SIRT4

Summary

SIRT4 (sirtuin 4, HGNC:14932) is a protein-coding gene on chromosome 12q24.31, encoding NAD-dependent protein lipoamidase sirtuin-4, mitochondrial (Q9Y6E7). Acts as a NAD-dependent protein lipoamidase, biotinylase, deacetylase and ADP-ribosyl transferase.

This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class IV of the sirtuin family.

Source: NCBI Gene 23409 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 59 total — 1 pathogenic
• Druggable target: yes — 2 molecules with ChEMBL bioactivity
• MANE Select transcript: NM_012240

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:14932
Approved symbol	SIRT4
Name	sirtuin 4
Location	12q24.31
Locus type	gene with protein product
Status	Approved
Aliases	SIR2L4
Ensembl gene	ENSG00000089163
Ensembl biotype	protein_coding
OMIM	604482
Entrez	23409

Gene structure

Transcript identifiers

Ensembl transcripts: 9 — 8 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000202967, ENST00000536460, ENST00000537892, ENST00000850925, ENST00000851533, ENST00000851534, ENST00000851535, ENST00000851536, ENST00000962684

RefSeq mRNA: 4 — MANE Select: NM_012240 NM_001385733, NM_001385734, NM_001385735, NM_012240

CCDS: CCDS9194

Canonical transcript exons

ENST00000202967 — 4 exons

Exon	Start	End
ENSE00001129533	120312456	120312750
ENSE00002274293	120312884	120313249
ENSE00002283557	120302321	120302378
ENSE00004282765	120303561	120304058

Expression profiles

Bgee: expression breadth ubiquitous, 190 present calls, max score 89.14.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 4.2392 / max 618.2275, expressed in 958 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
128326	3.7211	816
128327	0.5181	248

Top tissues by expression

275 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	89.14	gold quality
apex of heart	UBERON:0002098	78.86	gold quality
cortical plate	UBERON:0005343	78.49	gold quality
hindlimb stylopod muscle	UBERON:0004252	77.68	gold quality
gastrocnemius	UBERON:0001388	76.19	gold quality
muscle of leg	UBERON:0001383	75.83	gold quality
right adrenal gland	UBERON:0001233	75.10	gold quality
sperm	CL:0000019	74.92	gold quality
heart left ventricle	UBERON:0002084	74.30	gold quality
right adrenal gland cortex	UBERON:0035827	74.21	gold quality
left adrenal gland	UBERON:0001234	73.79	gold quality
cardiac ventricle	UBERON:0002082	73.66	gold quality
left adrenal gland cortex	UBERON:0035825	73.34	gold quality
right lobe of liver	UBERON:0001114	73.19	gold quality
male germ cell	CL:0000015	72.91	gold quality
muscle organ	UBERON:0001630	72.91	gold quality
ganglionic eminence	UBERON:0004023	72.68	gold quality
left testis	UBERON:0004533	72.68	gold quality
cerebellar hemisphere	UBERON:0002245	72.39	gold quality
cerebellar cortex	UBERON:0002129	72.30	gold quality
Brodmann (1909) area 23	UBERON:0013554	72.28	gold quality
prefrontal cortex	UBERON:0000451	71.85	gold quality
adrenal cortex	UBERON:0001235	71.85	gold quality
primary visual cortex	UBERON:0002436	71.77	gold quality
adrenal gland	UBERON:0002369	71.56	gold quality
right hemisphere of cerebellum	UBERON:0014890	71.45	gold quality
right testis	UBERON:0004534	71.38	gold quality
stromal cell of endometrium	CL:0002255	71.27	gold quality
testis	UBERON:0000473	71.25	gold quality
ventricular zone	UBERON:0003053	70.63	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	1.52

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): ATF2, ATF4

miRNA regulators (miRDB)

18 targeting SIRT4, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-497-5P	99.92	71.83	2674
HSA-MIR-1297	99.91	73.41	3162
HSA-MIR-15A-5P	99.90	72.80	2787
HSA-MIR-15B-5P	99.90	72.78	2798
HSA-MIR-16-5P	99.90	72.80	2780
HSA-MIR-195-5P	99.90	72.81	2805
HSA-MIR-424-5P	99.89	71.90	2641
HSA-MIR-6838-5P	99.89	71.94	2690
HSA-MIR-1299	99.77	71.24	2389
HSA-MIR-4524A-5P	99.57	71.73	1193
HSA-MIR-4524B-5P	99.57	71.68	1195
HSA-MIR-1252-3P	99.55	67.71	2862
HSA-MIR-6128	99.33	67.83	1581
HSA-MIR-6770-5P	98.97	66.76	1853
HSA-MIR-374B-3P	98.63	68.24	1360
HSA-MIR-1267	98.24	69.05	837
HSA-MIR-215-3P	97.02	68.01	1209
HSA-MIR-4471	95.11	66.84	755

Literature-anchored findings (GeneRIF, showing 40)

