SLC30A4

Summary

SLC30A4 (solute carrier family 30 member 4, HGNC:11015) is a protein-coding gene on chromosome 15q21.1, encoding Probable proton-coupled zinc antiporter SLC30A4 (O14863). Probable proton-coupled zinc ion antiporter mediating zinc import from cytoplasm potentially into the endocytic compartment.

Zinc is the second most abundant trace metal in the human body. It is an essential element, serving both a structural role, as in the formation of zinc fingers in DNA-binding proteins, and a catalytic role in metalloenzymes, such as pancreatic carboxypeptidases (e.g., MIM 114852), alkaline phosphatases (e.g., MIM 171760), various dehydrogenases, and superoxide dismutases (e.g., MIM 147450). SLC30A4, or ZNT4, belongs to the ZNT family of zinc transporters. ZNTs are involved in transporting zinc out of the cytoplasm and have similar structures, consisting of 6 transmembrane domains and a histidine-rich cytoplasmic loop (Huang and Gitschier, 1997 [PubMed 9354792]).

Source: NCBI Gene 7782 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 50 total
• MANE Select transcript: NM_013309

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:11015
Approved symbol	SLC30A4
Name	solute carrier family 30 member 4
Location	15q21.1
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000104154
Ensembl biotype	protein_coding
OMIM	602095
Entrez	7782

Gene structure

Transcript identifiers

Ensembl transcripts: 5 — 4 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000261867, ENST00000559667, ENST00000854653, ENST00000854654, ENST00000854655

RefSeq mRNA: 1 — MANE Select: NM_013309 NM_013309

CCDS: CCDS10125

Canonical transcript exons

ENST00000261867 — 8 exons

Exon	Start	End
ENSE00001107783	45488841	45489042
ENSE00001107785	45490728	45490881
ENSE00001107791	45486611	45486745
ENSE00001297393	45479606	45485317
ENSE00001321505	45487527	45487632
ENSE00001329353	45521964	45522468
ENSE00001358366	45522607	45522755
ENSE00003686492	45511138	45511284

Expression profiles

Bgee: expression breadth ubiquitous, 253 present calls, max score 94.25.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 3.9858 / max 70.5861, expressed in 1342 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
149724	2.5688	1164
149725	0.8732	582
149721	0.2889	117
149723	0.1681	57
149722	0.0868	36

Top tissues by expression

281 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
jejunal mucosa	UBERON:0000399	94.25	gold quality
Brodmann (1909) area 23	UBERON:0013554	92.58	gold quality
middle temporal gyrus	UBERON:0002771	92.40	gold quality
oocyte	CL:0000023	91.73	gold quality
secondary oocyte	CL:0000655	91.73	gold quality
germinal epithelium of ovary	UBERON:0001304	91.57	gold quality
endothelial cell	CL:0000115	90.97	gold quality
lateral globus pallidus	UBERON:0002476	86.56	gold quality
synovial joint	UBERON:0002217	86.20	gold quality
gingival epithelium	UBERON:0001949	86.06	gold quality
gingiva	UBERON:0001828	85.71	gold quality
decidua	UBERON:0002450	85.42	gold quality
trigeminal ganglion	UBERON:0001675	85.24	gold quality
postcentral gyrus	UBERON:0002581	85.09	gold quality
jejunum	UBERON:0002115	85.03	gold quality
prostate gland	UBERON:0002367	84.87	gold quality
parietal lobe	UBERON:0001872	84.79	gold quality
cauda epididymis	UBERON:0004360	84.75	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	84.54	gold quality
entorhinal cortex	UBERON:0002728	84.52	gold quality
esophagus squamous epithelium	UBERON:0006920	84.52	gold quality
duodenum	UBERON:0002114	84.15	gold quality
lateral nuclear group of thalamus	UBERON:0002736	83.93	gold quality
penis	UBERON:0000989	83.82	gold quality
superior frontal gyrus	UBERON:0002661	83.62	gold quality
corpus epididymis	UBERON:0004359	83.30	gold quality
primary visual cortex	UBERON:0002436	83.21	gold quality
parietal pleura	UBERON:0002400	83.02	gold quality
occipital lobe	UBERON:0002021	82.47	gold quality
subthalamic nucleus	UBERON:0001906	82.26	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	5.59

