SLC16A3

Summary

SLC16A3 (solute carrier family 16 member 3, HGNC:10924) is a protein-coding gene on chromosome 17q25.3, encoding Monocarboxylate transporter 4 (O15427). Proton-dependent transporter of monocarboxylates such as L-lactate and pyruvate.

Lactic acid and pyruvate transport across plasma membranes is catalyzed by members of the proton-linked monocarboxylate transporter (MCT) family, which has been designated solute carrier family-16. Each MCT appears to have slightly different substrate and inhibitor specificities and transport kinetics, which are related to the metabolic requirements of the tissues in which it is found. The MCTs, which include MCT1 (SLC16A1; MIM 600682) and MCT2 (SLC16A7; MIM 603654), are characterized by 12 predicted transmembrane domains (Price et al., 1998 [PubMed 9425115]).

Source: NCBI Gene 9123 — RefSeq curated summary.

At a glance

• GWAS associations: 3
• Clinical variants (ClinVar): 116 total
• Druggable target: yes — 4 molecules with ChEMBL bioactivity
• MANE Select transcript: NM_004207

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:10924
Approved symbol	SLC16A3
Name	solute carrier family 16 member 3
Location	17q25.3
Locus type	gene with protein product
Status	Approved
Aliases	MCT3, MCT4
Ensembl gene	ENSG00000141526
Ensembl biotype	protein_coding
OMIM	603877
Entrez	9123

Gene structure

Transcript identifiers

Ensembl transcripts: 27 — 21 protein_coding, 5 retained_intron, 1 protein_coding_CDS_not_defined

ENST00000392339, ENST00000392341, ENST00000577650, ENST00000578574, ENST00000578684, ENST00000578810, ENST00000579572, ENST00000580098, ENST00000580189, ENST00000581287, ENST00000581642, ENST00000582715, ENST00000582743, ENST00000583025, ENST00000583444, ENST00000584689, ENST00000584781, ENST00000617373, ENST00000619321, ENST00000877806, ENST00000877807, ENST00000877808, ENST00000877809, ENST00000877810, ENST00000877811, ENST00000877812, ENST00000948113

RefSeq mRNA: 6 — MANE Select: NM_004207 NM_001042422, NM_001042423, NM_001206950, NM_001206951, NM_001206952, NM_004207

CCDS: CCDS11804

Canonical transcript exons

ENST00000582743 — 5 exons

Exon	Start	End
ENSE00000949451	82236729	82236872
ENSE00001330469	82237138	82237893
ENSE00002707923	82229042	82229106
ENSE00002717641	82238702	82240086
ENSE00003628723	82235983	82236231

Expression profiles

Bgee: expression breadth ubiquitous, 279 present calls, max score 97.93.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 57.9282 / max 1701.6299, expressed in 1669 samples.

FANTOM5 promoters (8 alternative TSS)

Promoter ID	TPM avg	Samples expressed
163475	52.1944	1654
163473	2.5828	762
163474	1.6133	570
163472	0.8893	364
163482	0.3970	191
163481	0.2034	82
163477	0.0283	9
163476	0.0197	7

Top tissues by expression

292 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
stromal cell of endometrium	CL:0002255	97.93	gold quality
monocyte	CL:0000576	97.45	gold quality
mononuclear cell	CL:0000842	96.98	gold quality
leukocyte	CL:0000738	96.95	gold quality
granulocyte	CL:0000094	96.83	gold quality
blood	UBERON:0000178	96.67	gold quality
nasal cavity epithelium	UBERON:0005384	95.37	gold quality
lower esophagus mucosa	UBERON:0035834	95.13	gold quality
gastrocnemius	UBERON:0001388	94.56	gold quality
pericardium	UBERON:0002407	94.53	gold quality
mucosa of transverse colon	UBERON:0004991	94.04	gold quality
cartilage tissue	UBERON:0002418	93.93	gold quality
muscle of leg	UBERON:0001383	93.77	gold quality
tendon of biceps brachii	UBERON:0008188	93.77	gold quality
muscle organ	UBERON:0001630	92.95	gold quality
spleen	UBERON:0002106	92.32	gold quality
bone marrow cell	CL:0002092	91.99	gold quality
upper lobe of left lung	UBERON:0008952	91.97	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	91.95	gold quality
type B pancreatic cell	CL:0000169	91.90	silver quality
olfactory bulb	UBERON:0002264	91.59	silver quality
right lung	UBERON:0002167	91.49	gold quality
dorsal root ganglion	UBERON:0000044	91.44	gold quality
upper lobe of lung	UBERON:0008948	91.34	gold quality
vastus lateralis	UBERON:0001379	91.24	gold quality
pancreatic ductal cell	CL:0002079	91.19	silver quality
parotid gland	UBERON:0001831	91.14	silver quality
right lobe of thyroid gland	UBERON:0001119	90.88	gold quality
ascending aorta	UBERON:0001496	90.87	gold quality
quadriceps femoris	UBERON:0001377	90.86	gold quality

Single-cell (SCXA)

Detected in 6 experiment(s), a significant marker in 6.

Experiment	Marker?	Max mean expression
E-MTAB-6701	yes	1203.70
E-MTAB-8495	yes	658.01
E-CURD-114	yes	43.97
E-MTAB-8142	yes	39.63
E-MTAB-9067	yes	11.22
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

8 targeting SLC16A3, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-141-3P	99.94	72.79	2421
HSA-MIR-200A-3P	99.94	72.68	2420
HSA-MIR-4651	99.06	67.57	2002
HSA-MIR-608	98.93	67.83	2013
HSA-MIR-6818-3P	98.56	68.23	1307
HSA-MIR-296-5P	97.61	64.02	851
HSA-MIR-3194-5P	96.80	64.90	1027
HSA-MIR-6777-3P	95.35	64.30	699

Literature-anchored findings (GeneRIF, showing 11)

• Gamma-hydroxybutyric acid (GHB) is a substrate for both MCT2 and MCT4. (PMID:17502341)
• Ocular absorption of monocarboxylic acid drugs may be enhanced by MCT transporter SLC16A3, and the absorption route provided by the transporter may be utilized to improve the bioavailability of topically applied ophthalmic drugs. (PMID:20035863)
• MCT1 may be acting as an uptake transporter and MCT4 as an efflux system across the basolateral membrane for ferulic acid, and that this process is stimulated by butyric acid. (PMID:26854723)
• these data suggest that the key effect of MCT4 depletion on NK cells probably utilizes inductive autophagy as a compensatory metabolic mechanism to minimize the acidic extracellular microenvironment associated with lactate export in tumors. (PMID:30051648)
• The tissue expression of MCT3, MCT8, and MCT9 genes in women with breast cancer. (PMID:34097251)
• MCT4 as a potential therapeutic target to augment gemcitabine chemosensitivity in resected pancreatic cancer. (PMID:34791637)
• Identification and Validation of a Prognostic Model Based on Three MVI-Related Genes in Hepatocellular Carcinoma. (PMID:34975331)
• Monocarboxylate transporter 4 inhibition potentiates hepatocellular carcinoma immunotherapy through enhancing T cell infiltration and immune attack. (PMID:35043976)
• Involvement of SLC16A1/MCT1 and SLC16A3/MCT4 in l-lactate transport in the hepatocellular carcinoma cell line. (PMID:36104287)
• Bone Morphogenetic Protein-4 Promotes Phenotypic Modulation via SMAD-4/MCT-4 Axis in Vascular Smooth Muscle Cells. (PMID:38151007)
• Targeting tumor-intrinsic SLC16A3 to enhance anti-PD-1 efficacy via tumor immune microenvironment reprogramming. (PMID:38522774)

Cross-species orthologs

18 orthologs

Organism	Symbol	Gene ID
danio_rerio	slc16a3a	ENSDARG00000028583
danio_rerio	slc16a3b	ENSDARG00000045051
mus_musculus	Slc16a3	ENSMUSG00000025161
rattus_norvegicus	Slc16a3	ENSRNOG00000036677
drosophila_melanogaster	Mct1	FBGN0023549
drosophila_melanogaster	CG14196	FBGN0031002
drosophila_melanogaster	CG8051	FBGN0031012
drosophila_melanogaster	Sln	FBGN0033657
drosophila_melanogaster	CG8468	FBGN0033913
drosophila_melanogaster	Targ	FBGN0033955
drosophila_melanogaster	CG13907	FBGN0035173
drosophila_melanogaster	out	FBGN0259834
caenorhabditis_elegans		WBGENE00003986
caenorhabditis_elegans		WBGENE00010834
caenorhabditis_elegans		WBGENE00015273
caenorhabditis_elegans		WBGENE00015676
caenorhabditis_elegans		WBGENE00020168
caenorhabditis_elegans		WBGENE00021227

