SLC29A3

Summary

SLC29A3 (solute carrier family 29 member 3, HGNC:23096) is a protein-coding gene on chromosome 10q22.1, encoding Equilibrative nucleoside transporter 3 (Q9BZD2). Uniporter that mediates the facilitative transport of nucleoside across lysosomal and mitochondrial membranes.

This gene encodes a nucleoside transporter. The encoded protein plays a role in cellular uptake of nucleosides, nucleobases, and their related analogs. Mutations in this gene have been associated with H syndrome, which is characterized by cutaneous hyperpigmentation and hypertrichosis, hepatosplenomegaly, heart anomalies, and hypogonadism. A related disorder, PHID (pigmented hypertrichosis with insulin-dependent diabetes mellitus), has also been associated with mutations at this locus. Alternatively spliced transcript variants have been described.

Source: NCBI Gene 55315 — RefSeq curated summary.

At a glance

• Gene–disease (curated): H syndrome (Definitive, ClinGen) — +1 more curated relationship
• GWAS associations: 9
• Clinical variants (ClinVar): 518 total — 32 pathogenic, 6 likely-pathogenic
• Phenotypes (HPO): 102
• Druggable target: yes
• MANE Select transcript: NM_018344

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:23096
Approved symbol	SLC29A3
Name	solute carrier family 29 member 3
Location	10q22.1
Locus type	gene with protein product
Status	Approved
Aliases	ENT3, FLJ11160, hENT3
Ensembl gene	ENSG00000198246
Ensembl biotype	protein_coding
OMIM	612373
Entrez	55315

Gene structure

Transcript identifiers

Ensembl transcripts: 14 — 10 nonsense_mediated_decay, 2 protein_coding, 1 protein_coding_CDS_not_defined, 1 retained_intron

ENST00000373189, ENST00000469204, ENST00000479577, ENST00000642198, ENST00000642772, ENST00000643042, ENST00000643619, ENST00000643752, ENST00000644088, ENST00000644591, ENST00000644895, ENST00000645345, ENST00000647524, ENST00000697843

RefSeq mRNA: 3 — MANE Select: NM_018344 NM_001174098, NM_001363518, NM_018344

CCDS: CCDS7310, CCDS86099

Canonical transcript exons

ENST00000373189 — 6 exons

Exon	Start	End
ENSE00001027395	71351562	71351788
ENSE00001027397	71356081	71356243
ENSE00001027400	71344209	71344291
ENSE00001459740	71361954	71363385
ENSE00003552806	71322756	71323054
ENSE00003817004	71319259	71319310

Expression profiles

Bgee: expression breadth ubiquitous, 219 present calls, max score 88.75.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 8.4606 / max 169.5005, expressed in 1674 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
105418	5.6809	1522
105419	2.7797	1097

Top tissues by expression

272 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
olfactory bulb	UBERON:0002264	88.75	gold quality
type B pancreatic cell	CL:0000169	88.47	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	88.16	gold quality
mucosa of urinary bladder	UBERON:0001259	84.90	gold quality
placenta	UBERON:0001987	84.48	gold quality
cervix squamous epithelium	UBERON:0006922	83.24	gold quality
diaphragm	UBERON:0001103	83.22	gold quality
oocyte	CL:0000023	82.51	gold quality
right ovary	UBERON:0002118	80.81	gold quality
granulocyte	CL:0000094	80.71	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	80.38	gold quality
leukocyte	CL:0000738	80.27	gold quality
mononuclear cell	CL:0000842	80.19	gold quality
monocyte	CL:0000576	80.15	gold quality
epithelial cell of pancreas	CL:0000083	79.85	gold quality
left ovary	UBERON:0002119	79.46	gold quality
tongue squamous epithelium	UBERON:0006919	79.36	gold quality
cerebellar vermis	UBERON:0004720	79.31	gold quality
epithelium of nasopharynx	UBERON:0001951	79.01	silver quality
epithelium of bronchus	UBERON:0002031	78.66	gold quality
bronchus	UBERON:0002185	78.49	gold quality
lymph node	UBERON:0000029	78.45	gold quality
smooth muscle tissue	UBERON:0001135	78.42	gold quality
ovary	UBERON:0000992	78.38	gold quality
layer of synovial tissue	UBERON:0007616	78.28	silver quality
urinary bladder	UBERON:0001255	78.15	gold quality
secondary oocyte	CL:0000655	78.13	gold quality
inferior vagus X ganglion	UBERON:0005363	77.98	silver quality
periodontal ligament	UBERON:0008266	77.82	silver quality
right lobe of liver	UBERON:0001114	77.39	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	4.17

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

29 targeting SLC29A3, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-1-3P	99.93	72.35	1914
HSA-MIR-206	99.93	72.50	1893
HSA-MIR-3119	99.92	71.34	2390
HSA-MIR-613	99.91	71.50	1710
HSA-MIR-6780A-5P	99.88	66.69	2776
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-1273H-5P	99.77	66.32	2471
HSA-MIR-4517	99.76	69.19	1867
HSA-MIR-149-3P	99.72	68.22	3963
HSA-MIR-1179	99.71	68.70	1040
HSA-MIR-30B-3P	99.70	65.76	2325
HSA-MIR-3689A-3P	99.70	65.73	2306
HSA-MIR-3689B-3P	99.70	65.71	2311
HSA-MIR-3689C	99.70	65.71	2311
HSA-MIR-6779-5P	99.70	65.76	2363
HSA-MIR-6883-5P	99.69	68.05	3785
HSA-MIR-6128	99.33	67.83	1581
HSA-MIR-4505	99.27	67.81	2678
HSA-MIR-5787	99.22	67.86	2628
HSA-MIR-1207-3P	98.99	66.22	1532
HSA-MIR-873-5P	98.84	66.90	1348
HSA-MIR-760	98.81	66.65	1392
HSA-MIR-12114	98.70	63.45	730
HSA-MIR-676-5P	98.49	68.87	1492
HSA-MIR-5008-5P	98.42	65.87	1019
HSA-MIR-6864-5P	98.38	66.59	1079
HSA-MIR-3664-3P	97.85	67.62	1452
HSA-MIR-2276-5P	96.27	65.85	937

