SLC3A1

Summary

SLC3A1 (solute carrier family 3 member 1, HGNC:11025) is a protein-coding gene on chromosome 2p21, encoding Amino acid transporter heavy chain SLC3A1 (Q07837). Acts as a chaperone that facilitates biogenesis and trafficking of functional transporter heteromers to the plasma membrane.

This gene encodes a type II membrane glycoprotein which is one of the components of the renal amino acid transporter which transports neutral and basic amino acids in the renal tubule and intestinal tract. Mutations and deletions in this gene are associated with cystinuria. Alternatively spliced transcript variants have been described, but their biological validity has not been determined.

Source: NCBI Gene 6519 — RefSeq curated summary.

At a glance

• Gene–disease (curated): cystinuria (Definitive, ClinGen) — +1 more curated relationship
• GWAS associations: 2
• Clinical variants (ClinVar): 513 total — 59 pathogenic, 46 likely-pathogenic
• Phenotypes (HPO): 32
• Dosage sensitivity (ClinGen): haploinsufficiency autosomal recessive, triplosensitivity no evidence
• MANE Select transcript: NM_000341

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:11025
Approved symbol	SLC3A1
Name	solute carrier family 3 member 1
Location	2p21
Locus type	gene with protein product
Status	Approved
Aliases	CSNU1, D2H, RBAT, ATR1, NBAT
Ensembl gene	ENSG00000138079
Ensembl biotype	protein_coding
OMIM	104614
Entrez	6519

Gene structure

Transcript identifiers

Ensembl transcripts: 11 — 11 protein_coding

ENST00000260649, ENST00000409229, ENST00000409294, ENST00000409380, ENST00000409387, ENST00000409740, ENST00000409741, ENST00000410056, ENST00000427285, ENST00000611973, ENST00000905893

RefSeq mRNA: 1 — MANE Select: NM_000341 NM_000341

CCDS: CCDS1819

Canonical transcript exons

ENST00000260649 — 10 exons

Exon	Start	End
ENSE00000750851	44280716	44280895
ENSE00000750852	44281387	44281541
ENSE00000750855	44299971	44300090
ENSE00000750856	44301003	44301127
ENSE00000809760	44286032	44286157
ENSE00000932605	44312586	44312753
ENSE00000932606	44313835	44313951
ENSE00001165249	44275480	44275965
ENSE00001929028	44320199	44321494
ENSE00003511068	44304143	44304338

Expression profiles

Bgee: expression breadth ubiquitous, 163 present calls, max score 96.04.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 2.0639 / max 872.3099, expressed in 81 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
19995	1.1986	64
19994	0.5962	46
19996	0.2637	31
19997	0.0055	3

Top tissues by expression

254 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
body of pancreas	UBERON:0001150	96.04	gold quality
gall bladder	UBERON:0002110	95.43	gold quality
metanephros cortex	UBERON:0010533	93.22	gold quality
pancreas	UBERON:0001264	92.22	gold quality
adult mammalian kidney	UBERON:0000082	91.95	gold quality
islet of Langerhans	UBERON:0000006	91.05	gold quality
small intestine Peyer’s patch	UBERON:0003454	88.10	gold quality
mucosa of transverse colon	UBERON:0004991	87.49	gold quality
kidney	UBERON:0002113	85.49	gold quality
rectum	UBERON:0001052	85.45	gold quality
small intestine	UBERON:0002108	85.05	gold quality
cortex of kidney	UBERON:0001225	84.87	gold quality
oocyte	CL:0000023	80.66	silver quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	79.00	gold quality
secondary oocyte	CL:0000655	77.75	silver quality
transverse colon	UBERON:0001157	77.71	gold quality
duodenum	UBERON:0002114	77.00	gold quality
oviduct epithelium	UBERON:0004804	75.28	gold quality
metanephros	UBERON:0000081	74.40	gold quality
right lobe of liver	UBERON:0001114	73.36	gold quality
intestine	UBERON:0000160	69.22	gold quality
jejunal mucosa	UBERON:0000399	69.09	gold quality
kidney epithelium	UBERON:0004819	67.44	gold quality
buccal mucosa cell	CL:0002336	67.38	gold quality
liver	UBERON:0002107	65.44	gold quality
calcaneal tendon	UBERON:0003701	64.78	gold quality
endometrium	UBERON:0001295	64.44	gold quality
tendon	UBERON:0000043	64.20	gold quality
colon	UBERON:0001155	64.05	gold quality
tendon of biceps brachii	UBERON:0008188	63.66	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-MTAB-5061	yes	1452.30
E-HCAD-10	yes	529.49
E-ANND-3	yes	9.87