Paralogs (13): SLC16A8 (ENSG00000100156), SLC16A6 (ENSG00000108932), SLC16A10 (ENSG00000112394), SLC16A7 (ENSG00000118596), SLC16A2 (ENSG00000147100), SLC16A12 (ENSG00000152779), SLC16A1 (ENSG00000155380), SLC16A14 (ENSG00000163053), SLC16A9 (ENSG00000165449), SLC16A4 (ENSG00000168679), SLC16A5 (ENSG00000170190), SLC16A11 (ENSG00000174326), SLC16A13 (ENSG00000174327)

Protein

Protein identifiers

Monocarboxylate transporter 4 — O15427 (reviewed: O15427)

Alternative names: Solute carrier family 16 member 3

All UniProt accessions (8): O15427, J3KTI8, J3KTM6, J3QQS9, J3QQV2, J3QRA0, J3QRP8, J3QSC3

UniProt curated annotations — full annotation on UniProt →

Function. Proton-dependent transporter of monocarboxylates such as L-lactate and pyruvate. Plays a predominant role in L-lactate efflux from highly glycolytic cells.

Subunit / interactions. Interacts with BSG; interaction mediates SLC16A3 targeting to the plasma membrane.

Subcellular location. Cell membrane. Basolateral cell membrane.

Tissue specificity. Highly expressed in skeletal muscle.

Domain organisation. Two basolateral sorting signals (BSS) in its C-terminal cytoplasmic tail are required to direct SLC16A3 to the basolateral membrane.

Induction. Up-regulated by hypoxia through a HIF1A-mediated mechanism.

Similarity. Belongs to the major facilitator superfamily. Monocarboxylate porter (TC 2.A.1.13) family.

RefSeq proteins (6): NP_001035887, NP_001035888, NP_001193879, NP_001193880, NP_001193881, NP_004198* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR004743	MCT	Family
IPR011701	MFS	Family
IPR020846	MFS_dom	Domain
IPR036259	MFS_trans_sf	Homologous_superfamily
IPR050327	Proton-linked_MCT	Family

Pfam: PF07690

Catalyzed reactions (Rhea), 2 shown:

• (S)-lactate(in) + H(+)(in) = (S)-lactate(out) + H(+)(out) (RHEA:29415)
• pyruvate(out) + H(+)(out) = pyruvate(in) + H(+)(in) (RHEA:64720)

UniProt features (41 total): topological domain 13, transmembrane region 12, mutagenesis site 7, region of interest 3, modified residue 3, initiator methionine 1, chain 1, compositionally biased region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O15427-F1	83.62	0.63

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (3): 436, 460, 464

Mutagenesis-validated functional residues (7):

Position	Phenotype
198	does not affect lactate transmembrane transporter activity.
278	abolishes lactate transmembrane transporter activity. does not affect cell membrane localization.
425	affects subcellular localization leading to apical localization. affects subcellular localization leading to apical loca
426	leads to a nonpolar expression pattern. affects subcellular localization leading to apical localization; when associated
427	affects subcellular localization leading to apical localization. affects subcellular localization leading to apical loca
432	does not affect basolateral plasma membrane localization. intracellular accumulation. affects subcellular localization l
433	does not affect basolateral plasma membrane localization. intracellular accumulation. affects subcellular localization l

Function

Pathways and Gene Ontology

Reactome pathways

7 pathways

ID	Pathway
R-HSA-210991	Basigin interactions
R-HSA-433692	Proton-coupled monocarboxylate transport
R-HSA-109582	Hemostasis
R-HSA-202733	Cell surface interactions at the vascular wall
R-HSA-382551	Transport of small molecules
R-HSA-425366
R-HSA-425407	SLC-mediated transmembrane transport

MSigDB gene sets: 257 (showing top): MODULE_52, RODRIGUES_THYROID_CARCINOMA_ANAPLASTIC_UP, MODULE_45, MODULE_64, RIZKI_TUMOR_INVASIVENESS_3D_DN, MODULE_16, GOBP_MONOCARBOXYLIC_ACID_METABOLIC_PROCESS, GOBP_ORGANIC_ACID_TRANSPORT, GOBP_ORGANIC_HYDROXY_COMPOUND_TRANSPORT, WEINMANN_ADAPTATION_TO_HYPOXIA_UP, BILD_HRAS_ONCOGENIC_SIGNATURE, MODULE_118, RICKMAN_METASTASIS_DN, MAINA_HYPOXIA_VHL_TARGETS_UP, FOSTER_TOLERANT_MACROPHAGE_DN

GO Biological Process (7): monocarboxylic acid transport (GO:0015718), lactate transmembrane transport (GO:0035873), plasma membrane lactate transport (GO:0035879), pyruvate catabolic process (GO:0042867), pyruvate transmembrane transport (GO:1901475), lactate transport (GO:0015727), transmembrane transport (GO:0055085)

GO Molecular Function (8): RNA binding (GO:0003723), monocarboxylic acid transmembrane transporter activity (GO:0008028), lactate:proton symporter activity (GO:0015650), pyruvate transmembrane transporter activity (GO:0050833), protein binding (GO:0005515), lactate transmembrane transporter activity (GO:0015129), symporter activity (GO:0015293), transmembrane transporter activity (GO:0022857)

GO Cellular Component (7): plasma membrane (GO:0005886), membrane (GO:0016020), basolateral plasma membrane (GO:0016323), apical plasma membrane (GO:0016324), lateral plasma membrane (GO:0016328), nuclear membrane (GO:0031965), apical part of cell (GO:0045177)

Reactome top-level categories

Rollup of top-4 pathways:

Category	Pathways
Cell surface interactions at the vascular wall	1
SLC-mediated transport of organic anions	1
Hemostasis	1
Transport of small molecules	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
carboxylic acid transmembrane transport	2
lactate transmembrane transport	2
monocarboxylic acid transport	2
monocarboxylic acid transmembrane transporter activity	2
plasma membrane region	2
carboxylic acid transport	1
lactate transport	1
pyruvate metabolic process	1
monocarboxylic acid catabolic process	1
pyruvate transport	1
organic hydroxy compound transport	1
transport	1
cellular process	1
nucleic acid binding	1
carboxylic acid transmembrane transporter activity	1
lactate transmembrane transporter activity	1
solute:proton symporter activity	1
secondary active monocarboxylate transmembrane transporter activity	1
pyruvate transmembrane transport	1
binding	1
secondary active transmembrane transporter activity	1
transporter activity	1
transmembrane transport	1
membrane	1
cell periphery	1
basal plasma membrane	1
apical part of cell	1
plasma membrane	1
nucleus	1
nuclear envelope	1
organelle membrane	1

Protein interactions and networks

STRING

1738 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SLC16A3	BSG	P35613	996
SLC16A3	CA9	Q16790	878
SLC16A3	EMB	Q6PCB8	870
SLC16A3	CBLL1	Q75N03	834
SLC16A3	LDHA	P00338	788
SLC16A3	SLC2A1	P11166	780
SLC16A3	SLC17A5	Q9NRA2	778
SLC16A3	SLC2A3	P11169	706
SLC16A3	HIF1A	Q16665	697
SLC16A3	PGK1	P00558	663
SLC16A3	PKM	P14618	658
SLC16A3	CA2	P00918	654
SLC16A3	MCTS1	Q9ULC4	638
SLC16A3	SLC3A2	P08195	637
SLC16A3	SLC9A1	P19634	627

IntAct

188 interactions, top by confidence:

A	B	Type	Score
SCRIB	SLC16A3	psi-mi:“MI:0407”(direct interaction)	0.710
DLG1	SLC16A3	psi-mi:“MI:0407”(direct interaction)	0.710
CFTR	ESYT2	psi-mi:“MI:0914”(association)	0.710
SLC16A3	SCRIB	psi-mi:“MI:0407”(direct interaction)	0.710
SLC16A3	DLG1	psi-mi:“MI:0407”(direct interaction)	0.710
SLC16A3	CASK	psi-mi:“MI:0914”(association)	0.590
SLC16A3	PTPN3	psi-mi:“MI:0407”(direct interaction)	0.590
SLC16A3	SYNJ2BP	psi-mi:“MI:0407”(direct interaction)	0.590
SLC16A3	SNTB1	psi-mi:“MI:0407”(direct interaction)	0.590
SLC16A3	SNTA1	psi-mi:“MI:0407”(direct interaction)	0.590
SLC16A3	CASK	psi-mi:“MI:0407”(direct interaction)	0.590
SLC16A3	MPP7	psi-mi:“MI:0407”(direct interaction)	0.590
SLC16A3	PTPN13	psi-mi:“MI:0407”(direct interaction)	0.590
SLC16A3	FAM9B	psi-mi:“MI:0915”(physical association)	0.560
SLC16A3	BANP	psi-mi:“MI:0915”(physical association)	0.560
NR2C2AP	SLC16A3	psi-mi:“MI:0915”(physical association)	0.560
FAM9B	SLC16A3	psi-mi:“MI:0915”(physical association)	0.560
BANP	SLC16A3	psi-mi:“MI:0915”(physical association)	0.560
SLC16A3	NR2C2AP	psi-mi:“MI:0915”(physical association)	0.560
SLC16A3	UBQLN2	psi-mi:“MI:0915”(physical association)	0.560
SLC16A3	UBQLN1	psi-mi:“MI:0915”(physical association)	0.560
SLC16A3	HPCA	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (127): BANP (Two-hybrid), NR2C2AP (Two-hybrid), FAM9B (Two-hybrid), SLC16A3 (Affinity Capture-MS), SLC16A3 (Affinity Capture-MS), SLC16A3 (Affinity Capture-MS), SLC16A3 (Affinity Capture-MS), SLC16A3 (Affinity Capture-MS), SLC16A3 (Proximity Label-MS), SLC16A3 (Affinity Capture-RNA), SLC16A3 (Affinity Capture-MS), SLC16A3 (Proximity Label-MS), SLC16A3 (Affinity Capture-MS), SLC16A3 (Affinity Capture-MS), SLC16A3 (Two-hybrid)

ESM2 similar proteins: A6NFX1, F1NJ67, F7EQ49, G5E8K6, O08878, O15375, O15427, O35308, O35910, O60669, O70461, O95907, P11049, P50407, P53987, P54219, P57787, Q01818, Q03064, Q14CX5, Q3T9M1, Q3T9X0, Q504N2, Q58CT4, Q5RB09, Q66H95, Q6AY78, Q6PDE8, Q6UXD7, Q78KK3, Q80T22, Q8BFQ6, Q8BMP4, Q8BZA7, Q8CE47, Q8IZD6, Q8NDV2, Q8NHX9, Q8VCV9, Q8VCW4

Diamond homologs: A0LNN5, B1AT66, I1RV24, O15375, O15403, O15427, O35440, O35910, O60669, O70451, O95907, P53985, P53986, P53987, P53988, P57787, P57788, Q03064, Q17QR6, Q3MHW6, Q63344, Q66HE2, Q7RTY0, Q7TMR7, Q8CE94, Q90632, D4A734, G5E8K6, O15374, O35308, O70461, Q503M4, Q5NC32, Q6GM59, Q6P2X9, Q6ZSM3, Q8BGC3, Q8NCK7, Q8R0M8, M0RCI4

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
SLC16A3	up-regulates	Survival
SLC16A3	down-regulates	Apoptosis

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 132 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Ras activation upon Ca2+ influx through NMDA receptor	5	33.6×	3e-05
Unblocking of NMDA receptors, glutamate binding and activation	5	32.0×	3e-05
Negative regulation of NMDA receptor-mediated neuronal transmission	5	32.0×	3e-05
Long-term potentiation	5	28.0×	5e-05
Assembly and cell surface presentation of NMDA receptors	9	26.9×	7e-09
Neurexins and neuroligins	10	23.2×	5e-09
Protein-protein interactions at synapses	6	18.8×	5e-05
RHOQ GTPase cycle	6	12.8×	4e-04

GO biological processes:

GO term	Partners	Fold	FDR
establishment or maintenance of epithelial cell apical/basal polarity	10	50.1×	2e-12
protein localization to synapse	6	39.6×	1e-06
receptor clustering	7	37.7×	2e-07
regulation of postsynaptic membrane neurotransmitter receptor levels	7	29.9×	6e-07
bicellular tight junction assembly	5	14.2×	2e-03
cell-cell adhesion	12	10.5×	4e-07
protein-containing complex assembly	9	8.8×	8e-05
protein localization to plasma membrane	9	8.4×	1e-04

Disease & clinical

Clinical variants and AI predictions

ClinVar

116 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	91
Likely benign	15
Benign	2

Top pathogenic / likely-pathogenic (0)

SpliceAI

2732 predictions. Top by Δscore:

Variant	Effect	Δscore
17:82235980:CAG:C	acceptor_loss	1.0000
17:82235982:GGT:G	acceptor_gain	1.0000
17:82235982:GGTGA:G	acceptor_gain	1.0000
17:82236228:ACAGG:A	donor_loss	1.0000
17:82236229:CAGGT:C	donor_loss	1.0000
17:82236231:GGT:G	donor_loss	1.0000
17:82236232:G:GC	donor_loss	1.0000
17:82236233:T:A	donor_loss	1.0000
17:82236871:GG:G	donor_gain	1.0000
17:82236872:GG:G	donor_gain	1.0000
17:82237134:CCAG:C	acceptor_loss	1.0000
17:82237135:CA:C	acceptor_loss	1.0000
17:82237136:A:AG	acceptor_gain	1.0000
17:82237136:AG:A	acceptor_gain	1.0000
17:82237136:AGG:A	acceptor_gain	1.0000
17:82237137:G:A	acceptor_gain	1.0000
17:82237137:G:C	acceptor_loss	1.0000
17:82237137:G:GA	acceptor_gain	1.0000
17:82237137:GGG:G	acceptor_gain	1.0000
17:82237137:GGGT:G	acceptor_gain	1.0000
17:82237137:GGGTT:G	acceptor_gain	1.0000
17:82248870:CCTA:C	donor_loss	1.0000
17:82248871:CTA:C	donor_loss	1.0000
17:82248988:C:CT	acceptor_gain	1.0000
17:82249010:GTTAG:G	acceptor_gain	1.0000
17:82249011:TTAG:T	acceptor_gain	1.0000
17:82249012:TAG:T	acceptor_gain	1.0000
17:82249013:AG:A	acceptor_gain	1.0000
17:82249015:C:A	acceptor_loss	1.0000
17:82249015:C:CC	acceptor_gain	1.0000

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000022714 (17:82222619 C>T), RS1000082644 (17:82216080 C>T), RS1000152225 (17:82226009 C>G,T), RS1000183770 (17:82226238 C>T), RS1000220132 (17:82234088 C>T), RS1000277907 (17:82220190 G>A), RS1000281959 (17:82231158 G>A), RS1000295658 (17:82226370 C>G,T), RS1000333717 (17:82231027 C>G,T), RS1000427796 (17:82230614 G>GC), RS1000503363 (17:82233929 C>T), RS1000543732 (17:82240316 AAGACGAGGAGGCAGGGAGC>A,AAGACGAGGAGGCAGGGAGCAGACGAGGAGGCAGGGAGC), RS1000581311 (17:82233952 T>C), RS1000630919 (17:82230181 G>A), RS1000683100 (17:82229949 C>G,T)

Disease associations

OMIM: gene MIM:603877 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

3 associations (top):

Study	Trait	p-value
GCST003141_5	Proteinuria and chronic kidney disease	6.000000e-06
GCST010002_133	Refractive error	2.000000e-50
GCST90002384_427	Hemoglobin	8.000000e-10