Literature-anchored findings (GeneRIF, showing 34)

• broad selectivity, low affinity nucleoside transporter that can also transport adenine (PMID:15701636)
• H syndrome is caused by mutations in the nucleoside transporter hENT3 (PMID:18940313)
• These data suggest that cellular localization of hENT3 is cell type dependent and the native transporter is substantially expressed in mitochondria and/or cell surface. (PMID:19164483)
• Five loss-of-function mutations were identified in the SLC29A3 gene in patients with pigmented hypertrichosis with insulin-dependent diabetes mellitus syndrome. (PMID:19336477)
• Data show that SLC29A3 is expressed in the islet and recessive mutations are likely to result in beta cell failure. (PMID:19581757)
• analysis of two novel mutations affecting the same amino acid residue of hENT3 in H syndrome [case report] (PMID:19889517)
• Mutation analysis of candidate genes within the target interval identified biallelic germline mutations in SLC29A3 in the Faisalabad histiocytosis kindred and in two families reported to have familial Rosai-Dorfman disease. (PMID:20140240)
• Mutation analysis showed that both parents and one of the three siblings were heterozygous for the mutation and that the mutation was absent in the remaining two siblings as well as in 100 normal control samples from the same ethnic population. (PMID:20199539)
• severe reductions/losses of hENT3 nucleoside transport functions of hENT3 syndrome mutants (PMID:20595384)
• The genotype (CC, TC, IT) and allele distribution of the ENT3 single nudcleotide polymorphism in the patients with lung cancer was not significantly different compared with that in controls (P > 0.05). (PMID:20677642)
• The ‘rescue’ role played by a normally noncoding mRNA splice variant of SLC29A3, uncovering a new mechanism by which frameshift mutations can be hypomorphic. (PMID:22238637)
• Two novel mutations in the SLC29A3 gene were identified: a homozygous splice site mutation IVS1+2T>1 G, and a homozygous missense mutation c.1157G>1 A (p.R386Q) which substituted highly conserved amino acid residue in a transmembrane domain. (PMID:22653152)
• we describe two unrelated children with DSS associated with autosomal recessive inheritance of variants in SLC29A3. (PMID:22875837)
• Homozygous mutation in SLC29A3 in 2 children of consanguineous parents exhibit H syndrome: insulin-dependent diabetes, hyperpigmentation, hepatosplenomegaly, lymphadenopathy, left ventricular hypertrophy, sensorineural hearing loss. [CASE REPORT] (PMID:22989030)
• Mutation analysis of the SLC29A3 gene revealed a novel nonsense mutation in H syndrome with agenesis of the inferior vena cava. (PMID:23406517)
• SLC29A3 genetic polymorphisms may have a role in overall survival in advanced non-small-cell lung cancer treated with gemcitabine (PMID:24535606)
• novel mutation c.401G>A associated with pigmented hypertrichosis with insulin-dependent diabetes mellitus syndrome (PMID:24894595)
• In a patient with H syndrome, a compound heterozygous alteration in the SLC29A3 gene was found. Her parents each had one of the mutations. The c.243delA frameshift mutation leading to a premature termination, resulting in a truncated protein, and a splice site mutation c.300+1G>C predicted to cause a splicing error. Patients with similar mutations are reviewed. (PMID:27316388)
• A homozygous c.1339G>A (p.Glu447Lys) mutation in the SLC29A3 gene. (PMID:28554179)
• The results suggest a putative pH-sensing role for Asp-219 and Glu-447 in hENT3 and that the size, ionization state, or electronegative polarity at these positions is crucial for obligate acidic pH-dependent activity. (PMID:28729424)
• Equilibrative nucleoside transporter 3 (ENT3), encoded by the SLC29A3 gene, is the major acidic pH dependent nucleoside transporter responsible for maintaining nucleoside homeostasis in lysosomal, and potentially, in mitochondrial compartments. (PMID:28985132)
• 225D and 231L in the N-terminal half of hENT3 partially contribute to the ability of hENT3 to transport AZT and DDI. (PMID:29530865)
• Study in Tunisian patients extends the mutation spectrum of H syndrome by reporting a novel frame-shift mutation, the p.S15Pfs*86 in exon 2 of SLC29A3 gene. (PMID:29808591)
• Mutation on exon 6 of the SLC29A3 gene is associated with stunted growth and development of autoimmune insulin dependent diabetes mellitus. (PMID:30517079)
• mutations in SLC29A3 and TCIRG1 in patients with Sclerosing bone dysplasias with hallmarks of dysosteosclerosis. (PMID:30537558)
• A novel 3’UTR mutation in the SLC29A3 gene is associated with the PHID (Pigmentary Hypertrichosis and non-autoimmune insulin-dependent diabetes mellitus) syndrome, highlighting a potentially new pathological mechanism for this disease. The involvement of the 3’UTR has not been previously established in any of the H syndrome disease cluster or in any complex syndrome of DM (Diabetes Mellitus). (PMID:30821020)
• The SLC29A3 gene, encoding a nucleoside transporter protein, is found in intracellular membranes. Mutations in this gene cause a wide range of clinical manifestations including H syndrome, pigmented hypertrichosis with insulin dependent diabetes, Faisalabad histiocytosis, and dysosteosclerosis. However, all these disorders with their different names and terminologies are actually the same entity termed H syndrome (PMID:31464584)
• MiR-1224-5p acts as a tumor suppressor via inhibiting the malignancy of rectal cancer through targeting SLC29A3. (PMID:32738187)
• Pediatric recurrent Rosai-Dorfman disease with germline heterozygous SLC29A3 and somatic MAP2K1 mutations. (PMID:32944792)
• Resolution of sclerotic lesions of dysosteosclerosis due to biallelic SLC29A3 variant in a Turkish girl. (PMID:33837634)
• Phenotypic intrafamilial variability including H syndrome and Rosai-Dorfman disease associated with the same c.1088G > A mutation in the SLC29A3 gene. (PMID:34657628)
• Loss of function of ENT3 drives histiocytosis and inflammation through TLR-MAPK signaling. (PMID:37738562)
• Equilibrative nucleotide transporter ENT3 (SLC29A3): A unique transporter for inherited disorders and cancers. (PMID:38104646)
• Identification of Coding Variants in 10q22.1 Associated with Vitiligo in the Chinese Han Population. (PMID:38546281)

