SLC36A3
gene geneOn this page
Also known as PAT3TRAMD2tramdorin2
Summary
SLC36A3 (solute carrier family 36 member 3, HGNC:19659) is a protein-coding gene on chromosome 5q33.1, encoding Proton-coupled amino acid transporter 3 (Q495N2).
Predicted to enable amino acid transmembrane transporter activity. Predicted to be involved in carboxylic acid transport and proton transmembrane transport. Predicted to be located in membrane. Predicted to be active in vacuolar membrane.
Source: NCBI Gene 285641 — RefSeq curated summary.
At a glance
- GWAS associations: 2
- Clinical variants (ClinVar): 79 total
- MANE Select transcript:
NM_181774
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:19659 |
| Approved symbol | SLC36A3 |
| Name | solute carrier family 36 member 3 |
| Location | 5q33.1 |
| Locus type | gene with protein product |
| Status | Approved |
| Aliases | PAT3, TRAMD2, tramdorin2 |
| Ensembl gene | ENSG00000186334 |
| Ensembl biotype | protein_coding |
| OMIM | 608332 |
| Entrez | 285641 |
Gene structure
Transcript identifiers
Ensembl transcripts: 3 — 2 protein_coding, 1 retained_intron
ENST00000335230, ENST00000377713, ENST00000423071
RefSeq mRNA: 2 — MANE Select: NM_181774
NM_001145017, NM_181774
CCDS: CCDS4314, CCDS47316
Canonical transcript exons
ENST00000335230 — 10 exons
| Exon | Start | End |
|---|---|---|
| ENSE00001335582 | 151296180 | 151296268 |
| ENSE00001335654 | 151298593 | 151298683 |
| ENSE00001845371 | 151276358 | 151277661 |
| ENSE00001913463 | 151303227 | 151303766 |
| ENSE00003500349 | 151287246 | 151287464 |
| ENSE00003501121 | 151284044 | 151284210 |
| ENSE00003504793 | 151288386 | 151288470 |
| ENSE00003504898 | 151284613 | 151284711 |
| ENSE00003529179 | 151281014 | 151281183 |
| ENSE00003658245 | 151293364 | 151293459 |
Expression profiles
Bgee: expression breadth broad, 11 present calls, max score 77.47.
FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.0127 / max 8.5706, expressed in 4 samples.
FANTOM5 promoters (2 alternative TSS)
| Promoter ID | TPM avg | Samples expressed |
|---|---|---|
| 64358 | 0.0092 | 3 |
| 64357 | 0.0034 | 4 |
Top tissues by expression
123 total, by Bgee expression score (0-100, higher = more expressed):
| Tissue | Anatomy ID | Expression score | Quality |
|---|---|---|---|
| male germ line stem cell (sensu Vertebrata) in testis | CL:0000089 ∩ UBERON:0000473 | 77.47 | gold quality |
| testis | UBERON:0000473 | 68.98 | gold quality |
| left testis | UBERON:0004533 | 68.71 | gold quality |
| right testis | UBERON:0004534 | 67.80 | gold quality |
| colonic epithelium | UBERON:0000397 | 45.40 | gold quality |
| bone marrow cell | CL:0002092 | 44.71 | gold quality |
| bone marrow | UBERON:0002371 | 43.90 | gold quality |
| monocyte | CL:0000576 | 42.93 | gold quality |
| leukocyte | CL:0000738 | 42.81 | gold quality |
| granulocyte | CL:0000094 | 42.45 | silver quality |
| sural nerve | UBERON:0015488 | 41.30 | gold quality |
| calcaneal tendon | UBERON:0003701 | 39.86 | gold quality |
| lower esophagus mucosa | UBERON:0035834 | 39.77 | gold quality |
| ganglionic eminence | UBERON:0004023 | 38.99 | gold quality |
| hindlimb stylopod muscle | UBERON:0004252 | 38.95 | gold quality |
| ventricular zone | UBERON:0003053 | 36.48 | gold quality |
| cortical plate | UBERON:0005343 | 36.47 | gold quality |
| skin of leg | UBERON:0001511 | 36.10 | silver quality |
| mucosa of stomach | UBERON:0001199 | 35.92 | silver quality |
| apex of heart | UBERON:0002098 | 35.90 | gold quality |
| blood | UBERON:0000178 | 35.81 | gold quality |
| zone of skin | UBERON:0000014 | 35.59 | silver quality |
| superior frontal gyrus | UBERON:0002661 | 35.23 | gold quality |
| popliteal artery | UBERON:0002250 | 35.20 | gold quality |
| tibial artery | UBERON:0007610 | 35.15 | gold quality |
| uterine cervix | UBERON:0000002 | 34.75 | gold quality |
| vagina | UBERON:0000996 | 34.70 | silver quality |
| skin of abdomen | UBERON:0001416 | 34.52 | silver quality |
| right coronary artery | UBERON:0001625 | 34.38 | gold quality |
| right adrenal gland cortex | UBERON:0035827 | 34.34 | gold quality |
Single-cell (SCXA)
Detected in 1 experiment(s), a significant marker in 1.
