SIGLEC16
Name	sialic acid binding Ig like lectin 16 (gene/pseudogene)
Location	19q13.33
Locus type	gene with protein product
Status	Approved
Aliases	Siglec-P16
Ensembl gene	ENSG00000161643
Ensembl biotype	protein_coding
Entrez	400709

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding_LoF

ENST00000602139

RefSeq mRNA: 1 — MANE Select: None NM_001348364

Canonical transcript exons

ENST00000602139 — 9 exons

Exon	Start	End
ENSE00003084270	49969812	49970191
ENSE00003102017	49969600	49969741
ENSE00003124566	49970323	49970607
ENSE00003146693	49973495	49975819
ENSE00003462806	49971121	49971384
ENSE00003507969	49971844	49972101
ENSE00003595537	49971667	49971714
ENSE00003601923	49973043	49973122
ENSE00003604734	49972601	49972694

Expression profiles

Bgee: expression breadth ubiquitous, 146 present calls, max score 86.45.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.0340 / max 6.9881, expressed in 13 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
208902	0.0340	13

Top tissues by expression

241 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
left ovary	UBERON:0002119	86.45	gold quality
right ovary	UBERON:0002118	83.46	gold quality
ovary	UBERON:0000992	81.80	gold quality
monocyte	CL:0000576	78.23	gold quality
spleen	UBERON:0002106	77.68	gold quality
leukocyte	CL:0000738	77.53	gold quality
granulocyte	CL:0000094	76.13	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	72.33	silver quality
vermiform appendix	UBERON:0001154	65.73	gold quality
right adrenal gland	UBERON:0001233	65.22	gold quality
right adrenal gland cortex	UBERON:0035827	64.67	gold quality
germinal epithelium of ovary	UBERON:0001304	64.50	silver quality
blood	UBERON:0000178	63.49	gold quality
right coronary artery	UBERON:0001625	62.46	gold quality
left adrenal gland	UBERON:0001234	62.14	gold quality
left adrenal gland cortex	UBERON:0035825	61.73	gold quality
adrenal cortex	UBERON:0001235	60.80	gold quality
caecum	UBERON:0001153	60.20	gold quality
adrenal gland	UBERON:0002369	60.10	gold quality
apex of heart	UBERON:0002098	59.96	gold quality
smooth muscle tissue	UBERON:0001135	59.74	gold quality
upper lobe of left lung	UBERON:0008952	59.27	gold quality
ventricular zone	UBERON:0003053	58.36	silver quality
left coronary artery	UBERON:0001626	58.16	gold quality
left uterine tube	UBERON:0001303	58.11	gold quality
bone marrow cell	CL:0002092	57.99	gold quality
upper lobe of lung	UBERON:0008948	57.96	gold quality
omental fat pad	UBERON:0010414	57.61	gold quality
peritoneum	UBERON:0002358	57.56	gold quality
coronary artery	UBERON:0001621	57.52	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	2.62

Regulation

Is transcription factor: no

Literature-anchored findings (GeneRIF, showing 3)

• SIGLEC16 encodes a DAP12-associated receptor expressed in macrophages that evolved from its inhibitory counterpart SIGLEC11 and has functional and non-functional alleles in humans. (PMID:18629938)
• The authors demonstrated that the human-specific pathogen Escherichia coli K1 uses its polysialic acid capsule as a molecular mimic to engage Siglec-11 and escape killing. In contrast, engagement of the activating counterpart Siglec-16 increases elimination of bacteria. (PMID:28100677)
• Proinflammatory Macrophage Activation by the Polysialic Acid-Siglec-16 Axis Is Linked to Increased Survival of Patients with Glioblastoma. (PMID:37058255)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Siglecg	ENSMUSG00000030468
rattus_norvegicus	Siglec10	ENSRNOG00000037339

Paralogs (16): CD22 (ENSG00000012124), SIGLEC1 (ENSG00000088827), SIGLEC8 (ENSG00000105366), CD33 (ENSG00000105383), SIGLEC6 (ENSG00000105492), MAG (ENSG00000105695), SIGLEC9 (ENSG00000129450), SIGLEC10 (ENSG00000142512), TMEM25 (ENSG00000149582), SIGLEC11 (ENSG00000161640), SIGLEC7 (ENSG00000168995), SIGLECL1 (ENSG00000179213), SIGLEC15 (ENSG00000197046), SIGLEC14 (ENSG00000254415), SIGLEC12 (ENSG00000254521), SIGLEC5 (ENSG00000268500)

Protein

Protein identifiers

Sialic acid-binding Ig-like lectin 16 — A6NMB1 (reviewed: A6NMB1)

Alternative names: Siglec-P16

All UniProt accessions (0):

UniProt curated annotations — full annotation on UniProt →

Function. Putative adhesion molecule that mediates sialic-acid dependent binding to cells.

Subcellular location. Membrane.

Tissue specificity. Expressed in bone marrow, fetal brain, fetal liver, lung and salivary gland. Detected in brain, macrophage, cancerous esophagus and lung at protein level.

Similarity. Belongs to the immunoglobulin superfamily. SIGLEC (sialic acid binding Ig-like lectin) family.