Cross-species orthologs

10 orthologs

Organism	Symbol	Gene ID
danio_rerio	slc29a3	ENSDARG00000077828
mus_musculus	Slc29a3	ENSMUSG00000020100
rattus_norvegicus	Slc29a3	ENSRNOG00000000568
drosophila_melanogaster	Ent2	FBGN0263916
caenorhabditis_elegans		WBGENE00001320
caenorhabditis_elegans		WBGENE00008123
caenorhabditis_elegans		WBGENE00009686
caenorhabditis_elegans		WBGENE00010510
caenorhabditis_elegans		WBGENE00010701
caenorhabditis_elegans		WBGENE00017532

Paralogs (3): SLC29A1 (ENSG00000112759), SLC29A4 (ENSG00000164638), SLC29A2 (ENSG00000174669)

Protein

Protein identifiers

Equilibrative nucleoside transporter 3 — Q9BZD2 (reviewed: Q9BZD2)

Alternative names: Solute carrier family 29 member 3

All UniProt accessions (10): A0A2R8Y4B7, A0A2R8Y4I0, A0A2R8Y5R8, A0A2R8Y5U2, A0A2R8Y657, A0A2R8Y863, A0A2R8YDA4, A0A2R8YDR8, A0A2R8YGC2, Q9BZD2

UniProt curated annotations — full annotation on UniProt →

Function. Uniporter that mediates the facilitative transport of nucleoside across lysosomal and mitochondrial membranes. Functions as a non-electrogenic Na(+)-independent transporter. Substrate transport is pH-dependent and enhanced under acidic condition, probably reflecting the location of the transporter in acidic intracellular compartments. Proton is not a cotransporting ion but most likely change the ionization state of the transporter which dictates transport-permissible/impermissible conformation for nucleoside translocation. May direct the nucleoside transport from lysosomes to cytosol or cytosol to mitochondria to facilitate the fundamental function of salvage synthesis of nucleic acids. Involved in the transport of nucleosides (adenosine, guanosine, uridine, thymidine, cytidine and inosine) and deoxynucleosides (deoxyadenosine, deoxycytidine). Also mediates transport of purine nucleobases (adenine, guanine) and pyrimidine nucleobases (uracil). Also able to transport monoamine neurotransmitters dopamine, serotonin, noradrenaline and tyramine. Capable of transporting ATP. Mediates nucleoside export from lysosomes in macrophages, which regulates macrophage functions and numbers.

Subcellular location. Lysosome membrane. Late endosome membrane. Mitochondrion membrane. Cell membrane.

Tissue specificity. Widely expressed in both adult and fetal tissues. Highest levels in placenta, uterus, ovary, spleen, lymph node and bone marrow. Expressed in liver. Lowest levels in brain and heart. Expressed in macrophages.

Disease relevance. Histiocytosis-lymphadenopathy plus syndrome (HLAS) [MIM:602782] A syndrome characterized by the combination of features from 2 or more of four histiocytic disorders, originally thought to be distinct: Faisalabad histiocytosis (FHC), sinus histiocytosis with massive lymphadenopathy (SHML), H syndrome, and pigmented hypertrichosis with insulin-dependent diabetes mellitus syndrome (PHID). FHC features include joint deformities, sensorineural hearing loss, and subsequent development of generalized lymphadenopathy and swellings in the eyelids that contain histiocytes. SHML causes lymph node enlargement in children frequently accompanied by fever, leukocytosis, elevated erythrocyte sedimentation rate, and polyclonal hypergammaglobulinemia. H syndrome is characterized by cutaneous hyperpigmentation and hypertrichosis, hepatosplenomegaly, heart anomalies, and hypogonadism; hearing loss is found in about half of patients. PHID is characterized by predominantly antibody-negative insulin-dependent diabetes mellitus associated with pigmented hypertrichosis and variable occurrence of other features of H syndrome. The disease is caused by variants affecting the gene represented in this entry.