| Experiment | Marker? | Max mean expression |
|---|---|---|
| E-ANND-3 | yes | 4.53 |
Regulation
Is transcription factor: no
miRNA regulators (miRDB)
62 targeting SLC36A3, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):
| miRNA | Max score | Avg score | miRNA target_count |
|---|---|---|---|
| HSA-MIR-4425 | 100.00 | 67.59 | 1049 |
| HSA-MIR-1277-5P | 100.00 | 73.95 | 5056 |
| HSA-MIR-485-3P | 99.98 | 70.68 | 1585 |
| HSA-MIR-539-3P | 99.98 | 70.74 | 1616 |
| HSA-MIR-548AA | 99.96 | 70.64 | 3753 |
| HSA-MIR-548AP-3P | 99.96 | 70.64 | 3753 |
| HSA-MIR-548T-3P | 99.96 | 70.64 | 3753 |
| HSA-MIR-6809-3P | 99.91 | 71.45 | 3814 |
| HSA-MIR-6499-3P | 99.90 | 66.38 | 1212 |
| HSA-MIR-627-3P | 99.90 | 71.42 | 3316 |
| HSA-MIR-6780A-5P | 99.88 | 66.69 | 2776 |
| HSA-MIR-3140-3P | 99.88 | 68.47 | 2069 |
| HSA-MIR-659-3P | 99.85 | 70.69 | 1620 |
| HSA-MIR-5003-3P | 99.85 | 69.29 | 2517 |
| HSA-MIR-4799-5P | 99.82 | 70.60 | 2663 |
| HSA-MIR-3121-3P | 99.82 | 71.96 | 3630 |
| HSA-MIR-1273H-5P | 99.77 | 66.32 | 2471 |
| HSA-MIR-4517 | 99.76 | 69.19 | 1867 |
| HSA-MIR-30B-3P | 99.70 | 65.76 | 2325 |
| HSA-MIR-3689A-3P | 99.70 | 65.73 | 2306 |
| HSA-MIR-3689B-3P | 99.70 | 65.71 | 2311 |
| HSA-MIR-3689C | 99.70 | 65.71 | 2311 |
| HSA-MIR-6779-5P | 99.70 | 65.76 | 2363 |
| HSA-MIR-587 | 99.64 | 70.86 | 2611 |
| HSA-MIR-4499 | 99.62 | 67.29 | 1470 |
| HSA-MIR-6832-5P | 99.58 | 64.82 | 1132 |
| HSA-MIR-516B-5P | 99.56 | 66.33 | 1495 |
| HSA-MIR-7106-5P | 99.53 | 67.47 | 3574 |
| HSA-MIR-6832-3P | 99.52 | 70.44 | 1726 |
| HSA-MIR-6513-5P | 99.43 | 67.81 | 1071 |
Literature-anchored findings (GeneRIF, showing 2)
- PAT3 was isolated and identified, but its function is not yet known. (PMID:12809675)
- lysophosphatidic acid stimulates apical Cl(-)/OH(-) exchange activity and surface levels of SLC36A3 and SLC26A6 in intestinal epithelial cells (PMID:19910524)
Cross-species orthologs