• mitochondrial SIRT4 has a role in the regulation of insulin secretion (PMID:17715127)
• there is a negative correlation between SIRTs 1 and 4 and fasting plasma glucose, a positive correlation between SIRT4 mRNA levels and triglyceride/lipoprotein a levels, and a negative correlation between SIRT4 mRNA levels and HDL (PMID:21556116)
• Study shows that mTORC1 promotes glutamine anaplerosis by activating glutamate dehydrogenase (GDH). This regulation requires transcriptional repression of SIRT4, the mitochondrial-localized sirtuin that inhibits GDH. Mechanistically, mTORC1 represses SIRT4 by promoting the proteasome-mediated destabilization of cAMP-responsive element binding 2. (PMID:23663782)
• regulates ATP levels via ANT2 and a feedback loop involving AMPK (PMID:24296486)
• these results highlight the tumor-suppressive role of SIRT4 in Myc-induced B cell lymphoma and suggest that SIRT4 may be a potential target against Myc-induced and/or glutamine-dependent cancers. (PMID:24368766)
• The present study shows low circulating levels of SIRT4 in obese patients with nonalcoholic fatty liver disease. (PMID:25045415)
• Results show that mitochondrial sirtuins SIRT3, SIRT4, and SIRT5 can promote increased mitochondrial respiration and cellular metabolism and respond to excess glucose by inducing a coordinated increase of glycolysis and respiration. (PMID:25165814)
• Overexpression of SIRT4 attenuated inflammation mediators in umbilical vein endothelial cells. (PMID:25331589)
• This study demonstrated that SIRT4 upregulation in the liver of non-alcoholic fatty liver disease patients. (PMID:25361925)
• Serum Sirt4 was inversely related to anthropometric and metabolic parameters and positively related to peak GH and IGF-1. (PMID:25466907)
• Until now, a mammalian cellular lipoamidase has not been characterized; this study discovered that SIRT4 can function with this enzymatic capacity in the mitochondria, and that PDH is a biological substrate; compared to its catalytic efficiency for deacetylation, SIRT4 exhibits far superior enzymatic activity for lipoyl- and biotinyl-lysine modifications. (PMID:25525879)
• C-terminal-binding protein (CtBP) was found to have an essential role in promoting glutaminolysis by directly repressing the expression of SIRT4. (PMID:25633289)
• SIRT4 behaves as a tumor suppressor at the human tissue protein level. (PMID:26054687)
• SIRT4 has a tumour-suppressive function and may serve as a novel therapeutic target in colorectal cancer. (PMID:26086877)
• Data indicate that compared to non-neoplastic endometria (NNE), endometrial cancer (EC) showed SIRT7 mRNA overexpression, whereas SIRT1, SIRT2, SIRT4 and SIRT5 were underexpressed, and no significant differences were observed for SIRT3 and SIRT6. (PMID:26701732)
• Thus, these results suggest that SIRT4 has essential roles in stress resistance and may be an important therapeutic target for cancer treatment. (PMID:26775843)
• miR-15b is a negative regulator of stress-induced SIRT4 expression, thereby counteracting senescence associated mitochondrial dysfunction and regulating the SASP and possibly organ aging, such as photoaging of human skin. (PMID:26959556)
• SIRT4 overexpression inhibits the proliferation of colorectal cancer cells in vitro and in vivo. (PMID:26986234)
• The function of the three mitochondrial sirtuins (SIRT3, SIRT4, SIRT5) and their role in disease are reviewed. (PMID:27164052)
• Protein levels of SIRT 4 were significantly higher in HUVECs from HELLP pregnancies compared to control after 60 and 120 minutes of hypoxia. (PMID:27651178)
• This is the first study to identify an association between SIRT4 expression and decreased mitochondrial fission, which was driven by Drp1. SIRT4 inhibited Drp1 phosphorylation and weakened Drp1 recruitment to the mitochondrial membrane via an interaction with Fis-1. (PMID:27941873)
• SIRT4 protein levels in endometrioid adenocarcinoma were markedly lower than its non-neoplastic tissue counterpart (P< 0.001). (PMID:28582846)
• we found that knock-out of mitochondrial sirtuin sir-2.3, homologous to mammalian SIRT4, is protective in both chemical ischemia and hyperactive channel induced necrosis. This work suggests a deleterious role of SIRT4 during ischemic processes in mammals that must be further investigated (PMID:28820880)
• we propose that the SIRT4-OPA1 axis is causally linked to mitochondrial dysfunction and altered mitochondrial dynamics that translates into aging-associated decreased mitophagy based on an unbalanced mitochondrial fusion/fission cycle. (PMID:29081403)
• structural model of a complex of human Sirt4 and GDH in order to elucidate the molecular mechanism underlying the ADP-ribosylation of GDH by Sirt4 (PMID:29571013)
• this study shows that SIRT4 resolves immune tolerance in monocytes by rebalancing glycolysis and glucose oxidation homeostasis (PMID:29593712)
• This makes SIRT4 become the last puzzle of mitochondrial sirtuins, and thus brings some obstacles for studying SIRT4 biological functions or developing SIRT4 modulators. (PMID:30033389)
• suppresses hepatocellular carcinoma tumorigenesis by undermining mTOR signaling (PMID:30552782)
• SIRT4 was induced and cooperated with IDE to degrade PTEN. (PMID:30649986)
• SIRT4 overexpression promoted oxLDLinduced HUVEC proliferation and inhibited cell apoptosis. Furthermore, SIRT4 overexpression suppressed the PI3K/Akt/NFkappaB pathway by inhibiting PI3K phosphorylation and phosphorylated (p)Akt, pnuclear factor of kappa light polypeptide gene enhancer in Bcells inhibitor alpha and pp65 NFkappaB expression. (PMID:31059091)
• This study establishes SIRT4 as key anabolic factor that activates TORC1 signaling and regulates lipogenesis, autophagy, and cell proliferation. (PMID:31685549)
• Results demonstrate that downregulation of SIRT4 in TAMs modulates the alternative activation of macrophages and promotes HCC development via the FAO-PPARdelta-STAT3 axis. (PMID:31744516)
• SIRT4 prevents excitotoxicity via modulating glutamate metabolism in glioma cells. (PMID:32081049)
• Mammalian SIRT4 is a tumor suppressor of clear cell renal cell carcinoma by inhibiting cancer proliferation, migration and invasion. (PMID:32675395)
• Loss of SIRT4 promotes the self-renewal of Breast Cancer Stem Cells. (PMID:32863939)
• SIRT4 is the molecular switch mediating cellular proliferation in colorectal cancer through GLS mediated activation of AKT/GSK3beta/CyclinD1 pathway. (PMID:33315089)
• Circular RNA OMA1 regulates the progression of breast cancer via modulation of the miR1276/SIRT4 axis. (PMID:34414449)
• Dysregulation of mitochondrial sirtuin genes is associated with human male infertility. (PMID:34664305)
• Role of mitochondrial sirtuins in rheumatoid arthritis. (PMID:34768083)
• Analysis of SIRT4 gene single-nucleotide polymorphisms in a Han Chinese population with dilated cardiomyopathy. (PMID:34856814)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	sirt4	ENSDARG00000010415
mus_musculus	Sirt4	ENSMUSG00000029524
rattus_norvegicus	Sirt4	ENSRNOG00000001151
drosophila_melanogaster	Sirt4	FBGN0029783
caenorhabditis_elegans		WBGENE00004801
caenorhabditis_elegans		WBGENE00004802

