SKI

Summary

SKI (SKI proto-oncogene, HGNC:10896) is a protein-coding gene on chromosome 1p36.33-p36.32, encoding Ski oncogene (P12755). May play a role in terminal differentiation of skeletal muscle cells but not in the determination of cells to the myogenic lineage.

This gene encodes the nuclear protooncogene protein homolog of avian sarcoma viral (v-ski) oncogene. It functions as a repressor of TGF-beta signaling, and may play a role in neural tube development and muscle differentiation.

Source: NCBI Gene 6497 — RefSeq curated summary.

At a glance

• Gene–disease (curated): Shprintzen-Goldberg syndrome (Definitive, ClinGen)
• GWAS associations: 16
• Clinical variants (ClinVar): 1,440 total — 17 pathogenic, 10 likely-pathogenic
• Phenotypes (HPO): 166
• Dosage sensitivity (ClinGen): haploinsufficiency no evidence, triplosensitivity no evidence
• MANE Select transcript: NM_003036

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:10896
Approved symbol	SKI
Name	SKI proto-oncogene
Location	1p36.33-p36.32
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000157933
Ensembl biotype	protein_coding
OMIM	164780
Entrez	6497

Gene structure

Transcript identifiers

Ensembl transcripts: 6 — 3 protein_coding_CDS_not_defined, 2 protein_coding, 1 retained_intron

ENST00000378536, ENST00000478223, ENST00000507179, ENST00000508416, ENST00000704337, ENST00000851187

RefSeq mRNA: 1 — MANE Select: NM_003036 NM_003036

CCDS: CCDS39

Canonical transcript exons

ENST00000378536 — 7 exons

Exon	Start	End
ENSE00001035943	2303285	2303400
ENSE00001035948	2303840	2304102
ENSE00001035949	2304293	2304585
ENSE00001035950	2306020	2306250
ENSE00001477851	2306577	2310213
ENSE00001477855	2228319	2229735
ENSE00003563482	2302978	2303103

Expression profiles

Bgee: expression breadth ubiquitous, 268 present calls, max score 97.31.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 30.0856 / max 477.9542, expressed in 1789 samples.

FANTOM5 promoters (9 alternative TSS)

Promoter ID	TPM avg	Samples expressed
196	28.8666	1787
195	0.4682	234
208	0.2563	96
197	0.1875	78
198	0.1087	32
201320	0.0830	41
209	0.0691	6
201	0.0375	8
207	0.0088	3

Top tissues by expression

294 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
nipple	UBERON:0002030	97.31	gold quality
right hemisphere of cerebellum	UBERON:0014890	97.03	gold quality
cerebellar hemisphere	UBERON:0002245	97.02	gold quality
cerebellar cortex	UBERON:0002129	96.85	gold quality
urethra	UBERON:0000057	96.67	gold quality
decidua	UBERON:0002450	96.02	gold quality
descending thoracic aorta	UBERON:0002345	95.64	gold quality
popliteal artery	UBERON:0002250	95.51	gold quality
tibial artery	UBERON:0007610	95.50	gold quality
cerebellum	UBERON:0002037	95.49	gold quality
aorta	UBERON:0000947	95.41	gold quality
sural nerve	UBERON:0015488	95.33	gold quality
thoracic aorta	UBERON:0001515	95.29	gold quality
ascending aorta	UBERON:0001496	95.25	gold quality
lower lobe of lung	UBERON:0008949	95.15	gold quality
saphenous vein	UBERON:0007318	95.06	gold quality
right coronary artery	UBERON:0001625	94.86	gold quality
synovial joint	UBERON:0002217	94.72	gold quality
mammary duct	UBERON:0001765	94.56	gold quality
penis	UBERON:0000989	93.81	gold quality
coronary artery	UBERON:0001621	93.67	gold quality
left coronary artery	UBERON:0001626	93.49	gold quality
upper leg skin	UBERON:0004262	93.33	gold quality
seminal vesicle	UBERON:0000998	93.01	gold quality
inferior vagus X ganglion	UBERON:0005363	92.74	gold quality
cortical plate	UBERON:0005343	92.55	gold quality
mucosa of stomach	UBERON:0001199	92.51	gold quality
lower esophagus muscularis layer	UBERON:0035833	92.51	gold quality
lower esophagus	UBERON:0013473	92.48	gold quality
left uterine tube	UBERON:0001303	92.37	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	7.13

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

260 targeting SKI, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4692	100.00	67.32	2066
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-4533	100.00	69.48	2758
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-4747-5P	100.00	67.90	2681
HSA-MIR-5196-5P	100.00	67.98	2761
HSA-MIR-29A-3P	100.00	73.11	1835
HSA-MIR-29B-3P	100.00	73.18	1833
HSA-MIR-29C-3P	100.00	73.15	1833
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-5692B	100.00	71.32	2622
HSA-MIR-5692C	100.00	71.32	2622
HSA-MIR-4514	99.99	67.10	1870
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-33A-5P	99.99	68.62	1055
HSA-MIR-33B-5P	99.99	68.58	1062
HSA-MIR-3185	99.99	68.12	1959
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-5696	99.98	72.36	4487
HSA-MIR-32-5P	99.98	75.21	1964
HSA-MIR-363-3P	99.98	74.72	1821
HSA-MIR-367-3P	99.98	74.83	1819
HSA-MIR-92A-3P	99.98	75.21	1960
HSA-MIR-92B-3P	99.98	75.25	1955
HSA-MIR-25-3P	99.98	74.60	1817