20 orthologs
| Organism | Symbol | Gene ID |
|---|---|---|
| danio_rerio | slc38a5b | ENSDARG00000014587 |
| mus_musculus | Slc36a3 | ENSMUSG00000049491 |
| rattus_norvegicus | Slc36a3 | ENSRNOG00000021310 |
| drosophila_melanogaster | CG16700 | FBGN0030816 |
| drosophila_melanogaster | CG4991 | FBGN0030817 |
| drosophila_melanogaster | CG13384 | FBGN0032036 |
| drosophila_melanogaster | polyph | FBGN0033572 |
| drosophila_melanogaster | VGAT | FBGN0033911 |
| drosophila_melanogaster | acs | FBGN0035300 |
| drosophila_melanogaster | CG7888 | FBGN0036116 |
| drosophila_melanogaster | CG32079 | FBGN0052079 |
| drosophila_melanogaster | CG32081 | FBGN0052081 |
| drosophila_melanogaster | mah | FBGN0285912 |
| caenorhabditis_elegans | WBGENE00006783 | |
| caenorhabditis_elegans | slc-36.4 | WBGENE00010421 |
| caenorhabditis_elegans | Y18D10A.23 | WBGENE00012487 |
| caenorhabditis_elegans | WBGENE00012629 | |
| caenorhabditis_elegans | WBGENE00012804 | |
| caenorhabditis_elegans | WBGENE00019837 | |
| caenorhabditis_elegans | WBGENE00020837 |
Paralogs (15): SLC38A5 (ENSG00000017483), SLC32A1 (ENSG00000101438), SLC38A7 (ENSG00000103042), SLC38A1 (ENSG00000111371), SLC36A1 (ENSG00000123643), SLC38A2 (ENSG00000134294), SLC38A4 (ENSG00000139209), SLC38A6 (ENSG00000139974), SLC38A10 (ENSG00000157637), SLC38A8 (ENSG00000166558), SLC38A11 (ENSG00000169507), SLC38A9 (ENSG00000177058), SLC36A4 (ENSG00000180773), SLC36A2 (ENSG00000186335), SLC38A3 (ENSG00000188338)
Protein
Protein identifiers
Proton-coupled amino acid transporter 3 — Q495N2 (reviewed: Q495N2)
Alternative names: Solute carrier family 36 member 3, Tramdorin-2
All UniProt accessions (1): Q495N2
UniProt curated annotations — full annotation on UniProt →
Subcellular location. Membrane.
Tissue specificity. Specifically expressed in testis.
Similarity. Belongs to the amino acid/polyamine transporter 2 family.