Paralogs (6): SIRT2 (ENSG00000068903), SIRT6 (ENSG00000077463), SIRT1 (ENSG00000096717), SIRT5 (ENSG00000124523), SIRT3 (ENSG00000142082), SIRT7 (ENSG00000187531)

Protein

Protein identifiers

NAD-dependent protein lipoamidase sirtuin-4, mitochondrial — Q9Y6E7 (reviewed: Q9Y6E7)

Alternative names: NAD-dependent ADP-ribosyltransferase sirtuin-4, NAD-dependent protein biotinylase sirtuin-4, NAD-dependent protein deacetylase sirtuin-4, Regulatory protein SIR2 homolog 4, SIR2-like protein 4

All UniProt accessions (2): Q9Y6E7, F5H4X9

UniProt curated annotations — full annotation on UniProt →

Function. Acts as a NAD-dependent protein lipoamidase, biotinylase, deacetylase and ADP-ribosyl transferase. Catalyzes more efficiently removal of lipoyl- and biotinyl- than acetyl-lysine modifications. Inhibits the pyruvate dehydrogenase complex (PDH) activity via the enzymatic hydrolysis of the lipoamide cofactor from the E2 component, DLAT, in a phosphorylation-independent manner. Catalyzes the transfer of ADP-ribosyl groups onto target proteins, including mitochondrial GLUD1, inhibiting GLUD1 enzyme activity. Acts as a negative regulator of mitochondrial glutamine metabolism by mediating mono ADP-ribosylation of GLUD1: expressed in response to DNA damage and negatively regulates anaplerosis by inhibiting GLUD1, leading to block metabolism of glutamine into tricarboxylic acid cycle and promoting cell cycle arrest. In response to mTORC1 signal, SIRT4 expression is repressed, promoting anaplerosis and cell proliferation. Acts as a tumor suppressor. Also acts as a NAD-dependent protein deacetylase: mediates deacetylation of ‘Lys-471’ of MLYCD, inhibiting its activity, thereby acting as a regulator of lipid homeostasis. Does not seem to deacetylate PC. Controls fatty acid oxidation by inhibiting PPARA transcriptional activation. Impairs SIRT1-PPARA interaction probably through the regulation of NAD(+) levels. Down-regulates insulin secretion.

Subunit / interactions. Interacts with GLUD1, IDE and SLC25A5. Interacts with DLAT and PDHX. Interacts with MCCC1 (via the biotin carboxylation domain). Interacts with PCCA and PC.

Subcellular location. Mitochondrion matrix.

Tissue specificity. Detected in vascular smooth muscle and striated muscle. Detected in insulin-producing beta-cells in pancreas islets of Langerhans (at protein level). Widely expressed. Weakly expressed in leukocytes and fetal thymus.

Cofactor. Binds 1 zinc ion per subunit.

Induction. Induced by glutamine (at protein level).

Miscellaneous. Expression is down-regulated in a number of cancers, while overexpression reduces cell proliferation, transformation, and tumor development. According to some authors, ADP-ribosyltransferase activity of sirtuins may be an inefficient side reaction of the deacetylase activity and may not be physiologically relevant.

Similarity. Belongs to the sirtuin family. Class II subfamily.

RefSeq proteins (4): NP_001372662, NP_001372663, NP_001372664, NP_036372* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003000	Sirtuin	Family
IPR026587	Sirtuin_class_II	Family
IPR026590	Ssirtuin_cat_dom	Domain
IPR026591	Sirtuin_cat_small_dom_sf	Homologous_superfamily
IPR029035	DHS-like_NAD/FAD-binding_dom	Homologous_superfamily
IPR050134	NAD-dep_sirtuin_deacylases	Family

Pfam: PF02146

Catalyzed reactions (Rhea), 4 shown:

• N(6)-acetyl-L-lysyl-[protein] + NAD(+) + H2O = 2’’-O-acetyl-ADP-D-ribose + nicotinamide + L-lysyl-[protein] (RHEA:43636)
• L-cysteinyl-[protein] + NAD(+) = S-(ADP-D-ribosyl)-L-cysteinyl-[protein] + nicotinamide + H(+) (RHEA:56612)
• N(6)-[(R)-lipoyl]-L-lysyl-[protein] + NAD(+) + H2O = 2’’-O-lipoyl-ADP-D-ribose + nicotinamide + L-lysyl-[protein] (RHEA:63640)
• N(6)-biotinyl-L-lysyl-[protein] + NAD(+) + H2O = 2’’-O-biotinyl-ADP-D-ribose + nicotinamide + L-lysyl-[protein] (RHEA:70479)

UniProt features (14 total): binding site 9, transit peptide 1, chain 1, mutagenesis site 1, domain 1, active site 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9Y6E7-F1	90.44	0.84

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 161 (proton acceptor)

Ligand- & substrate-binding residues (9): 260–262; 286–288; 304; 62–82; 143–146; 169; 172; 220; 223

Mutagenesis-validated functional residues (1):

Position	Phenotype
161	abolishes inhibition of pdh complex activity.

Function

Pathways and Gene Ontology

Reactome pathways

8 pathways

ID	Pathway
R-HSA-204174	Regulation of pyruvate dehydrogenase (PDH) complex
R-HSA-2151201	Transcriptional activation of mitochondrial biogenesis
R-HSA-1428517	Aerobic respiration and respiratory electron transport
R-HSA-1430728	Metabolism
R-HSA-1592230	Mitochondrial biogenesis
R-HSA-1852241	Organelle biogenesis and maintenance
R-HSA-70268	Pyruvate metabolism
R-HSA-9861718	Regulation of pyruvate metabolism

MSigDB gene sets: 225 (showing top): PID_HDAC_CLASSI_PATHWAY, GOBP_LIPID_MODIFICATION, GOBP_NEGATIVE_REGULATION_OF_LIPID_METABOLIC_PROCESS, GOBP_ALPHA_AMINO_ACID_METABOLIC_PROCESS, GOBP_INSULIN_SECRETION, GRAESSMANN_APOPTOSIS_BY_SERUM_DEPRIVATION_UP, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GOBP_MACROMOLECULE_DEACYLATION, GOBP_REGULATION_OF_HORMONE_LEVELS, GOBP_NEGATIVE_REGULATION_OF_PEPTIDE_SECRETION, GOBP_HORMONE_TRANSPORT, GOBP_ORGANOPHOSPHATE_METABOLIC_PROCESS, GOBP_GLUTAMINE_FAMILY_AMINO_ACID_METABOLIC_PROCESS, GOBP_NUCLEOSIDE_PHOSPHATE_BIOSYNTHETIC_PROCESS, GOBP_MONOCARBOXYLIC_ACID_METABOLIC_PROCESS

GO Biological Process (13): obsolete regulation of glutamine family amino acid metabolic process (GO:0000820), L-glutamine metabolic process (GO:0006541), DNA damage response (GO:0006974), mitochondrion organization (GO:0007005), negative regulation of cardiac muscle cell apoptotic process (GO:0010667), peptidyl-lysine deacetylation (GO:0034983), negative regulation of fatty acid oxidation (GO:0046322), negative regulation of insulin secretion (GO:0046676), positive regulation of lipid biosynthetic process (GO:0046889), cellular response to hypoxia (GO:0071456), tricarboxylic acid metabolic process (GO:0072350), negative regulation of pyruvate decarboxylation to acetyl-CoA (GO:0160218), obsolete negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)

GO Molecular Function (17): NAD+ poly-ADP-ribosyltransferase activity (GO:0003950), histone deacetylase activity (GO:0004407), zinc ion binding (GO:0008270), nucleotidyltransferase activity (GO:0016779), lipoamidase activity (GO:0061690), NAD+ binding (GO:0070403), NAD-dependent protein lipoamidase activity (GO:0106419), NAD-dependent protein biotinidase activity (GO:0106420), NAD+-protein-cysteine ADP-ribosyltransferase activity (GO:0140803), NAD+-protein mono-ADP-ribosyltransferase activity (GO:1990404), protein binding (GO:0005515), transferase activity (GO:0016740), acyltransferase activity, transferring groups other than amino-acyl groups (GO:0016747), glycosyltransferase activity (GO:0016757), NAD-dependent protein lysine deacetylase activity (GO:0034979), metal ion binding (GO:0046872), NAD binding (GO:0051287)

GO Cellular Component (3): mitochondrion (GO:0005739), mitochondrial inner membrane (GO:0005743), mitochondrial matrix (GO:0005759)

Reactome top-level categories

Rollup of top-6 pathways:

Category	Pathways
Regulation of pyruvate metabolism	1
Mitochondrial biogenesis	1
Metabolism	1
Organelle biogenesis and maintenance	1
Aerobic respiration and respiratory electron transport	1
Pyruvate metabolism	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular response to stress	2
pentosyltransferase activity	2
acyltransferase activity, transferring groups other than amino-acyl groups	2
L-amino acid metabolic process	1
proteinogenic amino acid metabolic process	1
organelle organization	1
cardiac muscle cell apoptotic process	1
negative regulation of striated muscle cell apoptotic process	1
regulation of cardiac muscle cell apoptotic process	1
protein deacetylation	1
peptidyl-lysine modification	1
fatty acid oxidation	1
negative regulation of fatty acid metabolic process	1
regulation of fatty acid oxidation	1
insulin secretion	1
negative regulation of protein secretion	1
regulation of insulin secretion	1
negative regulation of peptide hormone secretion	1
lipid biosynthetic process	1
positive regulation of biosynthetic process	1
positive regulation of lipid metabolic process	1
regulation of lipid biosynthetic process	1
response to hypoxia	1
cellular response to decreased oxygen levels	1
carboxylic acid metabolic process	1
pyruvate decarboxylation to acetyl-CoA	1
regulation of pyruvate decarboxylation to acetyl-CoA	1
negative regulation of acetyl-CoA biosynthesis	1
protein lysine deacetylase activity	1
histone modifying activity	1
transition metal ion binding	1
transferase activity, transferring phosphorus-containing groups	1
hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides	1
anion binding	1
NAD binding	1
NAD+-protein mono-ADP-ribosyltransferase activity	1
catalytic activity, acting on a protein	1
binding	1
catalytic activity	1
acyltransferase activity	1