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0004509	hemoglobin measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (2): CHEMBL2073663 (SINGLE PROTEIN), CHEMBL4802067 (SELECTIVITY GROUP)

Molecules with ChEMBL bioactivity

4 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 3,892 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL1232461	MOLIBRESIB	2	1,538
CHEMBL1399124	SYROSINGOPINE	2	1,162
CHEMBL2107549	BINDARIT	2	1,033
CHEMBL3335793	AZD3965	1	159

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: transporter — SLC16 family of monocarboxylate transporters

Most potent curated ligand interactions (1 total), top 1:

Ligand	Action	Affinity	Parameter
compound 18n [PMID: 34382802]	Inhibition	9.0	pIC50

Binding affinities (BindingDB)

240 measured of 240 human assays (240 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
2-[[1-[(2-Chlorophenyl)methyl]-5-[3- (cyclopropylmethoxy)phenyl]pyrazol-3- yl]methoxy]-2-methyl-propanoic acid. 1HNMR (CDCl3): δ 0.25-0.29 (m, 2H), 0.58-0.63 (m, 2H), 14.16-1.20 (m, 1H), 1.55 (s, 6H), 5.58 (d, 2H), 4.63 (s, 2H), 5.42 (s, 2H), 6.40 (s, 1H), 6.374-6.78 (m, 2H), 6.84-6.93 (m, 2H), 7.18-7.28 (m, 3H), 7.33-7.35 (m, 1H).	IC50	54.5 nM	US-10202350: MCT4 inhibitors for treating disease
2-[[1-[(2-chlorophenyl)methyl]-5-(4-cyclopropyloxythiophen-2-yl)pyrrol-3-yl]methoxy]-2-methylpropanoic acid	IC50	55 nM	US-10214492
1-[[5-(4-Chlorophenyl)-1-[(2- chlorophenyl)methyl]pyrazol-3- yl]methoxy]cyclopropanecarboxylic acid 1H NMR (CD3OD, 400 MHz) δ 1.18- 1.32 (m, 3H), 1.64-1.80 (m, 1H), 4.61 (s, 2H), 5.42 (s, 2H), 6.52 (s, 1H), 6.60-6.80 (m, 1H), 7.20-52 (m, 7H).	IC50	100 nM	US-10202350: MCT4 inhibitors for treating disease
1-[[1-[(2-Chlorophenyl)methyl]-5-(3- methoxyphenyl)pyrazol-3- yl]methoxy]cyclobutanecarboxylic acid. 1HNMR (CDCl3): δ 1.78-1.85 (m 1H), 1.95-2.04 (m, 2H), 2.18-2.25 (m, 1H), 3.09-3.14 (m, 1H), 3.66 (s, 3H), 4.27-4.32 (m, 1H), 4.55-4.65 (dd, 2H), 5.43 (s, 2H), 6.44 (s, 1H), 6.73-6.91 (m, 4H), 7.17-7.34 (m 4).	IC50	100 nM	US-10202350: MCT4 inhibitors for treating disease
2-[[1-[[3-(dimethylamino)phenyl]methyl]-5-[3-(2-methylpropoxy)phenyl]pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	102 nM	US-10214492
2-[[1-[(2-ethoxyphenyl)methyl]-5-(1-methylindazol-6-yl)pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	102 nM	US-10214492
2-[[1-[(2-chlorophenyl)methyl]-5-[2-(2-methylpropoxy)-1,3-thiazol-5-yl]pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	104 nM	US-10214492
(E)-4-[1-[(2-chlorophenyl)methyl]-5-(3-methoxyphenyl)pyrazol-3-yl]-2,2-dimethylbut-3-enoic acid	IC50	152 nM	US-10214492
2-[[5-(3-cyclobutyloxyphenyl)-1-[(2-ethoxyphenyl)methyl]pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	154 nM	US-10214492
2-[[1-(1,3-dimethylindazol-7-yl)-5-[3-(2,2-dimethylpropoxy)phenyl]pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	154 nM	US-10214492
4-[1-[(2-chlorophenyl)methyl]-5-(3-methoxyphenyl)pyrazol-3-yl]-2,2-dimethylbutanoic acid	IC50	201 nM	US-10214492
2-[[1-[(2-Chlorophenyl)methyl]-5-[3- (cyclobutoxy)phenyl]pyrazol-3- yl]methoxy]-2-methyl-propanoic acid. 1HNMR (CDCl3): δ 1.49-1.61 (m, 7H), m1.75-1.82 (m 1H), 2.01-2.11 (m 2H), 2.17-2.24 (m 2H), 4.37-4.45 (m 1H), 4.62 (s, 2H), 5.42 (s, 2H), 6.39 (s, 1H), 6.64 (s, 1H), 6.75-6.86 (m, 3H), 7.19-7.35 (m 4H).	IC50	204 nM	US-10202350: MCT4 inhibitors for treating disease
2-[[1-[(2-Chlorophenyl)methyl]-5-[3- (cyclopentylmethoxy)phenyl]pyrazol-3- yl]methoxy]-2-methyl-propanoic acid. 1HNMR (CDCl3): δ 1.25-1.29 (m, 2H), 1.55-1.61 (m, 10H), 1.76-1.79 (m, 2H), 2.24-2.31 (m, 1H), 3.59 (d, 2H), 4.62 (s, 2H), 5.43 (s, 2H), 6.41 (s, 1H), 6.73-6.91 (m, 4H), 7.19-7.35 (m, 4H).	IC50	204 nM	US-10202350: MCT4 inhibitors for treating disease
2-[[1-[(2,6-dimethoxyphenyl)methyl]-5-[3-(2-methylpropoxy)phenyl]pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	220 nM	US-10214492
(2S)-2-[[1-[(2-chlorophenyl)methyl]-5-(3-methoxyphenyl)pyrazol-3-yl]methoxy]butanoic acid	IC50	251 nM	US-10214492
2-[[1-(3-chlorophenyl)-5-(3,5-dimethoxyphenyl)pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	254 nM	US-10214492
2-[[1-[(2-Chlorophenyl)methyl]-5-(3- isobutoxyphenyl)pyrazol-3-yl]methoxy]-2- methyl-propanoic acid. 1HNMR (CDCl3): δ 0.95 (s, 3H)(, 0.96 (s, 3H), 1.56 (s, 6H), 1.97-2.03 (m, 1H), 3.49 (d, 2H), 4.63 (s, 2H), 5.43 (s, 2H), 6.41 (s, 1H), 6.73-6.80 (m, 2H), 6.84- 6.92 (m, 2H), 7.19-7.28 (m, 3H), 7.33- 7.35 (m, 1H).	IC50	302 nM	US-10202350: MCT4 inhibitors for treating disease
2-[[5-(4-Chlorophenyl)-1-[(2,4- dichlorophenyl)methyl]pyrazol-3- yl]methoxy]acetic acid 1H NMR (DMSO-d6, 400 MHz) δ 3.80 (s, 2H), 4.50 9s, 2H), 5.30 (s, 2H), 6.50 (s, 1H), 6.60-80 (m, 1H), 7.20-70 (m, 6H).	IC50	303 nM	US-10202350: MCT4 inhibitors for treating disease
2-[[1-[(2-chlorophenyl)methyl]-5-(3-methoxyphenyl)pyrazol-3-yl]methoxy]-2-methyl-N-methylsulfonylpropanamide	IC50	303 nM	US-10202350: MCT4 inhibitors for treating disease
2-[[5-(4-Chlorophenyl)-1-[(2,4- dichlorophenyl)methyl]pyrazol-3- yl]methoxy]-2-methyl-propanoic acid 1H NMR (CD3OD, 400 MHz) δ 1.48 (s, 6H), 4.58 (s, 2H), 5.40 (s, 2H), 6.54 (s, 1H), 6.73 (d, 1H), 7.20-7.38 (m, 3H), 7.40-48 (m, 3H).	IC50	400 nM	US-10202350: MCT4 inhibitors for treating disease
2-[[5-(3-Chlorophenyl)-1-[(2- chlorophenyl)methyl]pyrazol-3- yl]methoxy]-2-methyl-propanoic acid 1H NMR (CD3OD, 400 MHz) δ 1.32 (S, 6h) 4.58 (s, 2H), 5.42 (s, 2H), 6.57 (s, 1H), 6.67-6.80 (m, 1H), 7.22-7.30 (m, 3H), 7.32-42 (m, 4H).	IC50	404 nM	US-10202350: MCT4 inhibitors for treating disease
2-[[1-[(2-Chlorophenyl)methyl]-5-[3- (cyclobutylmethoxy)phenyl]pyrazol-3- yl]methoxy]-2-methyl-propanoic acid. 1HNMR (CDCl3): δ 1.55 (s, 6H), 1.75- 1.82 (m, 2H), 1.85-1.98 (m, 2H), 2.06- 2.14 (m, 2H), 2.64-2.70 (m, 1H), 3.71 (d, 2H), 4.63 (s, 2H), 5.43 (s, 2H), 6.42 (s, 1H), 6.75-6.92 (m, 4H), 7.20-7.36 (m, 4).	IC50	404 nM	US-10202350: MCT4 inhibitors for treating disease
2-[[5-(4-Chlorophenyl)-1-[(2- chlorophenyl)methyl]pyrazol-3- yl]methoxy]-2-methyl-propanamide 1H NMR (CD3OD 400 MHz) δ 1.46 (s, 6H), 4.58 (s, 2H), 5.40 (s, 2H), 6.52 (s, 1H), 6.71-6.76 (m, 1H), 7.20-7.58 (m, 6H)	IC50	454 nM	US-10202350: MCT4 inhibitors for treating disease
2-[[1-[[4-(dimethylamino)phenyl]methyl]-5-[3-(2-methylpropoxy)phenyl]pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	454 nM	US-10214492
(2R)-2-[[1-(2-chlorophenyl)-5-(3-cyclopropyloxyphenyl)pyrazol-3-yl]methoxy]-2-methylbutanoic acid	IC50	454 nM	US-10214492
2-[[1-[(2-chlorophenyl)methyl]-5-(5-cyclopropyloxythiophen-2-yl)pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	650 nM	US-10214492
2-[[1-[(2-chlorophenyl)methyl]-5-(3-propan-2-ylphenyl)pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	6000 nM	US-10202350: MCT4 inhibitors for treating disease
2-[[5-benzyl-1-[(2-chlorophenyl)methyl]pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	9000 nM	US-10202350: MCT4 inhibitors for treating disease
2-[[1-[(2-Chlorophenyl)methyl]-5-[3- (cyclopropoxy)phenyl]pyrazol-3- yl]methoxy]-2-methyl-propanoic acid. 1HNMR (CDCl3): δ 0.55-0.68 (m 4H), 1.55 (s, 6H), 3.50-3.54 (m 1H), 4.63 (s, 2H), 5.44 (s, 2H), 6.42 (s, 1H), 6.76-7.02 (m, 4H), 7.17-7.35 (m, 4H).	IC50	10000 nM	US-10202350: MCT4 inhibitors for treating disease
2-[(2S)-2-[5-(3,5-dimethoxyphenyl)-1-[(2-ethoxyphenyl)methyl]pyrazol-3-yl]butan-2-yl]oxy-2-methylpropanoic acid	IC50	10000 nM	US-10214492
2-[[1-[(2-Chlorophenyl)methyl]-5-[3- (trifluoromethoxy)phenyl]pyrazol-3- yl]methoxy]-2-methyl-propanoic acid. 1HNMR (CDCl3): δ 1.56 (6H), 4.63 (s, 2H), 5.41 (s, 2H), 6.46 (s, 1H), 6.77-6.79 (m, 1H), 7.12-7.25 (m, 5H), 7.32-7.35 (m, 1H), 7.38- 7.42 (m, 1H).	IC50	11000 nM	US-10202350: MCT4 inhibitors for treating disease
2-([1-[(2-methoxyphenyl)methyl]-5-[3-(2- methylpropoxy)phenyl]-1H-pyrazol-3- yl]methoxy)-2-methylpropanoic acid LC-MS (ES, m/z): 453 1H-NMR (400 MHz, MeOD) δ 0.97 (6 H, d), 1.53 (6 H, s), 1.97 (1 H, dp), 3.48 (2 H, d), 3.78 (3 H, s), 4.58 (2 H, s), 5.31 (2 H, s), 6.52 (1 H, s), 6.67-6.74 (1 H, m), 6.76- 6.82 (1 H, m), 6.85-7.00 (4 H, m), 7.22- 7.33 (2 H, m).	IC50	11000 nM	US-10202350: MCT4 inhibitors for treating disease
2-([1-[(2-chlorophenyl)methyl]-5-[3-[(2-methylpropyl)amino]phenyl]-1H-pyrazol-3-yl]methoxy)-2-methylpropanoic Acid	IC50	11000 nM	US-10202350: MCT4 inhibitors for treating disease
2-[[1-[[2-(dimethylamino)phenyl]methyl]-5-[3-(2-methylpropoxy)phenyl]pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	11000 nM	US-10214492
(2R)-2-[[1-[(2-chlorophenyl)methyl]-5-(3-methoxyphenyl)pyrazol-3-yl]methoxy]butanoic acid	IC50	11000 nM	US-10214492
2-[[1-[(2-chlorophenyl)methyl]-5-[5-(2-methylpropoxy)thiophen-2-yl]pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	11000 nM	US-10214492
(2R)-2-[[1-[2-(azetidin-1-yl)phenyl]-5-(1-propylindazol-6-yl)pyrazol-3-yl]methoxy]-2-methylbutanoic acid	IC50	11000 nM	US-10214492
2-[[1-[(2-Chlorophenyl)methyl]-5-[3- (tetrahydropyran-4- ylmethoxy)phenyl]pyrazol-3-yl]methoxy]- 2-methyl-propanoic acid. 1HNMR (CDCl3): δ 1.34-1.41 (m, 2H), 1.55 (s, 6H), 1.66-1.69 (m, 2H), 1.97- 1.99 (m, 1H), 3.38-3.46m, 2H), 3.56 (d, 2H), 3.98-4.01 (m, 2H), 4.62 (s, 2H), 5.42 (s, 2H), 6.42 (s, 1H), 6.71 (s, 1H), 6.77-6.95 (m, 3H), 7.19-7.35 (m, 4H).	IC50	12000 nM	US-10202350: MCT4 inhibitors for treating disease
2-[[1-(2-chlorophenyl)-5-[3-(2-methylpropoxy)phenyl]pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	12000 nM	US-10214492
2-methyl-2-[[5-[3-(2-methylpropoxy)phenyl]-1-phenylpyrazol-3-yl]methoxy]propanoic acid	IC50	12000 nM	US-10214492
2-[[1-(2-bromophenyl)-5-(3-cyclopropyloxyphenyl)pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	12000 nM	US-10214492
2-[[1-[(2-chlorophenyl)methyl]-5-(3,5-diethoxyphenyl)pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	12000 nM	US-10214492
2-[[1-[(2-chlorophenyl)methyl]-5-(4-methoxythiophen-2-yl)pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	13000 nM	US-10202350: MCT4 inhibitors for treating disease
2-[[5-(1-benzothiophen-2-yl)-1-[(2-chlorophenyl)methyl]pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	13000 nM	US-10214492
(2R)-2-[[1-[(2-chlorophenyl)methyl]-5-(3-methoxyphenyl)pyrazol-3-yl]methoxy]-2-methylbutanoic acid	IC50	14000 nM	US-10214492
2-[[1-[(2-Chlorophenyl)methyl]-5-(3- ethoxyphenyl)pyrazol-3-yl]methoxy]-2- methyl-propanoic acid. 1HNMR (CDCl3): δ 1.34 (t, 3H),, 1.56 (s, 6H), 3.86 (q, 2H), 4.62 (s, 2H), 5.43 (s, 2H), 6.40 (s, 1H), 6.76-6.78 (m, 2H), 6.83- 6.85 (m, 1H), 6.89-6.91 (m, 1H), 7.19-7.28 (m, 3H), 7.33-7.35 (m, 1H).	IC50	15000 nM	US-10202350: MCT4 inhibitors for treating disease
2-[[1-[(2-Chlorophenyl)methyl]-5-(3-hydroxyphenyl)pyrazol-3-yl]methoxy]-2-methyl-propanoic Acid	IC50	15000 nM	US-10202350: MCT4 inhibitors for treating disease
2-methyl-2-[[1-(2-methylphenyl)-5-[3-(2-methylpropoxy)phenyl]pyrazol-3-yl]methoxy]propanoic acid	IC50	15000 nM	US-10214492
2-[[1-[(2-chlorophenyl)methyl]-5-(4-methoxyphenyl)pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	15000 nM	US-10214492
2-[[5-(3-cyclopropyloxyphenyl)-1-(2-methylphenyl)pyrazol-3-yl]methoxy]-2-methylpropanoic acid	IC50	15000 nM	US-10214492