Isoforms (3)
| UniProt ID | Names | Canonical? |
|---|---|---|
| Q495N2-1 | 1 | yes |
| Q495N2-2 | 2 | |
| Q495N2-3 | 3 |
RefSeq proteins (2): NP_001138489, NP_861439* (*=MANE)
Domains & families (InterPro)
| ID | Name | Type |
|---|---|---|
| IPR013057 | AA_transpt_TM | Domain |
Pfam: PF01490
UniProt features (35 total): topological domain 12, transmembrane region 11, sequence variant 5, compositionally biased region 2, splice variant 2, chain 1, region of interest 1, sequence conflict 1
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
| Model | pLDDT | Fraction very-high |
|---|---|---|
| AF-Q495N2-F1 | 84.61 | 0.64 |
Function
Pathways and Gene Ontology
Reactome pathways
0 pathways
MSigDB gene sets: 65 (showing top):
GOCC_VACUOLAR_MEMBRANE, GOBP_AMINO_ACID_TRANSMEMBRANE_TRANSPORT, GOBP_MONOATOMIC_CATION_TRANSPORT, GOBP_ORGANIC_ACID_TRANSPORT, GOBP_AMINO_ACID_TRANSPORT, E4F1_Q6, GOBP_ORGANIC_ANION_TRANSPORT, GOMF_PROTON_TRANSMEMBRANE_TRANSPORTER_ACTIVITY, GOBP_ORGANIC_CATION_TRANSPORT, GOBP_NEUTRAL_AMINO_ACID_TRANSPORT, GOBP_TRANSMEMBRANE_TRANSPORT, GOMF_L_AMINO_ACID_TRANSMEMBRANE_TRANSPORTER_ACTIVITY, GOMF_MONOATOMIC_CATION_TRANSMEMBRANE_TRANSPORTER_ACTIVITY, GOMF_AMINO_ACID_TRANSMEMBRANE_TRANSPORTER_ACTIVITY, GOMF_ACTIVE_TRANSMEMBRANE_TRANSPORTER_ACTIVITY
GO Biological Process (4): L-alanine transport (GO:0015808), glycine transport (GO:0015816), proline transmembrane transport (GO:0035524), proton transmembrane transport (GO:1902600)
GO Molecular Function (4): amino acid:proton symporter activity (GO:0005280), L-alanine transmembrane transporter activity (GO:0015180), glycine transmembrane transporter activity (GO:0015187), L-proline transmembrane transporter activity (GO:0015193)
GO Cellular Component (2): vacuolar membrane (GO:0005774), membrane (GO:0016020)
GO top-level categories
Rollup of top GO terms by namespace:
| Category | Terms |
|---|---|
| nitrogen compound transport | 2 |
| L-amino acid transmembrane transporter activity | 2 |
| neutral L-amino acid transmembrane transporter activity | 2 |
| L-amino acid transport | 1 |
| alanine transport | 1 |
| neutral amino acid transport | 1 |
| carboxylic acid transport | 1 |
| amino acid transmembrane transport | 1 |
| carboxylic acid transmembrane transport | 1 |
| monoatomic cation transmembrane transport | 1 |
| amino acid:monoatomic cation symporter activity | 1 |
| solute:proton symporter activity | 1 |
| L-alanine transport | 1 |
| alanine transmembrane transporter activity | 1 |
| glycine transport | 1 |
| carboxylic acid transmembrane transporter activity | 1 |
| proline transmembrane transport | 1 |
| vacuole | 1 |
| bounding membrane of organelle | 1 |
| cellular anatomical structure | 1 |
Protein interactions and networks
STRING
541 interactions, top by confidence (×1000):
| Protein A | Protein B | Partner UniProt | Score |
|---|---|---|---|
| SLC36A3 | PARVA | Q9NVD7 | 656 |
| SLC36A3 | LIMS1 | P48059 | 642 |