RefSeq proteins (1): NP_001335293 (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003006	Ig/MHC_CS	Conserved_site
IPR003598	Ig_sub2	Domain
IPR003599	Ig_sub	Domain
IPR007110	Ig-like_dom	Domain
IPR013098	Ig_I-set	Domain
IPR013106	Ig_V-set	Domain
IPR013783	Ig-like_fold	Homologous_superfamily
IPR036179	Ig-like_dom_sf	Homologous_superfamily
IPR051036	SIGLEC	Family

Pfam: PF07679, PF07686, PF13927

UniProt features (19 total): disulfide bond 5, glycosylation site 4, domain 4, topological domain 2, signal peptide 1, chain 1, transmembrane region 1, binding site 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-A6NMB1-F1	83.57	0.46

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (1): 120

Disulfide bonds (5): 37–174, 42–102, 165–216, 259–306, 363–408

Glycosylation sites (4): 43, 78, 338, 347

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-2172127	DAP12 interactions

MSigDB gene sets: 38 (showing top): GOBP_POSITIVE_REGULATION_OF_CYTOKINE_PRODUCTION, GOBP_POSITIVE_REGULATION_OF_RESPONSE_TO_EXTERNAL_STIMULUS, GOBP_CYTOKINE_PRODUCTION, GOBP_REGULATION_OF_RESPONSE_TO_STRESS, GOBP_POSITIVE_REGULATION_OF_RESPONSE_TO_BIOTIC_STIMULUS, GOBP_REGULATION_OF_RESPONSE_TO_EXTERNAL_STIMULUS, GOBP_REGULATION_OF_RESPONSE_TO_BIOTIC_STIMULUS, GOBP_REGULATION_OF_DEFENSE_RESPONSE, GOBP_DEFENSE_RESPONSE_TO_BACTERIUM, GOBP_POSITIVE_REGULATION_OF_INTERLEUKIN_6_PRODUCTION, GOBP_REGULATION_OF_DEFENSE_RESPONSE_TO_BACTERIUM, GOBP_POSITIVE_REGULATION_OF_MULTICELLULAR_ORGANISMAL_PROCESS, GOMF_ORGANIC_ACID_BINDING, GOBP_RESPONSE_TO_BACTERIUM, GOBP_INTERLEUKIN_6_PRODUCTION

GO Biological Process (3): cell adhesion (GO:0007155), positive regulation of interleukin-6 production (GO:0032755), positive regulation of defense response to bacterium (GO:1900426)

GO Molecular Function (2): carbohydrate binding (GO:0030246), sialic acid binding (GO:0033691)

GO Cellular Component (1): plasma membrane (GO:0005886)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Innate Immune System	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular process	1
positive regulation of cytokine production	1
interleukin-6 production	1
regulation of interleukin-6 production	1
positive regulation of response to biotic stimulus	1
positive regulation of defense response	1
positive regulation of response to external stimulus	1
defense response to bacterium	1
regulation of defense response to bacterium	1
binding	1
carboxylic acid binding	1
carbohydrate derivative binding	1
membrane	1
cell periphery	1

Protein interactions and networks

STRING

0 interactions, top by confidence (×1000):

IntAct

3 interactions, top by confidence:

A	B	Type	Score
SIGLEC10	SIGLEC16	psi-mi:“MI:0914”(association)	0.350

ESM2 similar proteins: A6NMB1, A7LCJ3, G1T7E7, G1TR84, M3XWH1, O15389, O43699, O70540, P04217, P05362, P0DP72, P13597, P20138, P32942, P33729, Q00238, Q08ET2, Q14773, Q28125, Q28730, Q28806, Q2KJF1, Q5NKT8, Q5NKU6, Q5NKV4, Q5NKV6, Q5NKV9, Q60625, Q62230, Q64JA4, Q6DN72, Q7L513, Q80ZE3, Q91Y57, Q920A9, Q920G3, Q92154, Q95132, Q95LH0, Q96A28

Diamond homologs: A6NMB1, D3YXG0, O15389, O43699, O60469, P20138, P35329, Q08ET2, Q63994, Q64JA4, Q80ZE3, Q8N441, Q8VHZ8, Q91Y57, Q920G3, Q95LH0, Q96LC7, Q96PQ1, Q96RL6, Q96RW7, Q9ERC8, Q9NYZ4, Q9Y286, Q9Y336, Q460M5, Q6ZMC9, Q80TG9, Q8N7X8, Q9BE71, Q9ULH4, A1KZ92, A2AJ76, A2ASS6, P98160, Q28173, Q62151, Q63495, Q8BQC3, Q8NDA2, A4IIW9

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

10 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	8
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

0 predictions. Top by Δscore:

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000389417 (19:49969356 AGAATGAAT>A,AGAAT,AGAATGAATGAAT,AGAATGAATGAATGAAT), RS1000678030 (19:49969409 A>G), RS1001183932 (19:49972519 C>T), RS1001380899 (19:49968395 G>GGTT), RS1002590397 (19:49968981 A>G), RS1003117807 (19:49975909 T>C), RS1003319002 (19:49974924 G>A), RS1003724817 (19:49971419 G>C), RS1003883527 (19:49968063 C>A), RS1004288171 (19:49969740 G>A), RS1004746319 (19:49972505 G>C,T), RS1004986725 (19:49975604 ACTTCGAGTCTTCCTGCCTTTG>A), RS1005129872 (19:49973659 G>A), RS1005290551 (19:49968749 A>G), RS1005323386 (19:49968468 T>A,C,G)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

11 total (human), top 11 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
aristolochic acid I	increases expression	1
S-(1,2-dichlorovinyl)cysteine	affects cotreatment, decreases expression	1
jinfukang	affects cotreatment, decreases expression	1
Benzo(a)pyrene	affects methylation	1
Cisplatin	affects cotreatment, decreases expression	1
Dexamethasone	increases expression	1
Lipopolysaccharides	affects cotreatment, decreases expression	1
Tobacco Smoke Pollution	affects expression	1
Valproic Acid	increases methylation	1
Antirheumatic Agents	decreases expression	1
Cadmium Chloride	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.