Domain organisation. Contains a N-terminal dileucine motif (DE)XXXL(LI) important for endosomal/lysosomal and mitochondrial subcellular localization.

Miscellaneous. Transports nucleoside analog drugs such as cladribine, cordycepin, tubercidin and idovudine. Also involved in the uptake of diabetes treatment medicine metformin, neurotoxin 1-methyl-4-phenylpyridinium (MPP(+)), and ribavirin. Transport activity is insensitive to nanomolar concentrations of the inhibitors nitrobenzylmercaptopurine riboside, dipyridamole and dilazep, and inhibited by higher concentrations. Does not transport hypoxanthine. A truncated version of SLC29A3/hENT3 in which the N-terminal 36 amino acids are deleted, enables cell-surface localization of an otherwise intracellular transporter, and is utilized to investigate the transporter activity.

Similarity. Belongs to the SLC29A/ENT transporter (TC 2.A.57) family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9BZD2-1	1	yes
Q9BZD2-2	2

RefSeq proteins (3): NP_001167569, NP_001350447, NP_060814* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002259	Eqnu_transpt	Family

Pfam: PF01733

Catalyzed reactions (Rhea), 12 shown:

• uracil(in) = uracil(out) (RHEA:69404)
• uridine(out) = uridine(in) (RHEA:71519)
• guanine(out) = guanine(in) (RHEA:71531)
• dopamine(out) = dopamine(in) (RHEA:73863)
• serotonin(out) = serotonin(in) (RHEA:73867)
• (R)-noradrenaline(out) = (R)-noradrenaline(in) (RHEA:73871)
• tyramine(in) = tyramine(out) (RHEA:74783)
• adenosine(in) = adenosine(out) (RHEA:75343)
• thymidine(in) = thymidine(out) (RHEA:75363)
• cytidine(in) = cytidine(out) (RHEA:75367)
• guanosine(in) = guanosine(out) (RHEA:75371)
• inosine(in) = inosine(out) (RHEA:75375)

UniProt features (99 total): mutagenesis site 46, sequence variant 16, topological domain 11, transmembrane region 11, sequence conflict 5, site 2, modified residue 2, chain 1, region of interest 1, short sequence motif 1, compositionally biased region 1, glycosylation site 1, splice variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9BZD2-F1	82.40	0.59

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (2): 219 (important for acidic ph-dependent nucleoside transporter activity. acts as a ph sensor); 447 (important for acidic ph-dependent nucleoside transporter activity. acts as a ph sensor)

Post-translational modifications (2): 21, 23

Glycosylation sites (1): 84

Mutagenesis-validated functional residues (46):

Position	Phenotype
31	localization at the cell surface; when associated with a-32.
32	localization at the cell surface; when associated with a-31.
48	no change in adenosine transport.
54	no change in adenosine transport.
76	decreased adenosine transport at ph 5.5.
86	decreased adenosine transport at ph 5.5.
92	decreased adenosine transport at ph 5.5.
93	no change in adenosine transport.
95	partial loss of acidic ph-dependent activity resulting in moderate emergence of adenosine transport at ph 7.4. partial l
98	decreased adenosine transport at ph 5.5.
104	decreased adenosine transport at ph 5.5.
132	decreased adenosine transport at ph5.5.
132	no change in adenosine transport at ph5.5.
156	decreased adenosine transport at ph5.5.
160	decreased adenosine transport at ph 5.5.
180	decreased adenosine transport at ph 5.5.
184	no change in adenosine transport.
187	decreased adenosine transport at ph 5.5.
190	no change in adenosine transport.
219	decreased adenosine transport at ph 5.5. partial loss of acidic ph-dependent activity resulting in emergence of adenosin
225	decreased adenosine transport at ph5.5.
233	decreased adenosine transport at ph 5.5.
244	decreased adenosine transport at ph 5.5.
255	no change in adenosine transport.
268	decreased adenosine transport at ph 5.5.

Function

Pathways and Gene Ontology

Reactome pathways

10 pathways

ID	Pathway
R-HSA-5619063	Defective SLC29A3 causes histiocytosis-lymphadenopathy plus syndrome (HLAS)
R-HSA-83936	Transport of nucleosides and free purine and pyrimidine bases across the plasma membrane
R-HSA-9755088	Ribavirin ADME
R-HSA-1643685	Disease
R-HSA-382551	Transport of small molecules
R-HSA-425397	Transport of vitamins, nucleosides, and related molecules
R-HSA-425407	SLC-mediated transmembrane transport
R-HSA-5619102	SLC transporter disorders
R-HSA-5619115	Disorders of transmembrane transporters
R-HSA-9748784	Drug ADME

MSigDB gene sets: 467 (showing top): GSE45365_CTRL_VS_MCMV_INFECTION_NK_CELL_UP, GSE45365_NK_CELL_VS_CD8A_DC_UP, GOCC_VACUOLAR_MEMBRANE, GOBP_NEUROTRANSMITTER_TRANSPORT, GOBP_ORGANIC_HYDROXY_COMPOUND_TRANSPORT, RUTELLA_RESPONSE_TO_CSF2RB_AND_IL4_UP, DOANE_RESPONSE_TO_ANDROGEN_DN, GOMF_NUCLEOBASE_CONTAINING_COMPOUND_TRANSMEMBRANE_TRANSPORTER_ACTIVITY, GOBP_NUCLEOBASE_CONTAINING_COMPOUND_TRANSPORT, GOCC_MITOCHONDRIAL_ENVELOPE, ZHOU_INFLAMMATORY_RESPONSE_LIVE_DN, GOBP_PYRIMIDINE_CONTAINING_COMPOUND_TRANSMEMBRANE_TRANSPORT, GOBP_ORGANIC_CATION_TRANSPORT, GOBP_NUCLEOSIDE_TRANSPORT, ACEVEDO_LIVER_CANCER_UP