| SLC36A3 | TLN1 | Q9Y490 | 584 |
| SLC36A3 | ILK | P57043 | 584 |
| SLC36A3 | HMCN1 | Q96RW7 | 564 |
| SLC36A3 | TLN2 | Q9Y4G6 | 558 |
| SLC36A3 | HMCN2 | Q8NDA2 | 556 |
| SLC36A3 | FERMT2 | Q96AC1 | 536 |
| SLC36A3 | WDR35 | Q9P2L0 | 504 |
| SLC36A3 | SLC6A19 | Q695T7 | 477 |
| SLC36A3 | FNDC8 | Q8TC99 | 461 |
| SLC36A3 | SLC6A18 | Q96N87 | 461 |
| SLC36A3 | SLC6A20 | Q9NP91 | 461 |
| SLC36A3 | SLC36A2 | Q495M3 | 439 |
| SLC36A3 | DOCK1 | Q14185 | 396 |
IntAct
2 interactions, top by confidence:
| A | B | Type | Score |
|---|---|---|---|
| SLC36A3 | GNB3 | psi-mi:“MI:0915”(physical association) | 0.400 |
BioGRID (2): GNB3 (Affinity Capture-MS), GNB3 (Affinity Capture-MS)
ESM2 similar proteins: A7MBD8, O70247, P63115, P63116, P83740, Q08DX7, Q1EHB4, Q28728, Q2M3M2, Q2YDU8, Q495M3, Q495N2, Q49B93, Q4V8B1, Q5BL81, Q5FY69, Q5RAE3, Q5U4D8, Q6R4Q5, Q6YBV0, Q6ZMD2, Q7SYH5, Q7T384, Q811P0, Q8BHK3, Q8BYF6, Q8CH36, Q8CIW6, Q8K078, Q8K415, Q8K4D3, Q8N695, Q8R0G7, Q8VDT1, Q91Y63, Q924A5, Q96BD0, Q99N01, Q9BXS9, Q9D232
Diamond homologs: Q495M3, Q495N2, Q4KL91, Q4V8B1, Q6YBV0, Q7Z2H8, Q811P0, Q8BHK3, Q8CH36, Q8K415, Q8K4D3, Q924A5, Q9VT04, Q9W056, P50944, Q9SVG0, Q9LXF8, F4ILY9, F4J1Q9, Q9FKY3, Q9SF09, Q4V5R4
SIGNOR signaling
0 interactions.
Disease & clinical
Clinical variants and AI predictions
ClinVar
79 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 0 |
| Likely pathogenic | 0 |
| Uncertain significance | 73 |
| Likely benign | 2 |
| Benign | 0 |
Top pathogenic / likely-pathogenic (0)
SpliceAI
1477 predictions. Top by Δscore:
| Variant | Effect | Δscore |
|---|---|---|
| 5:151277657:GACAC:G | acceptor_gain | 1.0000 |
| 5:151277658:ACAC:A | acceptor_gain | 1.0000 |
| 5:151277659:CAC:C | acceptor_gain | 1.0000 |
| 5:151277659:CACC:C | acceptor_gain | 1.0000 |
| 5:151277660:AC:A | acceptor_gain | 1.0000 |
| 5:151277661:CC:C | acceptor_gain | 1.0000 |
| 5:151277662:C:CC | acceptor_gain | 1.0000 |
| 5:151277663:T:G | acceptor_loss | 1.0000 |
| 5:151284707:ATCCC:A | acceptor_gain | 1.0000 |
| 5:151284708:TCCC:T | acceptor_gain | 1.0000 |
| 5:151284709:CCC:C | acceptor_gain | 1.0000 |
| 5:151284709:CCCC:C | acceptor_gain | 1.0000 |
| 5:151284710:CC:C | acceptor_gain | 1.0000 |
| 5:151284710:CCC:C | acceptor_gain | 1.0000 |
| 5:151284711:CC:C | acceptor_gain | 1.0000 |
| 5:151284712:C:CC | acceptor_gain | 1.0000 |
| 5:151284713:T:C | acceptor_loss | 1.0000 |
| 5:151287231:C:A | donor_gain | 1.0000 |
| 5:151287261:A:AC | donor_gain | 1.0000 |
| 5:151287262:A:C | donor_gain | 1.0000 |
| 5:151287279:C:CA | donor_gain | 1.0000 |
| 5:151277667:A:AC | acceptor_gain | 0.9900 |
| 5:151281012:A:AC | donor_gain | 0.9900 |
| 5:151281013:C:CC | donor_gain | 0.9900 |
| 5:151281013:CA:C | donor_gain | 0.9900 |
| 5:151283854:C:A | donor_gain | 0.9900 |
| 5:151284612:CCATA:C | donor_gain | 0.9900 |
| 5:151284620:ACG:A | donor_gain | 0.9900 |
| 5:151284621:CGC:C | donor_gain | 0.9900 |
| 5:151284712:C:T | acceptor_gain | 0.9900 |