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): PAX8, TBPL1

miRNA regulators (miRDB)

9 targeting SLC3A1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4262	100.00	73.26	3931
HSA-MIR-498-5P	99.76	69.64	1807
HSA-MIR-548V	99.29	69.47	1157
HSA-MIR-580-5P	99.28	70.94	1776
HSA-MIR-935	98.82	69.36	1072
HSA-MIR-589-5P	98.72	66.96	927
HSA-MIR-4718	98.55	68.61	814
HSA-MIR-127-5P	97.78	67.64	869
HSA-MIR-4301	95.00	65.22	554

Functional genomics

ClinGen dosage: haploinsufficiency 30 (autosomal recessive), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 40)

• The most frequent mutation in this study was the previously reported M467T and it was also detected in the normal population with an allelic frequency of 0.5%, which implies that other genes may be involved in cystinuria. (PMID:11748844)
• in kidney cells, intracellular association of rBAT and b(0,+)AT is required for the surface expression of either subunit, which together form a functional heterocomplex at the apical cell membrane. (PMID:12060600)
• a decreasing expression gradient of heterodimeric rBAT-b(0,+)AT along the proximal tubule is responsible for virtually all apical cystine reabsorption (PMID:12167606)
• in cystinuria, the detection rate for mutations in SLC3A1 in children was 54% in the SLC3A1 gene for type I chromosomes (PMID:12234283)
• To offer molecular genetic diagnosis for cystinuria, a search for mutations of the SLC3A1 gene is being expanded to be able to initiate early therapy. (PMID:12372889)
• a large duplication in SLC3A1 spanning from intron 4 to intron 9 accompanied by a small inversion of 25 bp and a 2 bp deletion in intron 9 in cystinuria (PMID:14531788)
• First direct evidence is given that mutations in rBAT may modify transport properties of amino acid antiporter system b0+. (PMID:14561219)
• Mutations of this protein have a population-specific distribution among south-east Europeans living in Germany. (PMID:14991253)
• Mutational analysis should focus on this gene in inheritance of cytinuria. (PMID:15635077)
• gene deletion, codon 222 in cystinuria (PMID:15818800)
• gene deletion in cysteinuria, codon 656 (PMID:15818801)
• gene deletion, codon 567 in cystinuria (PMID:15818802)
• SLC3A1 and SLC7A9 mutations may have roles in cystinuria (PMID:16138908)
• rBAT1 and Cav-1 share a cellular expression in the segregated caveolae structure. As caveolae are rich in signaling molecules, BAT1 could play a role in diverse pathophysiological processes. (PMID:16358225)
• The data show that patient with cysteinria adn nephrolithiasis has an increased cystine (923.08 microg/mL) level and was heterozygote for M467T mutation. (PMID:17010017)
• a deletion of SLC3A1 causes atypical hypotonia-cystinuria syndrome (PMID:18234729)
• Data suggest a two-step biogenesis model, with the early assembly of the subunits followed by folding of the rBAT extracellular domain. Defects on either of these steps lead to the type I cystinuria phenotype. (PMID:18332091)
• Twenty-four novel mutations in a cohort of 85 patients by direct sequencing of the SLC3A1 and SLC7A9 cystinuria genes are reported. (PMID:18752446)
• SLC3A1 and SLC7A9 mutations identified in 52 Greek cystinuria patients; in total 14 mutations were identified in SLC3A1 and 12 in SLC7A9. (PMID:18778962)
• Studies identified 6 different alleles in SLC3A1 and 2 in SLC7A9 accounting for a total of 25 copy number changes, 11 in SLC3A1 and 14 in SLC7A9. (PMID:19782624)
• In SLC3A1 gene, two large genomic rearrangements and 13 sequence variants are found in cystinuria patients. (PMID:21255007)
• Two novel deletions encompassing the SLC3A1 and PREPL genes have been identified in unrelated hypotonia-cystinuria syndrome patients. (PMID:22796000)
• Deletion of SLC3A1 is associated with Hypotonia-cystinuria syndrome. (PMID:23794250)