Functional genomics

ClinGen dosage: haploinsufficiency 0 (no evidence), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 40)

• c-Jun associates with the oncoprotein Ski and suppresses Smad2 transcriptional activity (PMID:12034730)
• determined the crystal structure of a complex between a conserved Smad4 binding fragment of Ski and the MH2 domain of Smad4 at 2.85 A resolution (PMID:12419246)
• the ability of Ski and SnoN to repress the growth inhibitory function of the Smad proteins is required for their transforming activity. (PMID:12764135)
• I discuss the basis for repression of intracellular TGF-beta signaling by SKI, some additional activities of this protein, and propose that by disrupting multiple tumor suppressor pathways, SKI functions as a melanoma oncogene. (PMID:12793438)
• c-ski and HIPK2 play an important role in the negative regulation of BMP-induced transcriptional activation (PMID:12874272)
• SKI regulates crucial events required for melanoma growth, survival, and invasion. (PMID:14583455)
• c-Ski protein has a role as a transcriptional co-repressor in TGF-beta signaling in esophageal squamous cell carcinoma (PMID:14712482)
• These results suggest that stabilization of inactive Smad complexes on DNA is a critical event in c-Ski-mediated inhibition of TGF-beta signaling. (PMID:15107821)
• Our data suggest that regulated proteolysis of Ski is one of the key mechanisms that control the threshold levels of this proto-oncoprotein, and thus prevents epithelial cells from becoming TGF-beta resistant. (PMID:15122324)
• ski is repressed by Smad7 (PMID:15128733)
• Functional Ski overexpression inhibits TGF-beta-mediated proliferation and prevents growth-arrested Schwann cells from reentering the cell cycle. (PMID:15312649)
• Ski cooperates in the process of transformation in erythroid cells by interfering with GATA1 function (PMID:15542823)
• Ski’s increased level and specific relocalization during mitosis (PMID:15806149)
• a novel polymorphism of the SKI gene was found to be associated with a decreased risk for orofacial defects (PMID:16054854)
• Ski seems to be involved in the blocking of differentiation in AML via inhibition of RARalpha signaling (PMID:16424870)
• subcellular localization of c-Ski may be regulated by proteasome-sensitive processes through amino acid residues 94-210 and 491-548 (PMID:17054724)
• These results indicate that impaired competition with p300 is the possible cause of dysfunction of c-Ski/SnoN in scleroderma fibroblasts and that this might contribute to maintenance of the autocrine TGFbeta loop in this disease. (PMID:17469184)
• Inhibition of Ski through RNA interference restored TGF-beta signaling and growth inhibition in vitro, and decreased tumor growth in vivo. (PMID:17592292)
• Ski-mediated repression of PU.1 is due to Ski’s ability to recruit histone deacetylase 3 to PU.1 bound to DNA. (PMID:17621263)
• Ski and SnoN proteins are overexpressed in Barrett’s esophagus (PMID:18261624)
• The ability of TGF-beta to induce degradation of Ski could be an additional mechanism contributing to its protumorigenic activity. (PMID:18451154)
• Ski is expressed in patients with acute myeloid leukemia treated with all-trans retinoic acid (PMID:18508800)
• c-Ski and SnoN, mediators in TGF-beta resistance, might be implicated in melanoma growth and progression. (PMID:18782659)
• These results indicate that Ski complexes serve to maintain a TGF-beta-responsive promoter at a repressed basal level via the activities of histone deacetylase and histone arginine methyltransferase. (PMID:19032343)
• SKI and MEL1 knockdown synergistically restored TGF-beta responsiveness in MKN28 cells and reduced tumor growth in vivo (PMID:19049980)
• SnoN and Ski were overexpressed both in adenomas with severe dysplasia and colorectal carcinomas. (PMID:19096149)
• This study explores the association of STRA6 and SKI genes in a cohort of subjects with anophthalmia and microphthalmia. (PMID:19112531)
• Ski can stabilize RARalpha and HDAC3 thus Ski represses retinoic acid signaling by stabilizing corepressor complex. (PMID:19341714)
• Ski may act as a tumor proliferation-promoting factor or as a metastatic suppressor in human pancreatic cancer. (PMID:19546161)
• c-Ski overexpression promotes the growth of diffuse-type gastric carcinoma through induction of angiogenesis (PMID:19594546)
• Results indicate that SKI exploits multiple regulatory levels of the TGF-beta pathway and its deficiency restores TGF-beta tumor suppressor and apoptotic activities in spite of the likely presence of oncogenic mutations in melanoma tumors. (PMID:19845874)
• Akt modulates TGF-beta signaling by temporarily adjusting the levels of two TGF-beta pathway negative regulators, Ski and Smad7 (PMID:19875456)
• findings show that Arkadia regulates the levels of expression of c-Ski protein in cell-type-dependent fashion, and exhibits a tumour suppressor function by inhibiting tumour cell growth (PMID:19959502)
• SKI promotes the switch of Smad3 from repressor of proliferation to activator of oncogenesis by facilitating phosphorylations in the linker domain. (PMID:20404506)
• Results identified serine 515 as a phosphorylation site of c-Ski which affects its electrophoretic motility. (PMID:20624875)
• the results suggest that association with Ski leads to inhibition of Siah2 E3 ubiquitin ligase activity and in this way, the Ski protein inhibits Siah2-mediated proteasomal degradation of HDAC3. (PMID:20691163)
• These results suggest that c-Ski is likely involved in the carcinogenesis of CCA induced by O. viverrini infection (PMID:20853076)
• c-Ski overexpression is associated with tumor progression. (PMID:20959473)
• Ski correlated with poor survival in the patients with TGF-beta-positive advanced gastric cancer. (PMID:21107877)
• Suppression of p53 activity through the cooperative action of Ski and histone deacetylase SIRT1. (PMID:21149449)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	skia	ENSDARG00000042151
mus_musculus	Ski	ENSMUSG00000029050
rattus_norvegicus	Ski	ENSRNOG00000055340