Protein interactions and networks

STRING

1554 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SIRT4	SIRT3	Q9NTG7	809
SIRT4	SLC25A5	P05141	790
SIRT4	GLUD1	P00367	763
SIRT4	SIRT2	Q8IXJ6	756
SIRT4	IDE	P14735	727
SIRT4	SIRT6	Q8N6T7	716
SIRT4	HDAC11	Q96DB2	709
SIRT4	SIRT5	Q9NXA8	677
SIRT4	PPARGC1A	Q9UBK2	648
SIRT4	HDAC9	Q9UKV0	646
SIRT4	PARP1	P09874	630
SIRT4	NAMPT	P43490	613
SIRT4	ACSS1	Q9NUB1	609
SIRT4	MLYCD	O95822	597
SIRT4	NDUFA9	Q16795	596

IntAct

27 interactions, top by confidence:

A	B	Type	Score
SIRT4	IDE	psi-mi:“MI:0914”(association)	0.620
DLAT	SIRT4	psi-mi:“MI:0403”(colocalization)	0.610
DLAT	SIRT4	psi-mi:“MI:0915”(physical association)	0.610
SIRT4	DLAT	psi-mi:“MI:0212”(lipoprotein cleavage reaction)	0.610
SIRT4	PDHX	psi-mi:“MI:0403”(colocalization)	0.560
SIRT4	PDHX	psi-mi:“MI:0914”(association)	0.560
SIRT4	PDHX	psi-mi:“MI:0212”(lipoprotein cleavage reaction)	0.560
SIRT4	AKT1	psi-mi:“MI:2364”(proximity)	0.470
BRAF	SIRT4	psi-mi:“MI:2364”(proximity)	0.470
SIRT4	AKT1	psi-mi:“MI:0915”(physical association)	0.470
BRAF	SIRT4	psi-mi:“MI:0915”(physical association)	0.470
SIRT4	SLC25A5	psi-mi:“MI:0915”(physical association)	0.400
SKP2	SIRT4	psi-mi:“MI:0915”(physical association)	0.400
SIRT4	VWA8	psi-mi:“MI:0914”(association)	0.350
SIRT4	SNX3	psi-mi:“MI:0914”(association)	0.350
SIRT4	NME2P1	psi-mi:“MI:0914”(association)	0.350
FBXW7	SIRT4	psi-mi:“MI:2364”(proximity)	0.270
SMAD4	SIRT4	psi-mi:“MI:2364”(proximity)	0.270
SPOP	SIRT4	psi-mi:“MI:2364”(proximity)	0.270
SIRT4	SPOP	psi-mi:“MI:2364”(proximity)	0.270
EGFR	SIRT4	psi-mi:“MI:2364”(proximity)	0.270
SIRT4	PTPN11	psi-mi:“MI:2364”(proximity)	0.270
SIRT4	PTEN	psi-mi:“MI:2364”(proximity)	0.270

BioGRID (27): HSPD1 (Affinity Capture-MS), NME2P1 (Affinity Capture-MS), SNX3 (Affinity Capture-MS), HSPD1 (Affinity Capture-MS), SNX3 (Affinity Capture-MS), FANCA (Affinity Capture-Luminescence), PTEN (Affinity Capture-MS), PTEN (Affinity Capture-Western), SIRT4 (Affinity Capture-Western), SIRT4 (Reconstituted Complex), PTEN (Reconstituted Complex), IDE (Affinity Capture-Western), SIRT4 (Affinity Capture-Western), NME2P1 (Affinity Capture-MS), HSPD1 (Affinity Capture-MS)

ESM2 similar proteins: A0A0J9UVG7, A0A250YGJ5, A0A2K5TU92, A0A559KX76, A8NWP2, C8V3W5, E1BRE2, E2RDZ6, E9GD30, F4P804, F7DKV7, F7EZ75, G5EB76, I1RN13, J4W6X9, O13492, P0CS88, P16081, P21334, P22945, P27783, P36842, P36858, P38681, P39863, P39869, P43100, P53686, P54898, P59941, Q3ZBQ0, Q57V41, Q59ST1, Q5AI90, Q5AW69, Q5HZN8, Q5R6G3, Q5RBF1, Q5RJQ4, Q68F47

Diamond homologs: A0QC96, A0QDH4, A0R2N3, A5U1J9, A8MBU4, A9SDL4, A9UVV1, B0RM75, B5YJW3, C1DBX3, E1BRE2, E9GD30, F4P804, F7D4X9, F7DKV7, F7EZ75, O07595, O28597, O30124, O58669, O67919, P0A2F2, P0A2F3, P66814, P9WGG2, P9WGG3, Q1JQC6, Q20480, Q20481, Q4JBN2, Q4QB33, Q4UZX0, Q57YZ9, Q5HU51, Q5HZN8, Q5JG47, Q5L014, Q5R6G3, Q5SIH7, Q5V4Q5

SIGNOR signaling

3 interactions.