ChEMBL bioactivities

738 potent at pChembl≥5 of 780 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
9.64	IC50	0.23	nM	CHEMBL5419465
9.54	IC50	0.29	nM	CHEMBL5399511
9.52	IC50	0.3	nM	CHEMBL5268154
9.52	IC50	0.3	nM	CHEMBL5937220
9.49	IC50	0.32	nM	CHEMBL5556465
9.46	IC50	0.35	nM	CHEMBL5562055
9.46	IC50	0.35	nM	CHEMBL5789173
9.46	IC50	0.35	nM	CHEMBL5960010
9.44	IC50	0.36	nM	CHEMBL5267318
9.44	IC50	0.36	nM	CHEMBL5562438
9.27	IC50	0.54	nM	CHEMBL6012305
9.24	IC50	0.57	nM	CHEMBL5270910
9.23	IC50	0.59	nM	CHEMBL5560319
9.23	IC50	0.59	nM	CHEMBL5935003
9.08	IC50	0.83	nM	CHEMBL6010364
9.04	IC50	0.91	nM	CHEMBL5425432
9.00	IC50	1	nM	MSC-4381
9.00	IC50	1	nM	CHEMBL5219543
9.00	IC50	1	nM	CHEMBL1616099
9.00	IC50	1	nM	SYROSINGOPINE
9.00	IC50	1	nM	CHEMBL6031816
9.00	IC50	1	nM	CHEMBL5956640
8.96	IC50	1.1	nM	CHEMBL5904074
8.92	IC50	1.2	nM	CHEMBL5904026
8.89	IC50	1.3	nM	CHEMBL5434099
8.89	IC50	1.3	nM	CHEMBL5993465
8.89	IC50	1.3	nM	CHEMBL5958336
8.89	IC50	1.3	nM	CHEMBL5806253
8.85	IC50	1.4	nM	CHEMBL6037396
8.77	IC50	1.7	nM	CHEMBL5407216
8.77	IC50	1.7	nM	CHEMBL5804342
8.72	IC50	1.9	nM	CHEMBL5940699
8.72	IC50	1.9	nM	CHEMBL5759787
8.72	IC50	1.9	nM	CHEMBL5790479
8.70	IC50	2	nM	CHEMBL6054294
8.68	IC50	2.1	nM	CHEMBL5864334
8.68	IC50	2.1	nM	CHEMBL6006208
8.66	IC50	2.2	nM	CHEMBL5803571
8.62	IC50	2.4	nM	CHEMBL5811534
8.62	IC50	2.4	nM	CHEMBL6035770
8.62	IC50	2.4	nM	CHEMBL5833032
8.60	IC50	2.5	nM	CHEMBL375166
8.60	IC50	2.5	nM	CHEMBL5414818
8.60	IC50	2.5	nM	CHEMBL6022434
8.59	IC50	2.6	nM	CHEMBL6017525
8.59	IC50	2.6	nM	CHEMBL5923718
8.59	IC50	2.6	nM	CHEMBL6056725
8.55	IC50	2.8	nM	CHEMBL5982634
8.55	IC50	2.8	nM	CHEMBL5832566
8.54	IC50	2.9	nM	CHEMBL5996320