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

41 targeting SLC30A4, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4533	100.00	69.48	2758
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-6778-3P	99.96	67.29	2693
HSA-MIR-383-3P	99.85	65.84	1359
HSA-MIR-6134	99.63	65.68	1537
HSA-MIR-4437	99.52	65.29	1266
HSA-MIR-330-3P	99.41	69.95	2521
HSA-MIR-196A-3P	99.19	67.34	1204
HSA-MIR-422A	99.18	65.83	550
HSA-MIR-3164	99.02	68.39	1071
HSA-MIR-6820-3P	99.02	68.50	1035
HSA-MIR-939-3P	98.97	65.07	2347
HSA-MIR-887-5P	98.82	65.90	1347
HSA-MIR-4686	98.77	66.87	964
HSA-MIR-7113-3P	98.75	65.71	1120
HSA-MIR-378A-3P	98.43	66.10	548
HSA-MIR-378B	98.43	65.36	573
HSA-MIR-378C	98.43	66.10	548
HSA-MIR-378D	98.43	66.10	548
HSA-MIR-378E	98.43	65.99	551
HSA-MIR-378F	98.43	65.66	554
HSA-MIR-378H	98.43	66.16	545
HSA-MIR-378I	98.43	66.10	548
HSA-MIR-5589-5P	98.34	64.82	1148
HSA-MIR-660-3P	98.14	66.04	1434
HSA-MIR-6867-3P	98.12	66.07	1305
HSA-MIR-4469	97.93	65.81	1319
HSA-MIR-30C-1-3P	97.80	66.36	1499
HSA-MIR-30C-2-3P	97.80	66.45	1499

Literature-anchored findings (GeneRIF, showing 15)

• Genomic localization, organization; exclusion in variants of acrodermatitis enteropathica. (PMID:11686514)
• not responsible for acrodermatitis enteropathica in Japanese families (PMID:11935329)
• hZnT4 is constitutively expressed in the human breast and may be one of the several members of the ZnT family involved in the transport of zinc into milk (PMID:11988082)
• The hZnT4 protein did not co-localise with intracellular free zinc pools, suggesting that hZnT4 is not involved in transport of zinc into vesicles destined for secretion into milk. (PMID:12743795)
• decreased intensity of ZnT4 immunoreactivity occurred in the progression from benign to invasive localized prostate cancer and to metastatic disease (PMID:12955079)
• Decreased hZnT-4 expression is associated with prostate tissue abnormalities independent of total cellular zinc content. (PMID:14968438)
• findings implicate a role for ZnT(4) in mast cell Zn homeostasis and suggest that granule pools of Zn may be distinct from those regulating activation of procaspase-3 and NF-kappaB. (PMID:15187159)
• Our results show that Zn transporter-4 and Zn transporter-6 are significantly (P<0.05) increased in hippocampus/parahippocampal gyrus of early Alzheimer’s disease and Alzheimer’s disease subjects. (PMID:16580781)
• hZnT-4 is found in the plasma membrane. It is most highly expressed in Molt-4 cells, up-regulated after treatment with phytohemagglutinin & is responsible for the measured decrease of intracellular zinc content after high zinc exposure. (PMID:17971500)
• Data show that ZNT4 is extensively present in the Abeta-positive plaques in the cortex of human AD brains. (PMID:18639746)
• our results suggest that alterations in Zn transport proteins ZnT-1, ZnT-4 and ZnT-6 may contribute to the pathology observed in preclinical Alzheimer’s disease subjects before onset of clinical symptoms (PMID:19371353)
• The loss of ZnT4 in airway inflammation contributes to airway epithelium vulnerability in diseases such as asthma. (PMID:22254085)
• TRPML1 works in concert with ZnT4 to regulate zinc translocation between the cytoplasm and lysosomes. (PMID:23368743)
• There was a significant increase in protein levels of ZnT4 in the prefrontal cortex in Major depression disorder, relative to control subjects. (PMID:27661418)
• The Roles of ZnT1 and ZnT4 in Glucose-Stimulated Zinc Secretion in Prostate Epithelial Cells. (PMID:33140261)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	slc30a4	ENSDARG00000007180
mus_musculus	Slc30a4	ENSMUSG00000005802
rattus_norvegicus	Slc30a4	ENSRNOG00000000170
drosophila_melanogaster	ZnT41F	FBGN0025693
caenorhabditis_elegans		WBGENE00012712