• We present six family members with a complex phenotypic profile of cystinuria based on mutations in SLC3A1 (type A) or SLC7A9 (type B). (PMID:24045899)
• RBAT gene products, as the primary cause of cystinuria, may function as activators of the amino acid transport system in renal brush border membrane. (PMID:24449952)
• We present a new pathogenic homozygous mutation, c.833T>C in exon 4 of SLC3A1 gene, in a girl with cystinuria, whose single symptom was an increasingly hyper-echogenic colon in the prenatal sonography as of 30 weeks of gestation. (PMID:24824759)
• Report no association of SLC3A1 mutations with clinical course of disease in cystinuria patients. (PMID:25964309)
• M467T, T216M mutations not found in Iranian cystinuria patients (PMID:26123750)
• Deletion of the rBAT C-terminal disulfide loop (residues 673-685) prevented maturation and prompted degradation of the transporter. (PMID:26537754)
• Five SLC3A1 and SLC7A9 mutations appear to be responsible for the genetic basis of cystinuria in the Greek-Cypriot patients (PMID:26540609)
• We found a novel mutation in the acceptor region in exon 1 (SLC3A1 gene) and detected a heterozygosity status for the described patients. (PMID:26837681)
• In a Saudi Arabian cohort of patients with cystinuria, two new variants in the SLC3A1 and SLC9A7 genes were discovered. All of the detected mutations were missense variants in three different exons, such as c.1711 T > A (p.Cys571Ser) (exon 10), c.1166C > T p.Thr389Met (exon 11) and c.1400 T > A p.Met467Lys (exon 8). (PMID:28166740)
• Here, the authors report that the expression level of the solute carrier family 3, member 1 (SLC3A1), the cysteine carrier, tightly correlated with clinical stages and patients’ survival. Elevated SLC3A1 expression accelerated the cysteine uptake and the accumulation of reductive glutathione (GSH), leading to reduced reactive oxygen species (ROS). (PMID:28382174)
• Spectrum of SLC3A1 and SLC7A9 mutations in cystinuria patients presenting with prenatal hyperechoic colon has been described. (PMID:28646536)
• Thirteen pediatric patients with cystine stones were evaluated in our clinic between 2012 and 2015. Gene mutations in SLC3A1 and SLC7A9 were investigated (PMID:28689648)
• Analysis showing how different mutations in SLC3A1 and SLC7A9 affect severity of cystinuria. (PMID:28812535)
• Study shows that various computational tools were able to distinguish cystinuria-causing mutations from benign polymorphisms. Four deleterious mutation (R362C, T216M, M467K/T) in the coding region of SLC3A1 were identified. The intron variant c.1136+2/3delT in SLC3A1 gene probably affected the splicing process. (PMID:30069816)
• A homozygous c.325G>A mutation in cationic amino cid transport proteins (SLC7A9) was identified in two patients, and six neutral and basic amino acid transporter protein (SLC3A1) mutations were found in five patients. (PMID:30146843)
• Structural basis for amino acid exchange by a human heteromeric amino acid transporter. (PMID:32817565)
• Clinical profile of a Polish cohort of children and young adults with cystinuria. (PMID:33349102)

Cross-species orthologs

15 orthologs

Organism	Symbol	Gene ID
danio_rerio	slc3a1	ENSDARG00000017165
mus_musculus	Slc3a1	ENSMUSG00000024131
rattus_norvegicus	Slc3a1	ENSRNOG00000007006
drosophila_melanogaster	Amy-d	FBGN0000078
drosophila_melanogaster	Amy-p	FBGN0000079
drosophila_melanogaster	Mal-A2	FBGN0002569
drosophila_melanogaster	Mal-A3	FBGN0002571
drosophila_melanogaster	Amyrel	FBGN0020506
drosophila_melanogaster	Mal-B1	FBGN0032381
drosophila_melanogaster	Mal-B2	FBGN0032382
drosophila_melanogaster	Mal-A4	FBGN0033294
drosophila_melanogaster	Mal-A7	FBGN0033296
drosophila_melanogaster	Mal-A8	FBGN0033297
drosophila_melanogaster	Mal-A6	FBGN0050360
caenorhabditis_elegans		WBGENE00008220