A	Effect	B	Mechanism
SIRT4	“down-regulates activity”	GLUD1	glycosylation
SIRT4	“down-regulates activity”	GLUD2	glycosylation
ATF2	“down-regulates quantity by repression”	SIRT4	“transcriptional regulation”

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 16 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Ub-specific processing proteases	5	19.0×	1e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

59 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	45
Likely benign	4
Benign	2

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
4282506	NR_003137.3(RNU4-2):n.18_19insA	Pathogenic

SpliceAI

563 predictions. Top by Δscore:

Variant	Effect	Δscore
12:120312879:TGCA:T	acceptor_loss	1.0000
12:120312880:GCA:G	acceptor_loss	1.0000
12:120312882:A:AC	acceptor_loss	1.0000
12:120312883:GGTAT:G	acceptor_gain	1.0000
12:120302376:GAGGT:G	donor_loss	0.9900
12:120302377:AGGTA:A	donor_loss	0.9900
12:120303559:A:AG	acceptor_gain	0.9900
12:120303560:G:GG	acceptor_gain	0.9900
12:120312732:G:GA	donor_gain	0.9900
12:120312747:GCAG:G	donor_loss	0.9900
12:120312748:CAGG:C	donor_loss	0.9900
12:120312749:AGGT:A	donor_loss	0.9900
12:120312751:G:T	donor_loss	0.9900
12:120312882:A:AG	acceptor_gain	0.9900
12:120312883:G:GG	acceptor_gain	0.9900
12:120312883:GGT:G	acceptor_gain	0.9900
12:120312883:GGTA:G	acceptor_gain	0.9900
12:120302376:GAG:G	donor_gain	0.9800
12:120312583:G:C	acceptor_gain	0.9800
12:120312731:T:TA	donor_gain	0.9800
12:120312764:C:T	donor_gain	0.9800
12:120302374:GAGAG:G	donor_gain	0.9700
12:120302379:G:GG	donor_gain	0.9700
12:120303560:GA:G	acceptor_gain	0.9700
12:120303560:GAAT:G	acceptor_gain	0.9700
12:120303692:TCAAA:T	donor_gain	0.9700
12:120312454:AG:A	acceptor_gain	0.9700
12:120312455:GG:G	acceptor_gain	0.9700
12:120312582:A:AG	acceptor_gain	0.9700
12:120312583:G:GT	acceptor_gain	0.9700

AlphaMissense

2039 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
12:120312658:T:C	F234L	0.990
12:120312660:C:A	F234L	0.990
12:120312660:C:G	F234L	0.990
12:120303877:T:A	W106R	0.986
12:120303877:T:C	W106R	0.986
12:120303879:G:C	W106C	0.986
12:120303879:G:T	W106C	0.986
12:120303766:T:C	S69P	0.985
12:120303758:C:T	S66F	0.981
12:120312601:T:C	F215L	0.981
12:120312603:T:A	F215L	0.981
12:120312603:T:G	F215L	0.981
12:120312949:C:A	N286K	0.981
12:120312949:C:G	N286K	0.981
12:120303785:G:T	R75M	0.980
12:120303993:T:A	N144K	0.980
12:120303993:T:G	N144K	0.980
12:120303884:G:T	R108I	0.979
12:120312642:A:C	K228N	0.979
12:120312642:A:T	K228N	0.979
12:120312737:G:A	G260E	0.978
12:120303880:G:C	A107P	0.977
12:120303785:G:C	R75T	0.976
12:120303992:A:T	N144I	0.974
12:120304046:G:A	G162E	0.974
12:120303773:T:C	I71T	0.973
12:120303844:T:C	F95L	0.973
12:120303846:T:A	F95L	0.973
12:120303846:T:G	F95L	0.973
12:120303758:C:A	S66Y	0.972

dbSNP variants (sampled 300 via entrez): RS1000114305 (12:120291906 A>C,G,T), RS1000241736 (12:120291202 A>G), RS1000250371 (12:120302494 T>C,G), RS1000295953 (12:120310154 G>T), RS1000421232 (12:120308586 G>A), RS1000544694 (12:120298042 AG>A,AGG), RS1000724669 (12:120292398 C>T), RS1000829757 (12:120293079 AACTGCAAGAAAATTCAGTCTCCGTAGAG>A), RS1000842294 (12:120291681 A>G), RS1000901329 (12:120311526 G>A), RS1000951294 (12:120308316 C>G,T), RS1000953755 (12:120309430 G>T), RS1001151109 (12:120299325 G>A), RS1001338487 (12:120291655 A>C,G,T), RS1001350244 (12:120311886 A>G)

Disease associations

OMIM: gene MIM:604482 | disease phenotypes: MIM:620851, MIM:268000

GenCC curated gene-disease

Mondo (2): neurodevelopmental disorder with hypotonia, brain anomalies, distinctive facies, and absent language (MONDO:0971172), retinitis pigmentosa (MONDO:0019200)

Orphanet (2): RNU4-2-related autosomal dominant neurodevelopmental disorder (Orphanet:686488), Retinitis pigmentosa (Orphanet:791)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST008103_87	Bipolar disorder	1.000000e-06

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D012174	Retinitis Pigmentosa	C11.270.684; C11.768.585.658.500; C16.320.290.684

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL2163185 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

2 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 268,536 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL1140	NIACINAMIDE	4	231,688
CHEMBL265502	SURAMIN	3	36,848