Paralogs (8): SLC30A3 (ENSG00000115194), SLC30A5 (ENSG00000145740), SLC30A6 (ENSG00000152683), SLC30A2 (ENSG00000158014), SLC30A7 (ENSG00000162695), SLC30A8 (ENSG00000164756), SLC30A1 (ENSG00000170385), SLC30A10 (ENSG00000196660)

Protein

Protein identifiers

Probable proton-coupled zinc antiporter SLC30A4 — O14863 (reviewed: O14863)

Alternative names: Solute carrier family 30 member 4, Zinc transporter 4

All UniProt accessions (1): O14863

UniProt curated annotations — full annotation on UniProt →

Function. Probable proton-coupled zinc ion antiporter mediating zinc import from cytoplasm potentially into the endocytic compartment. Controls zinc deposition in milk.

Subunit / interactions. Homodimer; dityrosine-linked. Homodimerization could be specific of the human protein and enhances the zinc transport efficiency. Interacts with TMEM163.

Subcellular location. Endosome membrane. Late endosome membrane. Lysosome membrane.

Post-translational modifications. Homodimerization through dityrosine bonds is stimulated by oxidative stress.

Similarity. Belongs to the cation diffusion facilitator (CDF) transporter (TC 2.A.4) family. SLC30A subfamily.

RefSeq proteins (1): NP_037441* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002524	Cation_efflux	Family
IPR027469	Cation_efflux_TMD_sf	Homologous_superfamily
IPR027470	Cation_efflux_CTD	Domain
IPR036837	Cation_efflux_CTD_sf	Homologous_superfamily
IPR050681	CDF/SLC30A	Family
IPR058533	Cation_efflux_TM	Domain

Pfam: PF01545, PF16916

Catalyzed reactions (Rhea), 1 shown:

• Zn(2+)(in) + 2 H(+)(out) = Zn(2+)(out) + 2 H(+)(in) (RHEA:72627)

UniProt features (23 total): topological domain 7, transmembrane region 6, binding site 4, mutagenesis site 3, chain 1, region of interest 1, sequence conflict 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
9JJ3	ELECTRON MICROSCOPY	3.03

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O14863-F1	73.13	0.40

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (4): 146; 150; 277; 281

Mutagenesis-validated functional residues (3):

Position	Phenotype
355	decreased homodimerization.
404	decreased homodimerization.
413	decreased homodimerization.

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 291 (showing top): GSE45365_NK_CELL_VS_BCELL_UP, WAMUNYOKOLI_OVARIAN_CANCER_LMP_DN, BENPORATH_ES_WITH_H3K27ME3, GOBP_RESPONSE_TO_ZINC_ION, GOBP_LYSOSOMAL_TRANSPORT, GOCC_VACUOLAR_MEMBRANE, GOBP_TRANSITION_METAL_ION_TRANSPORT, ATACCTC_MIR202, GOBP_VACUOLAR_TRANSPORT, BROWNE_HCMV_INFECTION_16HR_UP, CHANDRAN_METASTASIS_DN, GOBP_MONOATOMIC_CATION_TRANSPORT, GOBP_RESPONSE_TO_METAL_ION, RICKMAN_TUMOR_DIFFERENTIATED_WELL_VS_POORLY_DN, FOSTER_TOLERANT_MACROPHAGE_UP

GO Biological Process (10): response to toxic substance (GO:0009636), response to zinc ion (GO:0010043), zinc ion transmembrane transport (GO:0071577), zinc export across plasma membrane (GO:0140882), zinc ion import into lysosome (GO:0140916), monoatomic ion transport (GO:0006811), monoatomic cation transport (GO:0006812), zinc ion transport (GO:0006829), transmembrane transport (GO:0055085), zinc ion import into organelle (GO:0062111)

GO Molecular Function (5): zinc ion transmembrane transporter activity (GO:0005385), antiporter activity (GO:0015297), metal ion binding (GO:0046872), protein binding (GO:0005515), monoatomic cation transmembrane transporter activity (GO:0008324)