GO Biological Process (16): xenobiotic metabolic process (GO:0006805), obsolete serotonin transport (GO:0006837), nucleobase transport (GO:0015851), nucleoside transport (GO:0015858), cytidine transport (GO:0015861), uridine transmembrane transport (GO:0015862), obsolete dopamine transport (GO:0015872), obsolete norepinephrine transport (GO:0015874), adenosine transport (GO:0032238), inosine transport (GO:0035340), nucleoside transmembrane transport (GO:1901642), guanine transmembrane transport (GO:1903716), uracil transmembrane transport (GO:1903791), pyrimidine nucleobase transmembrane transport (GO:1904082), purine nucleobase transmembrane transport (GO:1904823), neurotransmitter transport (GO:0006836)

GO Molecular Function (11): neurotransmitter transmembrane transporter activity (GO:0005326), nucleoside transmembrane transporter activity (GO:0005337), monoamine transmembrane transporter activity (GO:0008504), obsolete organic cation transmembrane transporter activity (GO:0015101), nucleobase transmembrane transporter activity (GO:0015205), guanine transmembrane transporter activity (GO:0015208), uracil transmembrane transporter activity (GO:0015210), cytidine transmembrane transporter activity (GO:0015212), uridine transmembrane transporter activity (GO:0015213), protein binding (GO:0005515), transmembrane transporter activity (GO:0022857)

GO Cellular Component (10): mitochondrial outer membrane (GO:0005741), lysosomal membrane (GO:0005765), Golgi apparatus (GO:0005794), plasma membrane (GO:0005886), late endosome membrane (GO:0031902), mitochondrion (GO:0005739), lysosome (GO:0005764), endosome (GO:0005768), membrane (GO:0016020), mitochondrial membrane (GO:0031966)

Reactome top-level categories

Rollup of top-7 pathways:

Category	Pathways
SLC transporter disorders	1
Transport of vitamins, nucleosides, and related molecules	1
Drug ADME	1
SLC-mediated transmembrane transport	1
Transport of small molecules	1
Disorders of transmembrane transporters	1
Disease	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
nucleoside transport	3
pyrimidine nucleoside transport	2
pyrimidine-containing compound transmembrane transport	2
nucleoside transmembrane transport	2
transmembrane transport	2
transmembrane transporter activity	2
pyrimidine nucleoside transmembrane transporter activity	2
cytoplasm	2
endomembrane system	2
intracellular membrane-bounded organelle	2
metabolic process	1
cellular response to xenobiotic stimulus	1
nitrogen compound transport	1
nucleobase-containing compound transport	1
carbohydrate derivative transport	1
guanine transport	1
purine nucleobase transmembrane transport	1
uracil transport	1
pyrimidine nucleobase transmembrane transport	1
pyrimidine nucleobase transport	1
purine nucleobase transport	1
purine-containing compound transmembrane transport	1
transport	1
neurotransmitter transport	1
nucleobase-containing compound transmembrane transporter activity	1
carbohydrate derivative transmembrane transporter activity	1
active transmembrane transporter activity	1
nucleobase transport	1
purine nucleobase transmembrane transporter activity	1
guanine transmembrane transport	1
pyrimidine nucleobase transmembrane transporter activity	1
uracil transmembrane transport	1
cytidine transport	1
uridine transmembrane transport	1
binding	1
transporter activity	1
mitochondrial membrane	1
organelle outer membrane	1
lysosome	1
lytic vacuole membrane	1

Protein interactions and networks

STRING

848 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SLC29A3	SLC28A3	Q9HAS3	755
SLC29A3	SLC28A2	O43868	747
SLC29A3	SLC28A1	O00337	747
SLC29A3	CD63	P08962	668
SLC29A3	CLINT1	Q14677	549
SLC29A3	VTI1B	Q9UEU0	524
SLC29A3	OSTM1	Q86WC4	490
SLC29A3	SLC47A1	Q96FL8	486
SLC29A3	ADK	P55263	475
SLC29A3	SLC46A1	Q96NT5	465
SLC29A3	SLC15A1	P46059	464
SLC29A3	SLC67A2	Q8NBP5	461
SLC29A3	HGS	O14964	461
SLC29A3	TCIRG1	Q13488	459
SLC29A3	SLC22A16	Q86VW1	456

IntAct

6 interactions, top by confidence:

A	B	Type	Score
SLC29A3	CREB3	psi-mi:“MI:0915”(physical association)	0.560
GNPTAB	SLC29A3	psi-mi:“MI:0915”(physical association)	0.400
	DENND11	psi-mi:“MI:0914”(association)	0.350

BioGRID (10): CREB3 (Two-hybrid), SLC29A3 (Affinity Capture-MS), SLC29A3 (Affinity Capture-RNA), SLC29A3 (Co-fractionation), SLC29A3 (Co-fractionation), SLC29A3 (Co-fractionation), TMEM150C (Co-fractionation), USP39 (Co-fractionation), GNPTAB (Affinity Capture-MS), SLC29A3 (Affinity Capture-RNA)