Paralogs (7): GBE1 (ENSG00000114480), SLC3A2 (ENSG00000168003), AMY1B (ENSG00000174876), AMY1C (ENSG00000187733), AMY1A (ENSG00000237763), AMY2B (ENSG00000240038), AMY2A (ENSG00000243480)

Protein

Protein identifiers

Amino acid transporter heavy chain SLC3A1 — Q07837 (reviewed: Q07837)

Alternative names: D2h, Neutral and basic amino acid transport protein, Solute carrier family 3 member 1, b(0,+)-type amino acid transporter-related heavy chain

All UniProt accessions (6): Q07837, A0A087X0R9, A0A0S2Z4E1, B8ZZK1, B8ZZP2, C9JBK3

UniProt curated annotations — full annotation on UniProt →

Function. Acts as a chaperone that facilitates biogenesis and trafficking of functional transporter heteromers to the plasma membrane. Associates with SLC7A9 to form a functional transporter complex that mediates the electrogenic exchange between cationic amino acids and neutral amino acids, with a stoichiometry of 1:1. SLC7A9-SLC3A1 transporter has system b(0,+)-like activity with high affinity for extracellular cationic amino acids and L-cystine and lower affinity for intracellular neutral amino acids. Substrate exchange is driven by high concentration of intracellular neutral amino acids and the intracellular reduction of L-cystine to L-cysteine. SLC7A9-SLC3A1 acts as a major transporter for reabsorption of L-cystine and dibasic amino acids across the brush border membrane in early proximal tubules. Associates with SLC7A13 to form a functional complex that transports anionic and neutral amino acids via exchange or facilitated diffusion. SLC7A13-SLC3A1 may act as a major transporter for L-cystine in late proximal tubules, ensuring its reabsorption from the luminal fluid in exchange for cytosolic L-glutamate or L-aspartate.

Subunit / interactions. Disulfide-linked heterodimer composed of the catalytic light subunit SLC7A9 and the heavy subunit SLC3A1. The heterodimer is the minimal functional unit. Assembles in non-covalently linked heterotetramers (dimers of heterodimers) and higher order oligomers; the oligomerization is mediated by SLC3A1 likely to prevent degradation in the endoplasmic reticulum and facilitate heteromer trafficking to the plasma membrane. Disulfide-linked heterodimer composed of the catalytic light subunit SLC7A13 and the heavy subunit SLC3A1.

Subcellular location. Cell membrane. Apical cell membrane.

Tissue specificity. Expressed in the brush border membrane in the kidney (at protein level). Predominantly expressed in the kidney, small intestine and pancreas. Weakly expressed in liver.

Disease relevance. Cystinuria (CSNU) [MIM:220100] An autosomal disorder characterized by impaired epithelial cell transport of cystine and dibasic amino acids (lysine, ornithine, and arginine) in the proximal renal tubule and gastrointestinal tract. The impaired renal reabsorption of cystine and its low solubility causes the formation of calculi in the urinary tract, resulting in obstructive uropathy, pyelonephritis, and, rarely, renal failure. The disease is caused by variants affecting the gene represented in this entry. Hypotonia-cystinuria syndrome (HCS) [MIM:606407] Characterized generalized hypotonia at birth, nephrolithiasis, growth hormone deficiency, minor facial dysmorphism, failure to thrive, followed by hyperphagia and rapid weight gain in late childhood. The disease is caused by variants affecting the gene represented in this entry. Hypotonia-cystinuria syndrome is a contiguous gene syndrome caused by a homozygous deletion on chromosome 2p21 that disrupts the gene represented in this entry and PREPL. A homozygous 77.4-kb deletion that disrupts the gene represented in this entry, PREPL, and CAMKMT, causes atypical hypotonia-cystinuria syndrome, characterized by mild to moderate intellectual disability and respiratory chain complex IV deficiency.