Paralogs (3): SKIL (ENSG00000136603), SKOR1 (ENSG00000188779), SKOR2 (ENSG00000215474)

Protein

Protein identifiers

Ski oncogene — P12755 (reviewed: P12755)

Alternative names: Proto-oncogene c-Ski

All UniProt accessions (1): P12755

UniProt curated annotations — full annotation on UniProt →

Function. May play a role in terminal differentiation of skeletal muscle cells but not in the determination of cells to the myogenic lineage. Functions as a repressor of TGF-beta signaling.

Subunit / interactions. Interacts with SMAD2, SMAD3 and SMAD4. Interacts with HIPK2. Part of a complex with HIPK2 and SMAD1/2/3. Interacts with PRDM16 and SMAD3; the interaction with PRDM16 promotes the recruitment SMAD3-HDAC1 complex on the promoter of TGF-beta target genes.

Subcellular location. Nucleus.

Post-translational modifications. Ubiquitinated by ARK2C, promoting proteasomal degradation, leading to enhance the BMP-Smad signaling.

Disease relevance. Shprintzen-Goldberg craniosynostosis syndrome (SGS) [MIM:182212] A very rare syndrome characterized by a marfanoid habitus, craniosynostosis, characteristic dysmorphic facial features, skeletal and cardiovascular abnormalities, intellectual disability, developmental delay and learning disabilities. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the SKI family.

RefSeq proteins (1): NP_003027* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003380	SKI/SNO/DAC	Domain
IPR009061	DNA-bd_dom_put_sf	Homologous_superfamily
IPR010919	SAND-like_dom_sf	Homologous_superfamily
IPR014890	c-SKI_SMAD4-bd_dom	Domain
IPR023216	Tscrpt_reg_SKI_SnoN	Family
IPR037000	Ski_DNA-bd_sf	Homologous_superfamily
IPR047315	DHD_Ski	Domain

Pfam: PF02437, PF08782

UniProt features (49 total): sequence variant 16, helix 11, strand 8, modified residue 4, turn 3, compositionally biased region 3, region of interest 2, chain 1, coiled-coil region 1

Structure

Experimental structures (PDB)

4 structures.

PDB	Method	Resolution (Å)
1SBX	X-RAY DIFFRACTION	1.65
5XOD	X-RAY DIFFRACTION	1.85
6ZVQ	X-RAY DIFFRACTION	2.03
1MR1	X-RAY DIFFRACTION	2.85

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P12755-F1	67.18	0.37

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (4): 720, 383, 432, 480

Function

Pathways and Gene Ontology

Reactome pathways

9 pathways

ID	Pathway
R-HSA-201451	Signaling by BMP
R-HSA-2173795	Downregulation of SMAD2/3:SMAD4 transcriptional activity
R-HSA-162582	Signal Transduction
R-HSA-170834	Signaling by TGF-beta Receptor Complex
R-HSA-212436	Generic Transcription Pathway
R-HSA-2173793	Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer
R-HSA-73857	RNA Polymerase II Transcription
R-HSA-74160	Gene expression (Transcription)
R-HSA-9006936	Signaling by TGFB family members

MSigDB gene sets: 738 (showing top): GSE45365_CTRL_VS_MCMV_INFECTION_NK_CELL_UP, GOBP_SMAD_PROTEIN_SIGNAL_TRANSDUCTION, GOBP_MORPHOGENESIS_OF_AN_EPITHELIUM, TGGTGCT_MIR29A_MIR29B_MIR29C, GOBP_REGULATION_OF_CELLULAR_RESPONSE_TO_GROWTH_FACTOR_STIMULUS, GOBP_EMBRYO_DEVELOPMENT_ENDING_IN_BIRTH_OR_EGG_HATCHING, GOBP_EPITHELIUM_DEVELOPMENT, GOBP_NEGATIVE_REGULATION_OF_CELL_DEVELOPMENT, GOBP_BODY_MORPHOGENESIS, GOBP_SOMATIC_STEM_CELL_POPULATION_MAINTENANCE, GOBP_MUSCLE_TISSUE_DEVELOPMENT, GOBP_AXIS_SPECIFICATION, REACTOME_SIGNALING_BY_TGF_BETA_RECEPTOR_COMPLEX, GOBP_SKELETAL_SYSTEM_DEVELOPMENT, TGCACTT_MIR519C_MIR519B_MIR519A