PubChem BioAssay actives

140 with measured affinity, of 248 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-[[5-[4-[(3R)-3-[(2,5,7-trimethyl-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)methyl]pyrrolidin-1-yl]phenyl]pyrazin-2-yl]methyl]morpholine	1964300: Inhibition of MCT4 in human SK-BR-3 cells assessed as inhibition of lactate efflux incubated for 4 hrs by automated microplate reader analysis	ic50	0.0002	uM
2-[[1-[2-(azetidin-1-yl)phenyl]-5-[3-(2,2-dimethylpropoxy)phenyl]pyrazol-3-yl]methoxy]-2-methylpropanoic acid	2074107: Inhibition of MCT4 in human MDA-MB-231 cells by BCECF-AM dye based assay	ic50	0.0003	uM
(2S)-2-[[1-[(2-chlorophenyl)methyl]-5-(1-ethylindazol-6-yl)pyrazol-3-yl]methoxy]-2-methylbutanoic acid	2074107: Inhibition of MCT4 in human MDA-MB-231 cells by BCECF-AM dye based assay	ic50	0.0003	uM
(2R)-2-[[5-(1-ethylindazol-6-yl)-1-(2-pyrrolidin-1-ylphenyl)pyrazol-3-yl]methoxy]-2-methylbutanoic acid	1931150: Inhibition of MCT4 in human MDA-MB-231 cells by BCECF-AM dye based fluorescence assay	ic50	0.0003	uM
4-[[6-[4-[(3R)-3-[(2,5,7-trimethyl-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)methyl]pyrrolidin-1-yl]phenyl]pyridazin-3-yl]methyl]morpholine	1964300: Inhibition of MCT4 in human SK-BR-3 cells assessed as inhibition of lactate efflux incubated for 4 hrs by automated microplate reader analysis	ic50	0.0003	uM
(2R)-2-[[1-[2-(azetidin-1-yl)phenyl]-5-(3-cyclopropyloxyphenyl)pyrazol-3-yl]methoxy]-2-methylbutanoic acid	1931150: Inhibition of MCT4 in human MDA-MB-231 cells by BCECF-AM dye based fluorescence assay	ic50	0.0004	uM
4-[[4-[5-[(3R)-3-[(2,5,7-trimethyl-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)methyl]pyrrolidin-1-yl]pyrazin-2-yl]phenyl]methyl]morpholine	1964300: Inhibition of MCT4 in human SK-BR-3 cells assessed as inhibition of lactate efflux incubated for 4 hrs by automated microplate reader analysis	ic50	0.0004	uM
(2S)-2-[[1-[2-(azetidin-1-yl)phenyl]-5-(3-cyclopropyloxyphenyl)pyrazol-3-yl]methoxy]-2-methylbutanoic acid	2074107: Inhibition of MCT4 in human MDA-MB-231 cells by BCECF-AM dye based assay	ic50	0.0004	uM
(2R)-2-[[1-[2-(azetidin-1-yl)phenyl]-5-(1-propylindazol-6-yl)pyrazol-3-yl]methoxy]-2-methylbutanoic acid	1931150: Inhibition of MCT4 in human MDA-MB-231 cells by BCECF-AM dye based fluorescence assay	ic50	0.0006	uM
2-[[5-[3-(2,2-dimethylpropoxy)phenyl]-1-(1-methylindazol-7-yl)pyrazol-3-yl]methoxy]-2-methylpropanoic acid	2074107: Inhibition of MCT4 in human MDA-MB-231 cells by BCECF-AM dye based assay	ic50	0.0006	uM
2,5,7-trimethyl-6-[[(3R)-1-[4-[6-[(4-methylpiperazin-1-yl)methyl]pyridazin-3-yl]phenyl]pyrrolidin-3-yl]methyl]-[1,2,4]triazolo[1,5-a]pyrimidine	1964300: Inhibition of MCT4 in human SK-BR-3 cells assessed as inhibition of lactate efflux incubated for 4 hrs by automated microplate reader analysis	ic50	0.0009	uM
2-[(1-benzyl-5-phenylpyrazol-3-yl)methoxy]-2-methylpropanoic acid	1916520: Inhibition of MCT4 in human NCI-H358 cells	ic50	0.0010	uM
3-[1-hydroxy-2-[(4-phenylphenyl)methylamino]ethyl]phenol	1916520: Inhibition of MCT4 in human NCI-H358 cells	ic50	0.0010	uM
methyl (1R,15S,17R,18R,19S,20S)-17-(4-ethoxycarbonyloxy-3,5-dimethoxybenzoyl)oxy-6,18-dimethoxy-1,3,11,12,14,15,16,17,18,19,20,21-dodecahydroyohimban-19-carboxylate	1916520: Inhibition of MCT4 in human NCI-H358 cells	ic50	0.0010	uM
4-[[6-[4-[(3R)-3-[(2,5,7-trimethyl-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)oxy]pyrrolidin-1-yl]phenyl]pyridazin-3-yl]methyl]morpholine	1964300: Inhibition of MCT4 in human SK-BR-3 cells assessed as inhibition of lactate efflux incubated for 4 hrs by automated microplate reader analysis	ic50	0.0013	uM
2,5,7-trimethyl-6-[[(3R)-1-[5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrazin-2-yl]pyrrolidin-3-yl]methyl]-[1,2,4]triazolo[1,5-a]pyrimidine	1964300: Inhibition of MCT4 in human SK-BR-3 cells assessed as inhibition of lactate efflux incubated for 4 hrs by automated microplate reader analysis	ic50	0.0017	uM
6-[(3,5-dimethyl-1H-pyrazol-4-yl)methyl]-5-[(4S)-4-hydroxy-1,2-oxazolidine-2-carbonyl]-3-methyl-1-(2-methylpropyl)thieno[2,3-d]pyrimidine-2,4-dione	1938960: Inhibition of human MCT4 in human SNU-398 cells assessed as inhibition of radioactive lactate efflux preincubated for 30 mins followed by D(+)glucose and measured after 4 hrs by dialysis based UHPLC-ESI-Q-Orbitrap-MS analysis	ic50	0.0025	uM
1-[4-[[6-[4-[(3R)-3-[(2,5,7-trimethyl-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)oxy]pyrrolidin-1-yl]phenyl]pyridazin-3-yl]methyl]piperazin-1-yl]ethanone	1964300: Inhibition of MCT4 in human SK-BR-3 cells assessed as inhibition of lactate efflux incubated for 4 hrs by automated microplate reader analysis	ic50	0.0025	uM
2,5,7-trimethyl-6-[(3R)-1-[4-[6-[(4-methylpiperazin-1-yl)methyl]pyridazin-3-yl]phenyl]pyrrolidin-3-yl]oxy-[1,2,4]triazolo[1,5-a]pyrimidine	1964300: Inhibition of MCT4 in human SK-BR-3 cells assessed as inhibition of lactate efflux incubated for 4 hrs by automated microplate reader analysis	ic50	0.0031	uM
5-phenyl-N-[2-(2,5,7-trimethyl-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)ethyl]-1,3,4-thiadiazole-2-carboxamide	1964300: Inhibition of MCT4 in human SK-BR-3 cells assessed as inhibition of lactate efflux incubated for 4 hrs by automated microplate reader analysis	ic50	0.0056	uM
5-[4-[(3S)-4-methylmorpholin-3-yl]phenyl]-N-[2-(2,5,7-trimethyl-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)ethyl]pyrazine-2-carboxamide	1964300: Inhibition of MCT4 in human SK-BR-3 cells assessed as inhibition of lactate efflux incubated for 4 hrs by automated microplate reader analysis	ic50	0.0063	uM
5-[4-(morpholin-4-ylmethyl)phenyl]-N-[2-(2,5,7-trimethyl-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)ethyl]pyrazine-2-carboxamide	1964300: Inhibition of MCT4 in human SK-BR-3 cells assessed as inhibition of lactate efflux incubated for 4 hrs by automated microplate reader analysis	ic50	0.0068	uM
5-[(4S)-4-hydroxy-4-methyl-1,2-oxazolidine-2-carbonyl]-3-methyl-6-[[5-methyl-3-(trifluoromethyl)-1H-pyrazol-4-yl]methyl]-1-propan-2-ylthieno[2,3-d]pyrimidine-2,4-dione	1938960: Inhibition of human MCT4 in human SNU-398 cells assessed as inhibition of radioactive lactate efflux preincubated for 30 mins followed by D(+)glucose and measured after 4 hrs by dialysis based UHPLC-ESI-Q-Orbitrap-MS analysis	ic50	0.0071	uM
7-[benzyl(methyl)amino]-2-oxochromene-3-carboxylic acid	780537: Inhibition of MCT4-mediated [14C]-lactate uptake in human SiHa cells in lactate-containing medium assessed as remaining lactate concentration in culture medium after 12 mins by liquid scintillation counting	ic50	0.0100	uM
5-[2-[5-chloro-2-[(5-ethoxyquinolin-8-yl)sulfonylamino]phenyl]ethynyl]-4-methoxypyridine-2-carboxylic acid	1938953: Binding affinity to full-length C-terminal GFP-tagged human MCT4 incubated for 1 hrs by fluorescence cross-correlation spectroscopy analysis	ki	0.0110	uM