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — 3.5.1.- Histone deacetylases (HDACs)

ChEMBL bioactivities

3 potent at pChembl≥5 of 15 total, top 3 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
6.05	IC50	900	nM	CHEMBL5574837
5.70	IC50	2000	nM	SURAMIN
5.00	IC50	1e+04	nM	CHEMBL5573193

PubChem BioAssay actives

3 with measured affinity, of 135 total; 3 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
2-[(6-chloro-1H-benzimidazol-2-yl)sulfanyl]-N-[5-(4-nitrophenyl)sulfonyl-1,3-thiazol-2-yl]-2-phenylacetamide	2099357: Inhibition of N-terminal His-tagged recombinant human Sirt4 (25 to 314 residues) expressed in Escherichia coli CodonPlus(DE3) cells using Fluo-HMG-Lys as substrate preincubated for 20 mins followed by NAM addition and measured after 45 mins in presence of NAD+ by fluorescence based assay	ic50	0.9000	uM
8-[[4-methyl-3-[[3-[[3-[[2-methyl-5-[(4,6,8-trisulfonaphthalen-1-yl)carbamoyl]phenyl]carbamoyl]phenyl]carbamoylamino]benzoyl]amino]benzoyl]amino]naphthalene-1,3,5-trisulfonic acid	2099385: Inhibition of N-terminal 6His-tagged human Sirt4 (25 to 314 residues) expressed in Escherichia coli CodonPlus(DE3) cells using HMG-FdL as substrate at 100 uM preincubated for 20 mins followed by NAM addition and measured after 45 mins in presence of NAD+ by fluorescence based assay relative to control	ic50	2.0000	uM
N-[5-(4-nitrophenyl)sulfonyl-1,3-thiazol-2-yl]-2-[(6-oxo-4-propyl-1H-pyrimidin-2-yl)sulfanyl]-2-phenylacetamide	2099357: Inhibition of N-terminal His-tagged recombinant human Sirt4 (25 to 314 residues) expressed in Escherichia coli CodonPlus(DE3) cells using Fluo-HMG-Lys as substrate preincubated for 20 mins followed by NAM addition and measured after 45 mins in presence of NAD+ by fluorescence based assay	ic50	10.0000	uM

CTD chemical–gene interactions

38 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, increases expression, increases methylation	3
bisphenol A	decreases methylation, affects cotreatment, increases expression	2
Cisplatin	affects expression, increases expression	2
Hydrogen Peroxide	affects expression, decreases expression	2
GSK-J4	decreases expression	1
tributyrin	increases expression	1
trichostatin A	increases expression	1
beta-lapachone	increases expression	1
sodium arsenite	decreases expression	1
butyraldehyde	increases expression	1
CGP 52608	affects binding, increases reaction	1
N-(oxo-5,6-dihydrophenanthridin-2-yl)-N,N-dimethylacetamide hydrochloride	decreases reaction, increases expression	1
nutlin 3	affects cotreatment, increases expression	1
abrine	increases expression	1
jinfukang	decreases expression	1
Decitabine	affects expression	1
Acetaminophen	increases expression	1
Amiodarone	increases expression	1
Camptothecin	increases expression	1
Dactinomycin	increases expression, affects cotreatment	1
Dichlorodiphenyl Dichloroethylene	decreases expression	1
Dexamethasone	increases expression, affects cotreatment	1
Ethyl Methanesulfonate	increases expression	1
Fluorouracil	increases expression	1
Formaldehyde	increases expression	1
Indomethacin	affects cotreatment, increases expression	1
Methyl Methanesulfonate	increases expression	1
Niacin	increases expression	1
Silicon Dioxide	decreases expression	1
Smoke	increases expression, increases secretion, decreases expression, affects localization, decreases reaction (+1 more)	1

ChEMBL screening assays

16 unique, capped per target: 16 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL2166870	Binding	Activity of recombinant human SIRT4 assessed as deacylation of compound at 50 uM after 1 hr by trypsin developer-based fluorescence assay	Substrates for efficient fluorometric screening employing the NAD-dependent sirtuin 5 lysine deacylase (KDAC) enzyme. — J Med Chem

Cellosaurus cell lines

5 cell lines: 5 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B8PF	Abcam HCT 116 SIRT4 KO	Cancer cell line	Male
CVCL_B9RT	Abcam A-549 SIRT4 KO	Cancer cell line	Male
CVCL_E0UZ	Ubigene Hep G2 SIRT4 KO	Cancer cell line	Male
CVCL_TL32	HAP1 SIRT4 (-) 1	Cancer cell line	Male
CVCL_TL33	HAP1 SIRT4 (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