GO Biological Process (33): negative regulation of transcription by RNA polymerase II (GO:0000122), neural tube closure (GO:0001843), lens morphogenesis in camera-type eye (GO:0002089), transforming growth factor beta receptor signaling pathway (GO:0007179), negative regulation of cell population proliferation (GO:0008285), anterior/posterior axis specification (GO:0009948), negative regulation of Schwann cell proliferation (GO:0010626), myotube differentiation (GO:0014902), olfactory bulb development (GO:0021772), myelination in peripheral nervous system (GO:0022011), positive regulation of Wnt signaling pathway (GO:0030177), embryonic limb morphogenesis (GO:0030326), negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512), negative regulation of BMP signaling pathway (GO:0030514), negative regulation of activin receptor signaling pathway (GO:0032926), somatic stem cell population maintenance (GO:0035019), camera-type eye development (GO:0043010), positive regulation of DNA binding (GO:0043388), nose morphogenesis (GO:0043585), negative regulation of osteoblast differentiation (GO:0045668), positive regulation of transcription by RNA polymerase II (GO:0045944), negative regulation of fibroblast proliferation (GO:0048147), camera-type eye morphogenesis (GO:0048593), skeletal muscle fiber development (GO:0048741), cell motility (GO:0048870), roof of mouth development (GO:0060021), cardiac muscle cell proliferation (GO:0060038), retina development in camera-type eye (GO:0060041), face morphogenesis (GO:0060325), bone morphogenesis (GO:0060349), negative regulation of SMAD protein signal transduction (GO:0060392), regulation of neurogenesis (GO:0050767), muscle structure development (GO:0061061)

GO Molecular Function (12): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), DNA-binding transcription repressor activity, RNA polymerase II-specific (GO:0001227), zinc ion binding (GO:0008270), protein kinase binding (GO:0019901), protein domain specific binding (GO:0019904), ubiquitin protein ligase binding (GO:0031625), identical protein binding (GO:0042802), SMAD binding (GO:0046332), histone deacetylase inhibitor activity (GO:0046811), DNA-binding transcription factor binding (GO:0140297), protein binding (GO:0005515)

GO Cellular Component (9): nucleus (GO:0005634), nucleoplasm (GO:0005654), transcription regulator complex (GO:0005667), cytoplasm (GO:0005737), centrosome (GO:0005813), nuclear body (GO:0016604), PML body (GO:0016605), transcription repressor complex (GO:0017053), protein-containing complex (GO:0032991)

Reactome top-level categories

Rollup of top-7 pathways:

Category	Pathways
Signaling by TGFB family members	2
Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer	1
RNA Polymerase II Transcription	1
Signaling by TGF-beta Receptor Complex	1
Generic Transcription Pathway	1
Gene expression (Transcription)	1
Signal Transduction	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
negative regulation of transmembrane receptor protein serine/threonine kinase signaling pathway	3
RNA polymerase II transcription regulatory region sequence-specific DNA binding	3
protein binding	3
regulation of transcription by RNA polymerase II	2
cellular anatomical structure	2
transcription by RNA polymerase II	1
negative regulation of DNA-templated transcription	1
primary neural tube formation	1
tube closure	1
lens development in camera-type eye	1
anatomical structure morphogenesis	1
camera-type eye morphogenesis	1
cellular response to transforming growth factor beta stimulus	1
transforming growth factor beta receptor superfamily signaling pathway	1
cell population proliferation	1
regulation of cell population proliferation	1
negative regulation of cellular process	1
axis specification	1
anterior/posterior pattern specification	1
regulation of Schwann cell proliferation	1
Schwann cell proliferation	1
negative regulation of glial cell proliferation	1
striated muscle cell differentiation	1
olfactory lobe development	1
anatomical structure development	1
Schwann cell development	1
peripheral nervous system axon ensheathment	1
myelination	1
positive regulation of signal transduction	1
Wnt signaling pathway	1
regulation of Wnt signaling pathway	1
limb morphogenesis	1
embryonic appendage morphogenesis	1
transforming growth factor beta receptor signaling pathway	1
regulation of transforming growth factor beta receptor signaling pathway	1
BMP signaling pathway	1
regulation of BMP signaling pathway	1
negative regulation of cellular response to growth factor stimulus	1
activin receptor signaling pathway	1
regulation of activin receptor signaling pathway	1

Protein interactions and networks

STRING

1039 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SKI	SELENON	Q9NZV5	587
SKI	SNW1	Q13573	580
SKI	NCOR1	O75376	512
SKI	SMAD4	Q13485	443
SKI	TPM3	P06753	425
SKI	TP73	O15350	389
SKI	SMAD3	P84022	386
SKI	ACTA1	P02568	385
SKI	BEST2	Q8NFU1	369
SKI	HHAT	Q5VTY9	366
SKI	CREBRF	Q8IUR6	359
SKI	MECP2	P51608	347
SKI	FIBCD1	Q8N539	345
SKI	SMAD2	Q15796	330
SKI	RPP21	Q9H633	328

IntAct

76 interactions, top by confidence:

A	B	Type	Score
SKI	SMAD4	psi-mi:“MI:0915”(physical association)	0.940
SMAD4	SKI	psi-mi:“MI:0407”(direct interaction)	0.940
SKI	SMAD4	psi-mi:“MI:0914”(association)	0.940
SMAD4	SKI	psi-mi:“MI:0915”(physical association)	0.940
SMAD4	SKI	psi-mi:“MI:0914”(association)	0.940
SKI	SMAD2	psi-mi:“MI:0915”(physical association)	0.870
SKI	SMAD3	psi-mi:“MI:0914”(association)	0.840
SKI	SMAD3	psi-mi:“MI:0915”(physical association)	0.840
SKI	SMAD3	psi-mi:“MI:2364”(proximity)	0.840
SMAD3	SKI	psi-mi:“MI:0407”(direct interaction)	0.840
SMAD4	SMAD9	psi-mi:“MI:0914”(association)	0.750
NCOR1	SKI	psi-mi:“MI:0915”(physical association)	0.670
SKI	NCOR1	psi-mi:“MI:0914”(association)	0.670
SIN3A	SKI	psi-mi:“MI:0915”(physical association)	0.640
RALBP1	JUN	psi-mi:“MI:0914”(association)	0.640
SKI	Fam89b	psi-mi:“MI:0915”(physical association)	0.640
Fam89b	SKI	psi-mi:“MI:0915”(physical association)	0.640
Fam89b	SKI	psi-mi:“MI:0403”(colocalization)	0.640