5-[2-[2-[(5-methoxyquinolin-8-yl)sulfonylamino]phenyl]ethynyl]-3-methylpyridine-2-carboxylic acid	1938953: Binding affinity to full-length C-terminal GFP-tagged human MCT4 incubated for 1 hrs by fluorescence cross-correlation spectroscopy analysis	ki	0.0110	uM
5-[2-[2-[(5-methoxyquinolin-8-yl)sulfonylamino]phenyl]ethynyl]pyridine-2-carboxylic acid	1938959: Inhibition of human MCT4 in human MDA-MB-231 cells assessed as inhibition of radioactive lactate efflux preincubated for 30 mins followed by D(+)glucose and measured after 4 hrs by dialysis based UHPLC-ESI-Q-Orbitrap-MS analysis	ic50	0.0130	uM
(E)-2-cyano-3-[4-(dibutylamino)-2-methoxyphenyl]prop-2-enoic acid	1931140: Inhibition of MCT4 (unknown origin) assessed as reduction in [14C]lactate uptake incubated for 20 mins by liquid scintillation counting analysis	ic50	0.0140	uM
5-[2-[2-[(5-ethoxyquinolin-8-yl)sulfonylamino]phenyl]ethynyl]pyridine-2-carboxylic acid	1938953: Binding affinity to full-length C-terminal GFP-tagged human MCT4 incubated for 1 hrs by fluorescence cross-correlation spectroscopy analysis	ki	0.0160	uM
5-[4-[(3R)-4-methylmorpholin-3-yl]phenyl]-N-[2-(2,5,7-trimethyl-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)ethyl]pyrazine-2-carboxamide	1964300: Inhibition of MCT4 in human SK-BR-3 cells assessed as inhibition of lactate efflux incubated for 4 hrs by automated microplate reader analysis	ic50	0.0160	uM
4-phenyl-N-[2-(2,5,7-trimethyl-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)ethyl]benzamide	1964300: Inhibition of MCT4 in human SK-BR-3 cells assessed as inhibition of lactate efflux incubated for 4 hrs by automated microplate reader analysis	ic50	0.0160	uM
5-[2-[2-[(7-methylquinolin-8-yl)sulfonylamino]phenyl]ethynyl]pyridine-2-carboxylic acid	1938953: Binding affinity to full-length C-terminal GFP-tagged human MCT4 incubated for 1 hrs by fluorescence cross-correlation spectroscopy analysis	ki	0.0170	uM
5-[2-[2-[(5-ethoxyquinolin-8-yl)sulfonylamino]phenyl]ethynyl]-4-methoxypyridine-2-carboxylic acid	1938953: Binding affinity to full-length C-terminal GFP-tagged human MCT4 incubated for 1 hrs by fluorescence cross-correlation spectroscopy analysis	ki	0.0170	uM
5-[2-[2-[(5-ethoxyquinolin-8-yl)sulfonylamino]phenyl]ethynyl]-3-(methylamino)pyridine-2-carboxylic acid	1938953: Binding affinity to full-length C-terminal GFP-tagged human MCT4 incubated for 1 hrs by fluorescence cross-correlation spectroscopy analysis	ki	0.0170	uM
(E)-3-[4-[bis(2-methylpropyl)amino]-2-methoxyphenyl]-2-cyanoprop-2-enoic acid	1931140: Inhibition of MCT4 (unknown origin) assessed as reduction in [14C]lactate uptake incubated for 20 mins by liquid scintillation counting analysis	ic50	0.0170	uM
4-[2-[2-[(5-methoxyquinolin-8-yl)sulfonylamino]phenyl]ethynyl]benzoic acid	1938959: Inhibition of human MCT4 in human MDA-MB-231 cells assessed as inhibition of radioactive lactate efflux preincubated for 30 mins followed by D(+)glucose and measured after 4 hrs by dialysis based UHPLC-ESI-Q-Orbitrap-MS analysis	ic50	0.0210	uM
(E)-2-cyano-3-[2-methoxy-4-(N-phenylanilino)phenyl]prop-2-enoic acid	1931140: Inhibition of MCT4 (unknown origin) assessed as reduction in [14C]lactate uptake incubated for 20 mins by liquid scintillation counting analysis	ic50	0.0230	uM
5-phenyl-N-[2-(2,5,7-trimethyl-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)ethyl]pyrazine-2-carboxamide	1964300: Inhibition of MCT4 in human SK-BR-3 cells assessed as inhibition of lactate efflux incubated for 4 hrs by automated microplate reader analysis	ic50	0.0270	uM
5-[2-[2-[(3-methylquinolin-8-yl)sulfonylamino]phenyl]ethynyl]pyridine-2-carboxylic acid	1938953: Binding affinity to full-length C-terminal GFP-tagged human MCT4 incubated for 1 hrs by fluorescence cross-correlation spectroscopy analysis	ki	0.0290	uM
5-[2-[2-[(4-methylquinolin-8-yl)sulfonylamino]phenyl]ethynyl]pyridine-2-carboxylic acid	1938953: Binding affinity to full-length C-terminal GFP-tagged human MCT4 incubated for 1 hrs by fluorescence cross-correlation spectroscopy analysis	ki	0.0320	uM
(E)-2-cyano-3-[4-(dibenzylamino)-2-methoxyphenyl]prop-2-enoic acid	1931140: Inhibition of MCT4 (unknown origin) assessed as reduction in [14C]lactate uptake incubated for 20 mins by liquid scintillation counting analysis	ic50	0.0320	uM
5-[2-[2-(quinolin-8-ylsulfonylamino)phenyl]ethynyl]pyridine-2-carboxylic acid	1938953: Binding affinity to full-length C-terminal GFP-tagged human MCT4 incubated for 1 hrs by fluorescence cross-correlation spectroscopy analysis	ki	0.0370	uM
5-[2-[2-[[4-[2-(2-phenoxyethoxy)ethoxy]quinolin-8-yl]sulfonylamino]phenyl]ethynyl]pyridine-2-carboxylic acid	1938944: Inhibition of human MCT4 in human MDA-MB-231 cells assessed as inhibition of lactate efflux preincubated for 30 mins followed by D(+)glucose and measured after 4 hrs by dialysis based UHPLC-ESI-Q-Orbitrap-MS analysis	ic50	0.0400	uM
2-(methylamino)-4-[2-[2-[(7-methylquinolin-8-yl)sulfonylamino]phenyl]ethynyl]benzoic acid	1938944: Inhibition of human MCT4 in human MDA-MB-231 cells assessed as inhibition of lactate efflux preincubated for 30 mins followed by D(+)glucose and measured after 4 hrs by dialysis based UHPLC-ESI-Q-Orbitrap-MS analysis	ic50	0.0500	uM
5-[2-[2-[(6-methylquinolin-8-yl)sulfonylamino]phenyl]ethynyl]pyridine-2-carboxylic acid	1938953: Binding affinity to full-length C-terminal GFP-tagged human MCT4 incubated for 1 hrs by fluorescence cross-correlation spectroscopy analysis	ki	0.0510	uM
(E)-2-cyano-3-(2-methoxy-4-pyrrolidin-1-ylphenyl)prop-2-enoic acid	1931140: Inhibition of MCT4 (unknown origin) assessed as reduction in [14C]lactate uptake incubated for 20 mins by liquid scintillation counting analysis	ic50	0.0530	uM
3-methyl-5-[2-[2-[(7-methylquinolin-8-yl)sulfonylamino]phenyl]ethynyl]pyridine-2-carboxylic acid	1938953: Binding affinity to full-length C-terminal GFP-tagged human MCT4 incubated for 1 hrs by fluorescence cross-correlation spectroscopy analysis	ki	0.0560	uM
(E)-2-cyano-3-(2-methoxy-4-piperidin-1-ylphenyl)prop-2-enoic acid	1931140: Inhibition of MCT4 (unknown origin) assessed as reduction in [14C]lactate uptake incubated for 20 mins by liquid scintillation counting analysis	ic50	0.0580	uM
N-(5-phenyl-1,3,4-thiadiazol-2-yl)-3-(2,5,7-trimethyl-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)propanamide	1964300: Inhibition of MCT4 in human SK-BR-3 cells assessed as inhibition of lactate efflux incubated for 4 hrs by automated microplate reader analysis	ic50	0.0840	uM
(E)-2-cyano-3-[4-(dipentylamino)-2-methoxyphenyl]prop-2-enoic acid	1931140: Inhibition of MCT4 (unknown origin) assessed as reduction in [14C]lactate uptake incubated for 20 mins by liquid scintillation counting analysis	ic50	0.0850	uM