GO Cellular Component (10): cytoplasm (GO:0005737), lysosomal membrane (GO:0005765), late endosome (GO:0005770), plasma membrane (GO:0005886), endosome membrane (GO:0010008), late endosome membrane (GO:0031902), lysosome (GO:0005764), endosome (GO:0005768), membrane (GO:0016020), cytoplasmic vesicle (GO:0031410)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
zinc ion transmembrane transport	3
monoatomic cation transmembrane transport	2
transport	2
cellular anatomical structure	2
endosome	2
response to chemical	1
response to metal ion	1
zinc ion transport	1
export across plasma membrane	1
lysosomal transport	1
intercellular transport	1
vacuolar transmembrane transport	1
zinc ion import into organelle	1
monoatomic ion transport	1
transition metal ion transport	1
cellular process	1
transition metal ion transmembrane transporter activity	1
secondary active transmembrane transporter activity	1
cation binding	1
binding	1
monoatomic ion transmembrane transporter activity	1
intracellular anatomical structure	1
lysosome	1
lytic vacuole membrane	1
membrane	1
cell periphery	1
cytoplasmic vesicle membrane	1
bounding membrane of organelle	1
late endosome	1
endosome membrane	1
lytic vacuole	1
endomembrane system	1
cytoplasmic vesicle	1
cytoplasm	1
intracellular vesicle	1

Protein interactions and networks

STRING

692 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SLC30A4	SLC39A4	Q6P5W5	957
SLC30A4	SLC30A6	Q6NXT4	888
SLC30A4	SLC39A1	Q9NY26	867
SLC30A4	SLC30A9	Q6PML9	817
SLC30A4	SLC28A2	O43868	789
SLC30A4	GATM	P50440	774
SLC30A4	SLC39A13	Q96H72	759
SLC30A4	SLC39A7	Q92504	749
SLC30A4	SLC39A6	Q13433	747
SLC30A4	SLC39A10	Q9ULF5	747
SLC30A4	ATP7B	P35670	736
SLC30A4	DUOX1	Q9NRD9	733
SLC30A4	SLC39A14	Q15043	732
SLC30A4	SLC39A9	Q9NUM3	728
SLC30A4	SLC39A11	Q8N1S5	724

IntAct

74 interactions, top by confidence:

A	B	Type	Score
SLC30A3	SLC30A4	psi-mi:“MI:0403”(colocalization)	0.700
SLC30A3	SLC30A4	psi-mi:“MI:0915”(physical association)	0.700
SLC30A4	SLC30A3	psi-mi:“MI:0915”(physical association)	0.700
SLC30A4	Tfrc	psi-mi:“MI:0914”(association)	0.610
Tfrc	SLC30A4	psi-mi:“MI:0914”(association)	0.610
Tfrc	SLC30A4	psi-mi:“MI:0915”(physical association)	0.610
SLC30A4	TMEM100	psi-mi:“MI:0915”(physical association)	0.560
SLC30A4	YIPF6	psi-mi:“MI:0915”(physical association)	0.560
SLC30A4	NSG1	psi-mi:“MI:0915”(physical association)	0.560
SLC30A4	IER3IP1	psi-mi:“MI:0915”(physical association)	0.560
SLC30A4	SERP2	psi-mi:“MI:0915”(physical association)	0.560
PEDS1-UBE2V1	SLC30A4	psi-mi:“MI:0915”(physical association)	0.560
SLC30A4	LEPROTL1	psi-mi:“MI:0915”(physical association)	0.560
SLC30A4	CMTM5	psi-mi:“MI:0915”(physical association)	0.560
SLC30A4	TNF	psi-mi:“MI:0915”(physical association)	0.560
SLC30A4	CLN6	psi-mi:“MI:0915”(physical association)	0.560
SLC30A4	TMEM60	psi-mi:“MI:0915”(physical association)	0.560
SLC30A4	FZD7	psi-mi:“MI:0915”(physical association)	0.560
TNFRSF10C	SLC30A4	psi-mi:“MI:0915”(physical association)	0.560
SLC30A4	BTN2A2	psi-mi:“MI:0915”(physical association)	0.560
SLC30A4	GOSR2	psi-mi:“MI:0914”(association)	0.530
SLC30A4	OPA1	psi-mi:“MI:0914”(association)	0.530
SLC30A4	SLC30A10	psi-mi:“MI:0914”(association)	0.500
SLC30A4	SLC30A10	psi-mi:“MI:0915”(physical association)	0.500
TMEM163	SLC30A4	psi-mi:“MI:0915”(physical association)	0.460