BioGRID (300): SMAD3 (Affinity Capture-Western), SMAD4 (Affinity Capture-Western), SKI (Affinity Capture-Western), SKI (Two-hybrid), SKI (Affinity Capture-MS), SKI (Affinity Capture-MS), LATS2 (Affinity Capture-Western), STK38 (Affinity Capture-Western), STK38L (Affinity Capture-Western), SMAD3 (Affinity Capture-Western), MERTK (Affinity Capture-Western), SAV1 (Affinity Capture-Western), MOB1A (Affinity Capture-Western), MOB1B (Affinity Capture-Western), SKI (Affinity Capture-Western)

ESM2 similar proteins: A0A088MLT8, A2AQ25, B3KU38, B5DF41, E9PSK7, O15079, O35274, P0DPB3, P0DPB4, P12755, P49140, P85299, Q0D2I5, Q14DQ1, Q1LY51, Q3B7M3, Q3SYW5, Q4KMA0, Q4R3X1, Q50H33, Q5F3L9, Q5FVG6, Q5RD40, Q5XKK7, Q60698, Q6ZNC4, Q6ZUS6, Q6ZWB6, Q80U23, Q80U62, Q80XA6, Q812A5, Q86YI8, Q8BXL9, Q8K2W6, Q8ND83, Q8NFH8, Q8QFX1, Q8TEK3, Q924W7

Diamond homologs: A7M7C7, P12755, P12757, P17863, P49140, P84550, P84551, Q02225, Q1LXZ9, Q2VWA4, Q5R431, Q60665, Q60698, Q8BX46, Q9TUG2, Q925Q8, Q96NX9

SIGNOR signaling

16 interactions.

A	Effect	B	Mechanism
RNF111	down-regulates	SKI	ubiquitination
PRDM16	up-regulates	SKI	binding
AKT	down-regulates	SKI	phosphorylation
SKI	down-regulates	SMAD1	binding
SKI	“down-regulates activity”	SMAD2	binding
SKI	“down-regulates activity”	SMAD3	binding
SKI	“down-regulates activity”	SMAD4	binding
AKT1	down-regulates	SKI	phosphorylation
SKI	“down-regulates activity”	SMAD2/SMAD4	binding
SKI	“down-regulates activity”	SMAD3/SMAD4	binding
SKI	down-regulates	EP300	binding
SKI	down-regulates	SMAD5	binding
AURKA	“down-regulates quantity by destabilization”	SKI	phosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 52 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer	5	52.6×	2e-06
Downregulation of SMAD2/3:SMAD4 transcriptional activity	5	52.6×	2e-06
Signaling by TGF-beta Receptor Complex	5	28.6×	2e-05
Regulation of lipid metabolism by PPARalpha	5	20.1×	9e-05
Signaling by TGFB family members	6	19.8×	2e-05
Deubiquitination	5	17.7×	2e-04
Diseases of signal transduction by growth factor receptors and second messengers	6	9.7×	4e-04
Ub-specific processing proteases	6	9.1×	6e-04

GO biological processes:

GO term	Partners	Fold	FDR
SMAD protein signal transduction	6	102.2×	1e-08
transforming growth factor beta receptor signaling pathway	7	25.9×	2e-06
anatomical structure morphogenesis	6	19.4×	8e-05
in utero embryonic development	7	11.7×	2e-04
transcription by RNA polymerase II	5	8.2×	7e-03
proteasome-mediated ubiquitin-dependent protein catabolic process	6	7.3×	4e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

1440 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	17
Likely pathogenic	10
Uncertain significance	648
Likely benign	600
Benign	26

Top pathogenic / likely-pathogenic (27)

Variant ID	HGVS	Classification
1319166	NM_003036.4(SKI):c.953dup (p.Arg319fs)	Pathogenic
2202692	NM_003036.4(SKI):c.82T>A (p.Ser28Thr)	Pathogenic
2225761	NM_003036.4(SKI):c.100G>C (p.Gly34Arg)	Pathogenic
224869	NM_003036.4(SKI):c.62T>G (p.Leu21Arg)	Pathogenic
37259	NM_003036.4(SKI):c.94C>G (p.Leu32Val)	Pathogenic
37260	NM_003036.4(SKI):c.101G>A (p.Gly34Asp)	Pathogenic
37262	NM_003036.4(SKI):c.100G>T (p.Gly34Cys)	Pathogenic
37263	NM_003036.4(SKI):c.283_291del (p.Asp95_Ser97del)	Pathogenic
39783	NM_003036.4(SKI):c.101G>T (p.Gly34Val)	Pathogenic
39784	NM_003036.4(SKI):c.280_291del (p.Ser94_Ser97del)	Pathogenic
39785	NM_003036.4(SKI):c.104C>A (p.Pro35Gln)	Pathogenic
39786	NM_003036.4(SKI):c.103C>T (p.Pro35Ser)	Pathogenic
4075258	NM_003036.4(SKI):c.59C>G (p.Thr20Arg)	Pathogenic
409969	NM_003036.4(SKI):c.59C>T (p.Thr20Met)	Pathogenic
463409	NM_003036.4(SKI):c.638_895del (p.Leu213_Ala298del)	Pathogenic
692060	NM_003036.4(SKI):c.91T>C (p.Ser31Pro)	Pathogenic
944376	NM_003036.4(SKI):c.265C>T (p.Pro89Ser)	Pathogenic
1679387	NM_003036.4(SKI):c.106G>C (p.Ala36Pro)	Likely pathogenic
1695374	NM_003036.4(SKI):c.350G>A (p.Gly117Asp)	Likely pathogenic
1699134	NM_003036.4(SKI):c.1026del (p.Gln342fs)	Likely pathogenic
1709127	NM_003036.4(SKI):c.103C>G (p.Pro35Ala)	Likely pathogenic
213703	NM_003036.4(SKI):c.499_500delinsGG (p.Leu167Gly)	Likely pathogenic
3340191	NM_003036.4(SKI):c.218T>G (p.Val73Gly)	Likely pathogenic
3376870	NM_003036.4(SKI):c.832dup (p.Ser278fs)	Likely pathogenic
3686637	NM_003036.4(SKI):c.104C>T (p.Pro35Leu)	Likely pathogenic
570752	NM_003036.4(SKI):c.68A>C (p.Gln23Pro)	Likely pathogenic
984609	NM_003036.4(SKI):c.91T>G (p.Ser31Ala)	Likely pathogenic