CTD chemical–gene interactions

89 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	increases methylation, affects cotreatment, increases expression, affects expression	8
Oxygen	affects expression, affects reaction, increases expression	4
bisphenol A	affects expression, increases expression	3
Air Pollutants	affects expression, affects cotreatment, decreases expression, increases abundance	3
Estradiol	affects binding, increases expression, decreases expression	3
Tobacco Smoke Pollution	affects expression, decreases expression, increases expression	3
methylmercuric chloride	decreases expression	2
trichostatin A	affects cotreatment, increases expression	2
sodium arsenite	affects methylation, decreases expression	2
cobaltous chloride	increases expression, decreases reaction	2
mercuric bromide	decreases expression, affects cotreatment	2
Decitabine	increases expression, affects expression	2
Benzo(a)pyrene	increases methylation, affects methylation, decreases expression	2
Nickel	increases expression	2
Ozone	decreases expression, increases abundance, affects expression, affects cotreatment	2
Tretinoin	affects cotreatment, increases expression	2
Cyclosporine	decreases methylation, increases expression	2
Cadmium Chloride	increases abundance, increases expression	2
4’-methoxy-1-naphthylfenoterol	decreases expression	1
FR900359	increases phosphorylation	1
bisphenol F	affects cotreatment, increases methylation	1
PF-06840003	decreases expression, decreases reaction	1
triphenyl phosphate	affects expression	1
alpha-pinene	affects cotreatment, decreases expression, increases abundance	1
pyrogallol 1,3-dimethyl ether	affects cotreatment, decreases expression, affects localization, increases expression	1
beta-lapachone	increases expression, decreases expression	1
arsenite	affects binding, decreases reaction	1
zinc chloride	decreases reaction, increases expression	1
manganese chloride	increases expression	1
potassium chromate(VI)	decreases expression, affects cotreatment	1

ChEMBL screening assays

58 unique, capped per target: 53 binding, 5 functional

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1226691	Binding	Inhibition of human MCT4 expressed in INS1 cells assessed as reduction in intracellular acidification at 100 nM after 1 hr by L-Lactate uptake based BCECF staining	Monocarboxylate transporter MCT1 is a target for immunosuppression. — Nat Chem Biol
CHEMBL2076227	Functional	TP_TRANSPORTER: uptake in Xenopus laevis oocytes	Characterisation of human monocarboxylate transporter 4 substantiates its role in lactic acid efflux from skeletal muscle. — J Physiol

Cellosaurus cell lines

6 cell lines: 6 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_D1Z1	Abcam A-549 SLC16A3 KO	Cancer cell line	Male
CVCL_D2D2	Abcam HCT 116 SLC16A3 KO	Cancer cell line	Male
CVCL_D4I5	HCT116-SLC16A3-KO-c5	Cancer cell line	Male
CVCL_D4I6	HCT116-SLC16A3-KO-c9	Cancer cell line	Male
CVCL_TL68	HAP1 SLC16A3 (-) 1	Cancer cell line	Male
CVCL_TL69	HAP1 SLC16A3 (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.