ESM2 similar proteins: A0A0R4ILB2, A0A8M9Q308, A1A4N1, A2CER7, A5D7V7, A8WGF7, B0S5Y3, B2RXV4, B5X4H8, O00400, O00476, O01735, O23596, P30638, P36836, P46029, P60815, Q11073, Q16348, Q28722, Q28FF3, Q503P5, Q5F4B8, Q5RBM3, Q5XGK0, Q63424, Q6AYY8, Q6DDL7, Q6DIT7, Q6GMG6, Q6PB15, Q7Z3Q1, Q84XI3, Q86WB7, Q91X85, Q944P0, Q99808, Q99J27, Q9BZD2, Q9C8X2

Diamond homologs: A1A4N1, O54698, O54699, Q14542, Q61672, Q80WK7, Q99808, Q99P65, Q9BZD2, Q9JIM1, Q9NBV4

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

518 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	32
Likely pathogenic	6
Uncertain significance	230
Likely benign	178
Benign	27

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1069036	NM_018344.6(SLC29A3):c.269_275del (p.Thr90fs)	Pathogenic
1071023	NC_000010.10:g.(?73079047)(73079087_?)del	Pathogenic
130339	NM_018344.6(SLC29A3):c.300+1G>A	Pathogenic
1354691	NM_018344.6(SLC29A3):c.963del (p.Ile322fs)	Pathogenic
1366169	NM_018344.6(SLC29A3):c.101_104dup (p.Leu36fs)	Pathogenic
1390366	NM_018344.6(SLC29A3):c.443del (p.Val148fs)	Pathogenic
1451137	NM_018344.6(SLC29A3):c.300+2T>C	Pathogenic
1993275	NM_018344.6(SLC29A3):c.1294del (p.Leu432fs)	Pathogenic
1993276	NM_018344.6(SLC29A3):c.1295del (p.Leu432fs)	Pathogenic
2426462	NC_000010.10:g.(?73115818)(73116020_?)del	Pathogenic
2426463	NC_000010.10:g.(?73121691)(73122365_?)del	Pathogenic
2426464	NC_000010.10:g.(?73111299)(73122365_?)del	Pathogenic
2721497	NM_018344.6(SLC29A3):c.1077_1084del (p.Asp359fs)	Pathogenic
2750513	NM_018344.6(SLC29A3):c.919dup (p.Ser307fs)	Pathogenic
2760413	NM_018344.6(SLC29A3):c.67_70del (p.Leu24fs)	Pathogenic
2783465	NM_018344.6(SLC29A3):c.59_60dup (p.Ser21fs)	Pathogenic
2788367	NM_018344.6(SLC29A3):c.777C>A (p.Tyr259Ter)	Pathogenic
30948	NM_018344.6(SLC29A3):c.1088G>A (p.Arg363Gln)	Pathogenic
3244862	NC_000010.10:g.(?73103946)(73104068_?)del	Pathogenic
3727523	NM_018344.6(SLC29A3):c.273_277dup (p.Asp93fs)	Pathogenic
3903174	NM_018344.6(SLC29A3):c.610+1G>C	Pathogenic
427021	NM_018344.6(SLC29A3):c.300+1G>C	Pathogenic
4797550	NM_018344.6(SLC29A3):c.201dup (p.Trp68fs)	Pathogenic
563	NM_018344.6(SLC29A3):c.1279G>A (p.Gly427Ser)	Pathogenic
565	NM_018344.6(SLC29A3):c.1309G>A (p.Gly437Arg)	Pathogenic
566	NM_018344.6(SLC29A3):c.1045del (p.Leu349fs)	Pathogenic
567	NM_018344.6(SLC29A3):c.940del (p.Tyr314fs)	Pathogenic
569	NM_018344.6(SLC29A3):c.1346C>G (p.Thr449Arg)	Pathogenic
636986	NM_018344.6(SLC29A3):c.243del (p.Lys81fs)	Pathogenic
664261	NM_018344.6(SLC29A3):c.984del (p.Asn329fs)	Pathogenic

SpliceAI

1175 predictions. Top by Δscore:

Variant	Effect	Δscore
10:71319307:GACA:G	donor_gain	1.0000
10:71319311:G:GG	donor_gain	1.0000
10:71322745:T:A	acceptor_gain	1.0000
10:71322751:A:AG	acceptor_gain	1.0000
10:71322753:TA:T	acceptor_loss	1.0000
10:71322754:A:AG	acceptor_gain	1.0000
10:71322754:AGT:A	acceptor_gain	1.0000
10:71322754:AGTG:A	acceptor_gain	1.0000
10:71322755:G:GT	acceptor_gain	1.0000
10:71322755:GT:G	acceptor_gain	1.0000
10:71322755:GTG:G	acceptor_gain	1.0000
10:71322755:GTGG:G	acceptor_gain	1.0000
10:71322755:GTGGC:G	acceptor_gain	1.0000
10:71356076:TGCAG:T	acceptor_loss	1.0000
10:71356077:GCA:G	acceptor_loss	1.0000
10:71356078:CA:C	acceptor_loss	1.0000
10:71356079:A:AG	acceptor_gain	1.0000
10:71356079:A:T	acceptor_loss	1.0000
10:71356080:G:GC	acceptor_gain	1.0000
10:71319308:ACA:A	donor_gain	0.9900
10:71319309:CA:C	donor_gain	0.9900
10:71319311:G:T	donor_loss	0.9900
10:71319312:T:G	donor_loss	0.9900
10:71319315:G:GG	donor_gain	0.9900
10:71322752:A:G	acceptor_gain	0.9900
10:71322752:ATAGT:A	acceptor_gain	0.9900
10:71322979:G:GT	donor_gain	0.9900
10:71323051:CCTGG:C	donor_loss	0.9900
10:71323052:CTGG:C	donor_loss	0.9900
10:71323053:TGGTA:T	donor_loss	0.9900