SpliceAI

2322 predictions. Top by Δscore:

Variant	Effect	Δscore
1:2229735:GGT:G	donor_loss	1.0000
1:2229736:G:GG	donor_gain	1.0000
1:2302973:CGCA:C	acceptor_loss	1.0000
1:2302974:GCAG:G	acceptor_loss	1.0000
1:2302976:A:AG	acceptor_gain	1.0000
1:2302977:G:GC	acceptor_loss	1.0000
1:2302977:G:GG	acceptor_gain	1.0000
1:2303099:A:AG	donor_gain	1.0000
1:2303100:TAAG:T	donor_loss	1.0000
1:2303103:GG:G	donor_loss	1.0000
1:2303104:G:C	donor_loss	1.0000
1:2303283:A:AG	acceptor_gain	1.0000
1:2303284:G:GG	acceptor_gain	1.0000
1:2303284:GA:G	acceptor_gain	1.0000
1:2303400:GGTG:G	donor_loss	1.0000
1:2303838:A:AG	acceptor_gain	1.0000
1:2303839:G:GG	acceptor_gain	1.0000
1:2304075:G:GT	donor_gain	1.0000
1:2304081:G:GT	donor_gain	1.0000
1:2304095:G:GT	donor_gain	1.0000
1:2304096:G:T	donor_gain	1.0000
1:2304098:GGAAT:G	donor_gain	1.0000
1:2304099:GAATG:G	donor_gain	1.0000
1:2304100:A:T	donor_gain	1.0000
1:2304103:G:GG	donor_gain	1.0000
1:2304107:GT:G	donor_gain	1.0000
1:2304583:CAGGT:C	donor_loss	1.0000
1:2304584:AGGTG:A	donor_loss	1.0000
1:2304586:G:GG	donor_gain	1.0000
1:2304586:GT:G	donor_loss	1.0000

AlphaMissense

4662 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:2228836:T:C	F24L	1.000
1:2228837:T:C	F24S	1.000
1:2228838:C:A	F24L	1.000
1:2228838:C:G	F24L	1.000
1:2229080:T:C	L105P	1.000
1:2229095:T:A	I110N	1.000
1:2229100:T:C	C112R	1.000
1:2229102:C:G	C112W	1.000
1:2229103:T:C	F113L	1.000
1:2229104:T:C	F113S	1.000
1:2229104:T:G	F113C	1.000
1:2229105:C:A	F113L	1.000
1:2229105:C:G	F113L	1.000
1:2229112:G:A	G116R	1.000
1:2229112:G:C	G116R	1.000
1:2229113:G:A	G116E	1.000
1:2229119:A:T	E118V	1.000
1:2229124:C:A	R120S	1.000
1:2229125:G:C	R120P	1.000
1:2229128:T:A	L121Q	1.000
1:2229128:T:C	L121P	1.000
1:2229128:T:G	L121R	1.000
1:2229130:T:A	C122S	1.000
1:2229130:T:C	C122R	1.000
1:2229131:G:A	C122Y	1.000
1:2229131:G:C	C122S	1.000
1:2229131:G:T	C122F	1.000
1:2229132:T:G	C122W	1.000
1:2229134:T:A	L123Q	1.000
1:2229134:T:C	L123P	1.000

dbSNP variants (sampled 300 via entrez): RS1000003488 (1:2307705 T>A), RS1000022698 (1:2295715 GGCTATGTGTCCAGGCCACGTGTGA>G), RS1000039776 (1:2255677 ATCTC>A), RS1000050502 (1:2285756 G>A), RS1000053969 (1:2286502 A>C), RS1000100723 (1:2226737 G>A), RS1000109636 (1:2290403 C>G), RS1000121780 (1:2280197 G>A,T), RS1000269310 (1:2251356 T>C), RS1000276764 (1:2282857 G>A), RS1000312859 (1:2264462 G>T), RS1000351552 (1:2284956 A>G), RS1000359991 (1:2305264 G>T), RS1000368617 (1:2230077 C>A), RS1000372957 (1:2305158 C>A,G,T)

Disease associations

OMIM: gene MIM:164780 | disease phenotypes: MIM:182212, MIM:607086, MIM:123100

GenCC curated gene-disease

Disease	Classification	Inheritance
Shprintzen-Goldberg syndrome	Definitive	Autosomal dominant