234 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00717080	PHASE4	COMPLETED	The Role of Capsular Tension Ring (CTR) in Anterior Capsular Contraction
NCT00000114	PHASE3	COMPLETED	Randomized Trial of Vitamin A and Vitamin E Supplementation for Retinitis Pigmentosa
NCT00000116	PHASE3	COMPLETED	Randomized Trial of DHA for Retinitis Pigmentosa Patients Receiving Vitamin A
NCT00346333	PHASE3	COMPLETED	Clinical Trial of Lutein for Patients With Retinitis Pigmentosa Receiving Vitamin A
NCT01786395	PHASE3	TERMINATED	Phase III Efficacy and Safety Clinical Study of UF-021 for Treatment of Retinitis Pigmentosa
NCT04224207	PHASE3	COMPLETED	Management of Retinitis Pigmentosa by Mesenchymal Stem Cells by Wharton’s Jelly Derived Mesenchymal Stem Cells
NCT04636853	PHASE3	COMPLETED	CB-PRP in Retinitis Pigmentosa and Dry Age-related Macular Degeneration
NCT05537220	PHASE3	ACTIVE_NOT_RECRUITING	Oral N-acetylcysteine for Retinitis Pigmentosa
NCT05800301	PHASE3	COMPLETED	Management of Retinitis Pigmentosa Via Combination of Wharton’s Jelly-derived Mesenchymal Stem Cells and Magnovision
NCT05926583	PHASE3	ACTIVE_NOT_RECRUITING	A Study of AAV5-hRKp.RPGR for the Treatment of Japanese Participants With X-linked Retinitis Pigmentosa
NCT06388200	PHASE3	ACTIVE_NOT_RECRUITING	A Phase 3 Study Of OCU400 Gene Therapy for the Treatment Of Retinitis Pigmentosa
NCT07082855	PHASE3	NOT_YET_RECRUITING	A Multicenter, Randomized, Double-Blind, Controlled Clinical Study of Minocycline for the Treatment of Retinitis Pigmentosa
NCT07290530	PHASE3	NOT_YET_RECRUITING	24-Month Trial of NPI-001 for the Preservation of Photoreceptors in Retinitis Pigmentosa Associated With Usher Syndrome
NCT00100230	PHASE2	COMPLETED	DHA and X-Linked Retinitis Pigmentosa
NCT00447980	PHASE2	COMPLETED	A Study of Encapsulated Cell Technology (ECT) Implant for Participants With Early Stage Retinitis Pigmentosa
NCT00447993	PHASE2	COMPLETED	A Study of Encapsulated Cell Technology (ECT) Implant for Patients With Late Stage Retinitis Pigmentosa
NCT01233609	PHASE2	COMPLETED	Trial of Oral Valproic Acid for Retinitis Pigmentosa
NCT01399515	PHASE2	COMPLETED	Efficacy and Safety of Oral Valproic Acid for Retinitis Pigmentosa
NCT01530659	PHASE2	COMPLETED	Retinal Imaging in CNTF -Releasing Encapsulated Cell Implant Treated Patients for Early-stage Retinitis Pigmentosa
NCT01560715	PHASE2	COMPLETED	Autologous Bone Marrow-Derived Stem Cells Transplantation For Retinitis Pigmentosa
NCT02609165	PHASE2	COMPLETED	Nerve Growth Factor Eye Drops Treatment in Patients With Retinitis Pigmentosa and Cystoid Macular Edema
NCT02661711	PHASE2	COMPLETED	Aflibercept for Macular Oedema With Underlying Retinitis Pigmentosa (AMOUR) Study
NCT02804360	PHASE2	UNKNOWN	Intravitreal Dexamethasone Implant in Retinitis Pigmentosa-related Macular Edema- a Retrospective Study
NCT02837640	PHASE2	UNKNOWN	Studying a Potential Protective Effect of L-Dopa on Retinitis Pigmentosa
NCT03073733	PHASE2	COMPLETED	Safety and Efficacy of Intravitreal Injection of Human Retinal Progenitor Cells in Adults With Retinitis Pigmentosa
NCT04068207	PHASE2	COMPLETED	Minocycline Treatment in Retinitis Pigmentosa
NCT04356716	PHASE2	COMPLETED	Sildenafil for Treatment of Choroidal Ischemia
NCT04604899	PHASE2	COMPLETED	Safety of Repeat Intravitreal Injection of Human Retinal Progenitor Cells (jCell) in Adult Subjects With Retinitis Pigmentosa
NCT04763369	PHASE2	UNKNOWN	Investigation of Therapeutic Efficacy and Safety of UMSCs for the Management of Retinitis Pigmentosa (RP)
NCT04864496	PHASE2	UNKNOWN	Effects of Treatment With N- Acetylcysteine on Visual Outcomes in Patients With Retinitis Pigmentosa
NCT04945772	PHASE2	COMPLETED	Efficacy and Safety of MCO-010 Optogenetic Therapy in Adults With Retinitis Pigmentosa [RESTORE]
NCT05085964	PHASE2	TERMINATED	An Open-Label Extension Study to Evaluate Safety & Tolerability of QR-421a in Subjects With Retinitis Pigmentosa
NCT05392179	PHASE2	COMPLETED	A Study in Subjects With Retinitis Pigmentosa
NCT06627179	PHASE2	RECRUITING	Study to Evaluate Ultevursen in Subjects With Retinitis Pigmentosa (RP) Due to Mutations in Exon 13 of the USH2A Gene
NCT06628947	PHASE2	RECRUITING	A Phase II Study of Intravitreal KIO-301 in Patients With Late-stage Retinitis Pigmentosa
NCT06912633	PHASE2	RECRUITING	Safety of a Single, Intravitreal Injection of 6.0M jCell (Famzeretcel) in Retinitis Pigmentosa (RP)
NCT00063765	PHASE1	COMPLETED	Evaluation of Safety of Ciliary Neurotrophic Factor Implants in the Eye
NCT00065455	PHASE1	COMPLETED	Investigating the Effect of Vitamin A Supplementation on Retinitis Pigmentosa
NCT00458575	PHASE1	TERMINATED	A Study to Evaluate the Safety of CNTO 2476 in Patients With Advanced Retinitis Pigmentosa
NCT01068561	PHASE1	COMPLETED	Autologous Bone Marrow-Derived Stem Cells Transplantation For Retinitis Pigmentosa