BioGRID (289): CIAO1 (Affinity Capture-MS), YES1 (Affinity Capture-MS), BLK (Affinity Capture-MS), NCAM1 (Affinity Capture-MS), COLEC12 (Affinity Capture-MS), EIF5 (Affinity Capture-MS), GNAO1 (Affinity Capture-MS), RBM25 (Affinity Capture-MS), RAP2A (Affinity Capture-MS), PDS5B (Affinity Capture-MS), PDS5A (Affinity Capture-MS), NAPA (Affinity Capture-MS), NOP9 (Affinity Capture-MS), PRPF40A (Affinity Capture-MS), KIAA1524 (Affinity Capture-MS)

ESM2 similar proteins: A0A0G2KQY6, A0A3Q7ZPG5, A4IFD7, A4IIC5, A5PMX1, A8WMY3, O13918, O14863, O35149, O45923, O55174, O59758, O80632, P0CE46, P20107, P32798, P40544, P97441, Q28CE7, Q2HJ10, Q3KR82, Q52KD7, Q5BJM8, Q5I020, Q5MNV6, Q5NA18, Q5XHB4, Q5ZIU9, Q62941, Q6DBM8, Q6DG36, Q6NRI1, Q6NTL1, Q6P3N9, Q6QIX3, Q8BFU1, Q8BGG0, Q8H329, Q8IWU4, Q8LE59

Diamond homologs: O14863, O35149, O45923, O55174, P0CE46, P13512, P30540, P75757, P94178, P97441, Q08E25, Q2HJ10, Q54QU8, Q54T06, Q5I020, Q5R617, Q5XHB4, Q62941, Q6DBM8, Q6P0D1, Q6QIX3, Q83SA2, Q8BGG0, Q8IWU4, Q8X400, Q99726, Q9BRI3, Q9LXS1, Q9M271, Q9TTF3, Q9ZT63, A7Z1S6, O07084, Q66D85, Q688R1, Q6D7E5, Q8Z8B6, Q8ZGY6, Q8ZQT3, S7V0D3

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

50 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	41
Likely benign	3
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1473 predictions. Top by Δscore:

Variant	Effect	Δscore
15:45486609:A:AC	donor_gain	1.0000
15:45486610:C:CC	donor_gain	1.0000
15:45486610:CTTAG:C	donor_gain	1.0000
15:45486613:A:AC	donor_gain	1.0000
15:45486614:G:C	donor_gain	1.0000
15:45488836:ATTAC:A	donor_loss	1.0000
15:45488837:TTACC:T	donor_loss	1.0000
15:45488838:TACCT:T	donor_loss	1.0000
15:45488839:ACCT:A	donor_loss	1.0000
15:45489038:CCATT:C	acceptor_gain	1.0000
15:45489039:CATT:C	acceptor_gain	1.0000
15:45489039:CATTC:C	acceptor_gain	1.0000
15:45489041:TT:T	acceptor_gain	1.0000
15:45489043:C:CC	acceptor_gain	1.0000
15:45490726:A:AC	donor_gain	1.0000
15:45490727:C:CC	donor_gain	1.0000
15:45490727:CATT:C	donor_gain	1.0000
15:45490727:CATTA:C	donor_gain	1.0000
15:45490737:A:C	donor_gain	1.0000
15:45490877:AACCT:A	acceptor_gain	1.0000
15:45490878:ACCT:A	acceptor_gain	1.0000
15:45490878:ACCTC:A	acceptor_gain	1.0000
15:45490879:CCTC:C	acceptor_gain	1.0000
15:45490879:CCTCT:C	acceptor_gain	1.0000
15:45490880:CT:C	acceptor_gain	1.0000
15:45490882:C:CC	acceptor_gain	1.0000
15:45508919:A:C	donor_gain	1.0000
15:45511134:CTA:C	donor_loss	1.0000
15:45511135:TA:T	donor_loss	1.0000
15:45511136:A:AG	donor_loss	1.0000