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
Shprintzen-Goldberg syndrome	Definitive	AD

Mondo (6): Shprintzen-Goldberg syndrome (MONDO:0008426), familial thoracic aortic aneurysm and aortic dissection (MONDO:0019625), intellectual disability (MONDO:0001071), neurodevelopmental disorder (MONDO:0700092), craniosynostosis (MONDO:0015469), autism spectrum disorder (MONDO:0005258)

Orphanet (5): Shprintzen-Goldberg syndrome (Orphanet:2462), Familial thoracic aortic aneurysm and aortic dissection (Orphanet:91387), Craniosynostosis (Orphanet:1531), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658), NON RARE IN EUROPE: Autism (Orphanet:106)

HPO phenotypes

166 total (30 of 166 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000023	Inguinal hernia
HP:0000028	Cryptorchidism
HP:0000047	Hypospadias
HP:0000055	Abnormal female external genitalia morphology
HP:0000077	Abnormality of the kidney
HP:0000107	Renal cyst
HP:0000126	Hydronephrosis
HP:0000135	Hypogonadism
HP:0000160	Narrow mouth
HP:0000189	Narrow palate
HP:0000218	High palate
HP:0000238	Hydrocephalus
HP:0000244	Brachyturricephaly
HP:0000248	Brachycephaly
HP:0000252	Microcephaly
HP:0000260	Wide anterior fontanel
HP:0000268	Dolichocephaly
HP:0000270	Delayed cranial suture closure
HP:0000278	Retrognathia
HP:0000286	Epicanthus
HP:0000307	Pointed chin
HP:0000316	Hypertelorism
HP:0000327	Hypoplasia of the maxilla
HP:0000343	Long philtrum
HP:0000347	Micrognathia
HP:0000348	High forehead
HP:0000358	Posteriorly rotated ears
HP:0000369	Low-set ears
HP:0000377	Abnormal pinna morphology

GWAS associations

16 associations (top):

Study	Trait	p-value
GCST004616_101	Platelet distribution width	2.000000e-10
GCST005194_228	Coronary artery disease	2.000000e-07
GCST005196_176	Coronary artery disease	3.000000e-08
GCST005951_34	Body mass index	3.000000e-08
GCST005951_35	Body mass index	4.000000e-08
GCST006624_91	Systolic blood pressure	5.000000e-09
GCST007045_11	PR interval	5.000000e-10
GCST008971_125	Urate levels	6.000000e-09
GCST010321_96	PR interval	1.000000e-51
GCST011365_81	Myocardial infarction	4.000000e-07
GCST90000025_893	Appendicular lean mass	3.000000e-29
GCST90002400_7	Plateletcrit	5.000000e-24
GCST90002401_1	Platelet distribution width	9.000000e-29
GCST90002402_522	Platelet count	8.000000e-31
GCST90011898_31	Alanine aminotransferase levels	2.000000e-09
GCST90013405_98	Liver enzyme levels (alanine transaminase)	2.000000e-15

EFO canonical traits (8, from GWAS)

EFO ID	Trait name
EFO:0007984	platelet component distribution width
EFO:0004340	body mass index
EFO:0006335	systolic blood pressure
EFO:0004462	PR interval
EFO:0004531	urate measurement
EFO:0004980	appendicular lean mass
EFO:0007985	platelet crit
EFO:0004309	platelet count

MeSH disease descriptors (3)

Descriptor	Name	Tree numbers
D003398	Craniosynostoses	C05.116.099.370.894.232; C05.660.207.240; C05.660.906.364; C16.131.621.207.240; C16.131.621.906.364
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
D065886	Neurodevelopmental Disorders	F03.625

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

47 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, decreases expression, affects expression, increases methylation	3
(+)-JQ1 compound	increases expression	2
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression, increases expression	2
6,7-dimethoxy-2-(pyrrolidin-1-yl)-N-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine	decreases expression	1
FR900359	affects phosphorylation	1
bisphenol F	affects cotreatment, increases expression	1
TAK-243	increases sumoylation	1
dicrotophos	increases expression	1
triphenyl phosphate	affects expression	1
bisphenol A	decreases methylation	1
sodium arsenite	increases expression	1
2-palmitoylglycerol	increases expression	1
abrine	decreases expression	1
bisphenol S	decreases methylation	1
Gefitinib	increases expression	1
Sunitinib	increases expression	1
Acetaminophen	increases expression	1
Air Pollutants	affects expression, increases abundance	1
Arsenic	affects methylation	1
Atrazine	increases expression	1
Benzo(a)pyrene	decreases expression	1
Caffeine	affects phosphorylation	1
Cisplatin	decreases expression	1
Copper	affects binding, decreases expression	1
Dexamethasone	increases expression, affects cotreatment	1
Diethylstilbestrol	increases expression	1
Disulfiram	affects binding, decreases expression	1
Doxorubicin	decreases expression	1
Estradiol	affects cotreatment, increases expression	1
Hydralazine	affects cotreatment, decreases expression	1

Cellosaurus cell lines

2 cell lines: 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_WS22	UCD-Mel-N(Ski+)	Cancer cell line	Sex unspecified
CVCL_WS23	UCD-Mel-N(Ski+/Fhl2+)	Cancer cell line	Sex unspecified

Clinical trials (associated diseases)