AlphaMissense

3068 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
10:71362453:A:C	S425R	0.996
10:71362455:C:A	S425R	0.996
10:71362455:C:G	S425R	0.996
10:71351731:A:C	S185R	0.993
10:71351733:C:A	S185R	0.993
10:71351733:C:G	S185R	0.993
10:71362268:G:C	R363P	0.993
10:71351728:A:C	S184R	0.990
10:71351730:C:A	S184R	0.990
10:71351730:C:G	S184R	0.990
10:71362447:G:A	G423R	0.989
10:71362447:G:C	G423R	0.989
10:71362448:G:A	G423E	0.989
10:71362460:G:A	G427D	0.987
10:71362447:G:T	G423W	0.985
10:71362265:G:A	G362D	0.984
10:71356104:A:C	S212R	0.983
10:71356106:C:A	S212R	0.983
10:71356106:C:G	S212R	0.983
10:71322935:G:C	G61R	0.980
10:71362462:T:G	Y428D	0.980
10:71362571:G:A	G464D	0.980
10:71356081:G:A	G204E	0.978
10:71362570:G:C	G464R	0.978
10:71362337:G:C	R386P	0.977
10:71362459:G:C	G427R	0.976
10:71362558:G:C	G460R	0.976
10:71362559:G:A	G460D	0.973
10:71322936:G:A	G61D	0.972
10:71351756:T:C	F193S	0.972

dbSNP variants (sampled 300 via entrez): RS1000066746 (10:71369242 A>G), RS1000099934 (10:71318707 G>A), RS1000157747 (10:71319282 GGCAGCGGCGGCGTGGC>G,GGCAGCGGCGGCGTGGCGCAGCGGCGGCGTGGC), RS1000158396 (10:71347674 T>C), RS1000182236 (10:71339459 C>G), RS1000294711 (10:71352373 C>T), RS1000300201 (10:71334048 C>G), RS1000403725 (10:71324583 C>A), RS1000411397 (10:71344794 C>T), RS1000444300 (10:71346134 A>G), RS1000494217 (10:71357347 G>A), RS1000509303 (10:71373827 C>T), RS1000519380 (10:71340711 T>C), RS1000530816 (10:71340946 T>A), RS1000616776 (10:71380146 C>T)

Disease associations

OMIM: gene MIM:612373 | disease phenotypes: MIM:602782

GenCC curated gene-disease

Disease	Classification	Inheritance
H syndrome	Strong	Autosomal recessive
dysosteosclerosis	Supportive	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
H syndrome	Definitive	AR

Mondo (3): H syndrome (MONDO:0011273), acanthosis nigricans (MONDO:0007035), dysosteosclerosis (MONDO:0009138)

Orphanet (2): H syndrome (Orphanet:168569), NON RARE IN EUROPE: Acanthosis nigricans (Orphanet:924)

HPO phenotypes

102 total (30 of 102 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000027	Azoospermia
HP:0000054	Micropenis
HP:0000077	Abnormality of the kidney
HP:0000105	Enlarged kidney
HP:0000135	Hypogonadism
HP:0000141	Amenorrhea
HP:0000204	Cleft upper lip
HP:0000212	Gingival overgrowth
HP:0000238	Hydrocephalus
HP:0000256	Macrocephaly
HP:0000278	Retrognathia
HP:0000293	Full cheeks
HP:0000316	Hypertelorism
HP:0000365	Hearing impairment
HP:0000407	Sensorineural hearing impairment
HP:0000463	Anteverted nares
HP:0000494	Downslanted palpebral fissures
HP:0000520	Proptosis
HP:0000534	Abnormal eyebrow morphology
HP:0000639	Nystagmus
HP:0000648	Optic atrophy
HP:0000682	Abnormal dental enamel morphology
HP:0000684	Delayed eruption of teeth
HP:0000771	Gynecomastia
HP:0000815	Hypergonadotropic hypogonadism
HP:0000819	Diabetes mellitus
HP:0000823	Delayed puberty
HP:0000824	Decreased response to growth hormone stimulation test
HP:0000926	Platyspondyly

GWAS associations

9 associations (top):

Study	Trait	p-value
GCST001670_3	Vitiligo	2.000000e-08
GCST001762_646	Obesity-related traits	2.000000e-06
GCST001762_740	Obesity-related traits	8.000000e-07
GCST001795_12	Systemic lupus erythematosus	3.000000e-06
GCST002875_50	Diisocyanate-induced asthma	7.000000e-06
GCST006914_2	Sleep duration	6.000000e-09
GCST009144_2	Disease progression in age-related macular degeneration (adjusted for baseline)	9.000000e-06
GCST90002388_563	Lymphocyte count	5.000000e-21
GCST90002407_98	White blood cell count	4.000000e-12

EFO canonical traits (4, from GWAS)

EFO ID	Trait name
EFO:0004501	HOMA-IR
EFO:0006995	response to diisocyanate
EFO:0008336	disease progression measurement
EFO:0004587	lymphocyte count

MeSH disease descriptors (4)

Descriptor	Name	Tree numbers
D000052	Acanthosis Nigricans	C17.800.621.430.530.100
C535391	Asrar Facharzt Haque syndrome (supp.)
C562973	Dysosteosclerosis (supp.)
C538322	Histiocytosis with joint contractures and sensorineural deafness (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL6066081 (PROTEIN FAMILY)

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB clinical annotations

1 annotations.