AlphaMissense

2808 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
15:45490859:A:C	S187R	1.000
15:45490859:A:T	S187R	1.000
15:45490861:T:G	S187R	1.000
15:45487591:A:C	F312L	0.999
15:45487591:A:T	F312L	0.999
15:45487593:A:G	F312L	0.999
15:45487614:C:G	D305H	0.999
15:45488880:A:C	S285R	0.999
15:45488880:A:T	S285R	0.999
15:45488882:T:G	S285R	0.999
15:45488893:T:C	D281G	0.999
15:45488893:T:G	D281A	0.999
15:45490805:T:A	R205S	0.999
15:45490805:T:G	R205S	0.999
15:45490816:C:G	A202P	0.999
15:45511152:C:T	G175E	0.999
15:45511247:A:C	D143E	0.999
15:45511247:A:T	D143E	0.999
15:45511265:G:C	S137R	0.999
15:45511265:G:T	S137R	0.999
15:45511267:T:G	S137R	0.999
15:45487601:G:T	T309K	0.998
15:45487605:A:G	C308R	0.998
15:45487613:T:C	D305G	0.998
15:45487616:G:T	A304D	0.998
15:45488860:G:T	A292E	0.998
15:45488869:A:G	L289P	0.998
15:45488876:C:G	G287R	0.998
15:45488892:A:C	D281E	0.998
15:45488892:A:T	D281E	0.998

dbSNP variants (sampled 300 via entrez): RS1000055578 (15:45509698 G>A), RS1000206051 (15:45493475 C>G), RS1000678962 (15:45522488 T>A,C,G), RS1000900266 (15:45502478 T>A), RS1000905015 (15:45481947 C>T), RS1000929586 (15:45501575 A>T), RS1000965980 (15:45488830 A>C,G), RS1000981614 (15:45501827 G>A,C), RS1001031919 (15:45496397 T>A,C), RS1001105258 (15:45508377 A>C), RS1001124634 (15:45518959 T>G), RS1001132250 (15:45523066 C>A,T), RS1001199360 (15:45509119 GTGTTTAAATCTCAAAAAAATTAA>G), RS1001299635 (15:45487353 A>C), RS1001351498 (15:45487649 CA>C)

Disease associations

OMIM: gene MIM:602095 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST001738_3	Response to fenofibrate (adiponectin levels)	5.000000e-06

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: transporter — SLC30 zinc transporter family

CTD chemical–gene interactions

29 total (human), top 29 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, increases expression, increases methylation	6
sodium arsenite	decreases expression, affects cotreatment, increases abundance, affects methylation	3
potassium chromate(VI)	affects cotreatment, decreases expression	2
Phenylmercuric Acetate	affects cotreatment, increases expression	2
Smoke	decreases expression, increases abundance	2
Zinc	increases transport, decreases expression	2
methylmercuric chloride	decreases expression	1
triphenyl phosphate	affects expression	1
manganese chloride	affects cotreatment, decreases expression, increases abundance	1
epigallocatechin gallate	affects cotreatment, decreases expression	1
di-n-butylphosphoric acid	affects expression	1
chromium hexavalent ion	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
torcetrapib	increases expression	1
abrine	decreases expression	1
dorsomorphin	affects cotreatment, increases expression	1
(+)-JQ1 compound	increases expression	1
Panobinostat	increases expression	1
Air Pollutants	increases abundance, decreases expression	1
Arsenic	affects cotreatment, decreases expression, increases abundance	1
Coal	decreases expression, increases abundance	1
Doxorubicin	decreases expression	1
Folic Acid	decreases expression	1
Colforsin	increases expression	1
Lead	affects expression	1
Manganese	affects cotreatment, decreases expression, increases abundance	1
Vanadium	decreases expression	1
Cadmium Chloride	decreases expression	1
Coal Ash	decreases expression	1

Cellosaurus cell lines

2 cell lines: 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_D4LE	HCT116-SLC30A4-KO-c10	Cancer cell line	Male
CVCL_D4LF	HCT116-SLC30A4-KO-c18	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.