296 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT05657860	PHASE4	COMPLETED	Guanfacine Extended Release for the Reduction of Aggression and Self-injurious Behavior Associated With Prader-Willi Syndrome
NCT05744479	PHASE4	RECRUITING	Metformin for Antipsychotic-induced Weight Gain in Adults With Intellectual Disability
NCT06107829	PHASE4	WITHDRAWN	Valbenazine Treatment of Tardive Dyskinesia in Adults With Intellectual/Developmental Disabilities
NCT06997198	PHASE4	NOT_YET_RECRUITING	Deutetrabenazine Treatment for Tardive Dyskinesia in Intellectual/Developmental Disabilities
NCT04586348	PHASE4	UNKNOWN	Prenatal Iodine Supplementation and Early Childhood Neurodevelopment
NCT04873115	PHASE4	UNKNOWN	Double-blind, Placebo-controlled, Randomized Clinical Trial Comparing the Efficacy and Safety of Sialanar Plus orAl rehabiLitation Against Placebo Plus Oral Rehabilitation for chIldren and Adolescents With seVere Sialorrhoea and Neurodisabilties,
NCT02270736	PHASE3	COMPLETED	Clinical Study to Investigate the Efficacy and Safety of NT 201 Compared to Placebo in the Treatment of Chronic Troublesome Drooling Associated With Neurological Disorders and/or Intellectual Disability
NCT02559102	PHASE3	COMPLETED	Dexmedetomidine Sedation Versus General Anaesthesia for Inguinal Hernia Surgery in Infants
NCT02757079	PHASE3	COMPLETED	Study of the Efficacy and Safety of NPC-15 for Sleep Disorders of Children With Neurodevelopmental Disorders
NCT06915480	PHASE3	RECRUITING	Reducing Missed Appointments
NCT07377032	PHASE3	RECRUITING	TAP-GRIN: Interventional Study on Patients With GRIN-related Neurodevelopmental Disorders
NCT02304302	PHASE2	COMPLETED	Down Syndrome Memantine Follow-up Study
NCT03862950	PHASE2	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome (Met)
NCT04529226	PHASE2	UNKNOWN	Study to Compare Clozapine vs Treatment as Usual in People With Intellectual Disability & Treatment-resistant Psychosis
NCT04821856	PHASE2	COMPLETED	Evaluation of the Effectiveness of Cannabidiol in Treating Severe Behavioural Problems in Children and Adolescents With Intellectual Disability
NCT02909959	PHASE2	COMPLETED	Sulforaphane for the Treatment of Young Men With Autism Spectrum Disorder
NCT06081348	PHASE2	RECRUITING	Sertraline vs. Placebo in the Treatment of Anxiety in Children and AdoLescents With NeurodevelopMental Disorders
NCT06352372	PHASE2	COMPLETED	Safety and Efficacy of tPBM for Epileptiform Activity in Autism
NCT05273320	PHASE1	COMPLETED	Clinical Trial of Nabilone for Aggression in Adults With Intellectual and Developmental Disabilities
NCT05301361	PHASE1	ENROLLING_BY_INVITATION	Sensitivity of the NIH Toolbox to Stimulant Treatment in Intellectual Disabilities
NCT06016764	PHASE1	COMPLETED	Use of MRI and cTBS for Catatonia in Autism
NCT06586827	PHASE1	COMPLETED	Impact of Competency-Based Training and Technical Assistance Employment Outcomes of Individuals With ID/DD
NCT07531940	PHASE1	NOT_YET_RECRUITING	Escalating Doses of Memantine in Down Syndrome (MEDS-123)
NCT00503191	PHASE1	COMPLETED	NeuroModulation Technique Treatment of Autism
NCT04475848	PHASE1	COMPLETED	A Study to Investigate the Safety, Tolerability, Pharmacokinetics, Pharmacodynamics and Food Effect of RO6953958 in Healthy Participants
NCT06300398	PHASE1	COMPLETED	IAMA-6 Oral Dose Study in Healthy Adults
NCT01322165	Not specified	COMPLETED	National Registry of Genetically Triggered Thoracic Aortic Aneurysms and Cardiovascular Conditions
NCT03440697	Not specified	ACTIVE_NOT_RECRUITING	Pathogenetic Basis of Aortopathy and Aortic Valve Disease
NCT06783803	Not specified	ACTIVE_NOT_RECRUITING	Application of Linkage Analysis in the Identification of Novel Hereditary Factors in Familial Aneurysms
NCT03479476	PHASE2/PHASE3	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome
NCT02616796	PHASE1/PHASE2	COMPLETED	Effects of Social Gaze Training on Brain and Behavior in Fragile X Syndrome
NCT06860672	EARLY_PHASE1	RECRUITING	Clinical Trial of the Dual Vector Base Editor for the Treatment of the CHD3-R1025W Mutation
NCT00597948	Not specified	COMPLETED	Healthy Lifestyles for People With Intellectual Disabilities
NCT01087320	Not specified	RECRUITING	Genome Medical Sequencing for Gene Discovery
NCT01652963	Not specified	UNKNOWN	Picture-based Computerised Assessment and Training of Cognitive Behaviour Therapy Skills
NCT01695395	Not specified	COMPLETED	Mental Health Care Provision for Adults With Intellectual Disability and a Mental Disorder
NCT01867554	Not specified	COMPLETED	Research and Characterization of New Genes Involved in Intellectual Disability
NCT01915381	Not specified	COMPLETED	Improving Adherence Healthy Lifestyle With a Smartphone Application Based on Adults With Intellectual Disabilities
NCT01988623	Not specified	COMPLETED	Pivotal Response Treatment for Individuals With Intellectual Disabilities
NCT02099773	Not specified	COMPLETED	Support Staff-client Interactions With Augmentative and Alternative Communication