AlphaMissense
3082 scored. Top likely-pathogenic:
| Variant | Protein change | am_pathogenicity |
|---|---|---|
| 5:151287276:G:C | S226R | 0.995 |
| 5:151287276:G:T | S226R | 0.995 |
| 5:151287278:T:G | S226R | 0.995 |
| 5:151284091:A:C | F309L | 0.991 |
| 5:151284091:A:T | F309L | 0.991 |
| 5:151284093:A:G | F309L | 0.991 |
| 5:151277594:G:C | S404R | 0.990 |
| 5:151277594:G:T | S404R | 0.990 |
| 5:151277596:T:G | S404R | 0.990 |
| 5:151284070:G:C | S316R | 0.990 |
| 5:151284070:G:T | S316R | 0.990 |
| 5:151284072:T:G | S316R | 0.990 |
| 5:151284056:A:G | L321S | 0.989 |
| 5:151284105:C:G | G305R | 0.989 |
| 5:151284114:C:G | G302R | 0.989 |
| 5:151284114:C:T | G302R | 0.989 |
| 5:151284634:G:C | F262L | 0.989 |
| 5:151284634:G:T | F262L | 0.989 |
| 5:151284636:A:G | F262L | 0.989 |
| 5:151277597:G:C | S403R | 0.988 |
| 5:151277597:G:T | S403R | 0.988 |
| 5:151277599:T:G | S403R | 0.988 |
| 5:151277600:G:C | S402R | 0.988 |
| 5:151277600:G:T | S402R | 0.988 |
| 5:151277602:T:G | S402R | 0.988 |
| 5:151296254:G:C | S78R | 0.988 |
| 5:151296254:G:T | S78R | 0.988 |
| 5:151296256:T:G | S78R | 0.988 |
| 5:151284114:C:A | G302W | 0.987 |
| 5:151298604:C:G | A70P | 0.987 |
dbSNP variants (sampled 300 via entrez): RS1000067087 (5:151299242 CTCTCTCTCTCTCTCTCTCTCTCTA>C), RS1000123410 (5:151281556 G>A), RS1000124833 (5:151293202 T>C), RS1000153913 (5:151293642 A>G), RS1000416778 (5:151287681 C>T), RS1000476838 (5:151299272 A>C,G), RS1000653127 (5:151305300 G>A), RS1000678808 (5:151276840 C>T), RS1000787470 (5:151299177 C>T), RS1000856262 (5:151282835 C>T), RS1000908406 (5:151283101 G>A), RS1001106351 (5:151281426 A>G,T), RS1001223572 (5:151292076 G>T), RS1001274265 (5:151302251 C>G), RS1001326461 (5:151302689 A>G,T)
Disease associations
OMIM: gene MIM:608332 | disease phenotypes:
GenCC curated gene-disease
Mondo (0):
Orphanet (0):
HPO phenotypes
0 total (0 of 0 shown, HPO-id order):
GWAS associations
2 associations (top):
| Study | Trait | p-value |
|---|---|---|
| GCST004131_47 | Inflammatory bowel disease | 3.000000e-15 |
| GCST004132_24 | Crohn’s disease | 2.000000e-19 |
Drugs & pharmacology
Drug and pharmacology data
Is drug target: no
PharmGKB: 1 entry (VIP=true, CPIC=false)
GtoPdb / IUPHAR curated pharmacology
(IUPHAR/BPS Guide to Pharmacology — expert-curated)
Target class: transporter — SLC36 family of proton-coupled amino acid transporters
CTD chemical–gene interactions
4 total (human), top 4 by PubMed support.
| Chemical | Actions (top 5) | PubMed papers |
|---|---|---|
| bisphenol A | decreases expression, decreases methylation | 2 |
| CGP 52608 | affects binding, increases reaction | 1 |
| Benzo(a)pyrene | increases methylation | 1 |
| Valproic Acid | increases methylation | 1 |
Clinical trials (associated diseases)
0 trials via MONDO — disease-level, not drug-specific.
Related Atlas pages
No linked Atlas pages yet — the cross-entity mesh grows as the corpus expands.