Variant	Type	Level	Drugs	Phenotypes
rs780668	Efficacy	4	gemcitabine	Non-Small Cell Lung Carcinoma

PharmGKB variants

1 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs780668	SLC29A3	4	-0.25	1	gemcitabine

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: transporter — SLC29 family

CTD chemical–gene interactions

43 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	increases expression, increases abundance	3
Estradiol	affects cotreatment, decreases expression, increases expression	3
bisphenol A	affects expression, affects cotreatment, increases expression	2
Air Pollutants	decreases expression, increases abundance	2
Tretinoin	increases expression	2
Zidovudine	affects transport, increases expression	2
Cyclosporine	decreases expression	2
Aflatoxin B1	increases methylation	2
afuresertib	increases expression	1
bisphenol F	affects cotreatment, increases expression	1
pirinixic acid	affects binding, increases activity, increases expression	1
benzo(e)pyrene	increases methylation	1
ferrous chloride	decreases expression	1
aflatoxin B2	increases methylation	1
fialuridine	affects transport	1
di-n-butylphosphoric acid	affects expression	1
perfluorooctane sulfonic acid	increases expression	1
CGP 52608	affects binding, increases reaction	1
abrine	decreases expression	1
bisphenol S	affects cotreatment, increases expression	1
jinfukang	affects cotreatment, increases expression	1
Sunitinib	decreases expression	1
Acetaminophen	affects response to substance	1
Gemcitabine	affects transport	1
Adenosine	affects transport	1
Arsenic	increases abundance, increases expression	1
Cadmium	decreases expression, increases abundance	1
Cisplatin	affects cotreatment, increases expression	1
Dexamethasone	increases expression, affects cotreatment	1
Guanosine	affects transport	1

ChEMBL screening assays

2 unique, capped per target: 2 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4885543	Binding	Inhibition of Transporter, Adenosine at compound concentration of 10.0 uM in the Eurofins-Panlabs radioligand binding assay (Eurofins_assay_202020)	Profiling data from Eurofins-Panlabs

Cellosaurus cell lines

5 cell lines: 5 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_D4SW	HuH7-SLC29A3-KO-c12	Cancer cell line	Male
CVCL_D4SX	HuH7-SLC29A3-KO-c13	Cancer cell line	Male
CVCL_E0NR	Ubigene HeLa SLC29A3 KO	Cancer cell line	Female
CVCL_TM76	HAP1 SLC29A3 (-) 1	Cancer cell line	Male
CVCL_TM77	HAP1 SLC29A3 (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

15 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT02438020	PHASE4	UNKNOWN	Study of Efficacy of Metformin in the Treatment of Acanthosis Nigricans in Children With Obesity
NCT06213987	PHASE3	COMPLETED	The Efficacy Tretinoin Cream in the Treatment of Axillary Hyperpigmentation Associated With Acanthosis Nigricans
NCT00004311	PHASE2	COMPLETED	Phase II Study of the Effect of Leuprolide Acetate and Spironolactone on Insulin Resistance in Hyperandrogenic Women With Polycystic Ovarian Disease or Hyperandrogenism Insulin Resistance Acanthosis Nigricans Syndrome
NCT06940895	PHASE2	COMPLETED	Evaluating the Safety and Efficacy of Topical Sirolimus 0.2% to Treat Acanthosis Nigricans
NCT06742073	Not specified	RECRUITING	Histiocytosis and Inflammatory Manifestations in Patients with H Syndrome
NCT00000112	Not specified	UNKNOWN	Prevalence of Carbohydrate Intolerance in Lean and Obese Children
NCT01125150	Not specified	COMPLETED	Spectroscopic and Colorimetric Analysis of Acanthosis Nigricans in Patients With Hyperinsulinemia
NCT01881373	Not specified	COMPLETED	Children’s Healthy Living Community Randomized Trial
NCT02604095	Not specified	COMPLETED	Effect of Melatonin on Body Composition, Glucose Metabolism and Lipid Metabolism
NCT04893304	Not specified	UNKNOWN	Study of the Effect of Fractional co2 Laser Versus Q Switched:NdYAG Laser in the Treatment of Acanthosis Nigricans
NCT05457439	Not specified	UNKNOWN	Sustainable-psycho-nutritional Intervention Program and Its Effects on Health Outcomes and the Environment
NCT05529563	Not specified	UNKNOWN	The Effect of Laparoscopic Sleeve Gastrectomy on Insulin Secretion Pattern in Morbidly Obese Patients With Acanthosis Nigricans
NCT06008327	Not specified	COMPLETED	Comparison Of Outcome Of Treatment OF Topical 15%TCA VS Topical 0.05% Tretinoin In Treatment Of Acanthosis Nigricans
NCT06331819	Not specified	RECRUITING	Clinical Association Between Obstructive Sleep Apnea, Facial Pigmentation, and Vasovagal Symptoms.
NCT07371169	Not specified	COMPLETED	Efficacy of Chromium Picolinate in Reducing Acanthosis Nigricans Severity in Adolescents With Insulin Resistance