Isoforms (7)

UniProt ID	Names	Canonical?
Q07837-1	A	yes
Q07837-2	B
Q07837-3	C
Q07837-4	D
Q07837-5	E
Q07837-6	F
Q07837-7	G

RefSeq proteins (1): NP_000332* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR006047	GH13_cat_dom	Domain
IPR013780	Glyco_hydro_b	Homologous_superfamily
IPR017853	GH_hydrolase_sf	Homologous_superfamily
IPR045857	O16G_dom_2	Homologous_superfamily

Pfam: PF00128

UniProt features (157 total): sequence variant 54, strand 30, helix 28, turn 12, splice variant 11, glycosylation site 6, binding site 5, disulfide bond 4, topological domain 2, chain 1, modified residue 1, transmembrane region 1, region of interest 1, compositionally biased region 1

Structure

Experimental structures (PDB)

5 structures.

PDB	Method	Resolution (Å)
6LI9	ELECTRON MICROSCOPY	2.3
8WK6	ELECTRON MICROSCOPY	2.64
6LID	ELECTRON MICROSCOPY	2.7
6YUZ	ELECTRON MICROSCOPY	2.8
6YUP	ELECTRON MICROSCOPY	2.9

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q07837-F1	87.53	0.74

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (5): 321; 214; 284; 318; 319

Post-translational modifications (1): 10

Disulfide bonds (4): 114, 242–273, 571–666, 673–685

Glycosylation sites (6): 214, 261, 332, 495, 513, 575

Function

Pathways and Gene Ontology

Reactome pathways

9 pathways

ID	Pathway
R-HSA-352230	Amino acid transport across the plasma membrane
R-HSA-5619113	Defective SLC3A1 causes cystinuria (CSNU)
R-HSA-5660883	Defective amino acid transport by SLC7A9 causes cystinuria (CSNU)
R-HSA-1643685	Disease
R-HSA-382551	Transport of small molecules
R-HSA-425393
R-HSA-425407	SLC-mediated transmembrane transport
R-HSA-5619102	SLC transporter disorders
R-HSA-5619115	Disorders of transmembrane transporters

MSigDB gene sets: 188 (showing top): GOCC_VACUOLAR_MEMBRANE, GOBP_MODIFIED_AMINO_ACID_TRANSPORT, GOBP_AMINO_ACID_TRANSMEMBRANE_TRANSPORT, GOBP_ORGANIC_ACID_TRANSPORT, GOBP_AMINO_ACID_TRANSPORT, CAIRO_HEPATOBLASTOMA_DN, GOBP_BASIC_AMINO_ACID_TRANSPORT, GOBP_CARBOHYDRATE_METABOLIC_PROCESS, GOBP_ORGANIC_ANION_TRANSPORT, GOBP_SULFUR_COMPOUND_TRANSPORT, GOBP_DICARBOXYLIC_ACID_TRANSPORT, APPIERTO_RESPONSE_TO_FENRETINIDE_DN, GOBP_ACIDIC_AMINO_ACID_TRANSPORT, GOCC_APICAL_PLASMA_MEMBRANE, TGGNNNNNNKCCAR_UNKNOWN

GO Biological Process (8): carbohydrate metabolic process (GO:0005975), amino acid transport (GO:0006865), gene expression (GO:0010467), basic amino acid transport (GO:0015802), aspartate transmembrane transport (GO:0015810), L-cystine transport (GO:0015811), L-glutamate transmembrane transport (GO:0015813), basic amino acid transmembrane transport (GO:1990822)

GO Molecular Function (6): amino acid transmembrane transporter activity (GO:0015171), basic amino acid transmembrane transporter activity (GO:0015174), L-cystine transmembrane transporter activity (GO:0015184), protein-containing complex binding (GO:0044877), protein heterodimerization activity (GO:0046982), protein binding (GO:0005515)

GO Cellular Component (6): vacuolar membrane (GO:0005774), plasma membrane (GO:0005886), membrane (GO:0016020), brush border membrane (GO:0031526), extracellular exosome (GO:0070062), apical plasma membrane (GO:0016324)

Reactome top-level categories

Rollup of top-5 pathways:

Category	Pathways
SLC transporter disorders	2
SLC-mediated transport of amino acids	1
Transport of small molecules	1
Disorders of transmembrane transporters	1
Disease	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
amino acid transmembrane transport	3
binding	2
primary metabolic process	1
transport	1
macromolecule biosynthetic process	1
amino acid transport	1
C4-dicarboxylate transport	1
acidic amino acid transport	1
nitrogen compound transport	1
carboxylic acid transmembrane transport	1
sulfur amino acid transport	1
neutral amino acid transport	1
L-amino acid transport	1
modified amino acid transport	1
L-glutamate import	1
L-alpha-amino acid transmembrane transport	1
basic amino acid transport	1
transmembrane transporter activity	1
amino acid transmembrane transporter activity	1
basic amino acid transmembrane transport	1
sulfur amino acid transmembrane transporter activity	1
L-amino acid transmembrane transporter activity	1
L-cystine transport	1
modified amino acid transmembrane transporter activity	1
protein dimerization activity	1
vacuole	1
bounding membrane of organelle	1
membrane	1
cell periphery	1
cellular anatomical structure	1
brush border	1
apical plasma membrane	1
cell projection membrane	1
extracellular vesicle	1
apical part of cell	1
plasma membrane region	1

Protein interactions and networks

STRING

1778 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SLC3A1	SLC7A9	P82251	998
SLC3A1	PREPL	Q4J6C6	969
SLC3A1	AGT	P01019	961
SLC3A1	PPM1B	O75688	938
SLC3A1	CAMKMT	Q7Z624	935
SLC3A1	SLC7A5	Q01650	876
SLC3A1	SLC7A6	Q92536	844
SLC3A1	SLC7A7	Q9UM01	819
SLC3A1	SLC7A13	Q8TCU3	818
SLC3A1	SLC3A2	P08195	745
SLC3A1	SLC1A1	P43005	715
SLC3A1	SLC6A19	Q695T7	685
SLC3A1	CLTRN	Q9HBJ8	668
SLC3A1	SLC15A1	P46059	634
SLC3A1	SLC7A11	Q9UPY5	633

IntAct

4 interactions, top by confidence:

A	B	Type	Score
SLC3A1	SLC7A9	psi-mi:“MI:0407”(direct interaction)	0.520
SLC3A1	ILVBL	psi-mi:“MI:0914”(association)	0.350

BioGRID (108): SLC3A1 (Affinity Capture-MS), SLC3A1 (Cross-Linking-MS (XL-MS)), ADAM15 (Affinity Capture-MS), ADAMTS1 (Affinity Capture-MS), LPHN2 (Affinity Capture-MS), ATP6AP2 (Affinity Capture-MS), BTN2A1 (Affinity Capture-MS), CALR (Affinity Capture-MS), CANX (Affinity Capture-MS), CHID1 (Affinity Capture-MS), CHPF (Affinity Capture-MS), CHPF2 (Affinity Capture-MS), CHST14 (Affinity Capture-MS), CHSY3 (Affinity Capture-MS), CLGN (Affinity Capture-MS)

ESM2 similar proteins: A0A0W0FPC8, A0A1S4F0I0, A0A385MIS5, B2KKW0, C0JB47, D4AVJ0, E0XKJ9, E5D3Z8, G5ECE8, H2A0L4, H2A0L5, P29030, P36362, P41684, P49010, P86955, Q06GJ0, Q07837, Q08169, Q10737, Q11174, Q18143, Q22492, Q23997, Q2PQM6, Q2PQM7, Q2PQN0, Q4JK71, Q5AM60, Q5WMW5, Q619W7, Q64319, Q7GCM7, Q86R84, Q8I914, Q8L5C6, Q8L7S6, Q8MLZ7, Q8MM24, Q8MX31

Diamond homologs: A0R6E0, B0XAA1, O05242, O06458, O06994, O13996, O16098, O16099, O42918, O52520, O86959, P07190, P07191, P07192, P0C1B3, P0C1B4, P13080, P14899, P20845, P27937, P29093, P29094, P30292, P52980, P53051, P72235, P9WQ18, P9WQ19, Q02905, Q02906, Q07837, Q08806, Q17058, Q45101, Q54796, Q59832, Q59905, Q64319, Q7PYT9, Q91WV7

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
PAX8	“up-regulates quantity by expression”	SLC3A1	“transcriptional regulation”

Disease & clinical

Clinical variants and AI predictions

ClinVar

513 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	59
Likely pathogenic	46
Uncertain significance	257
Likely benign	73
Benign	27

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1064450	NM_000341.4(SLC3A1):c.342_346dup (p.Asp116delinsAlaTer)	Pathogenic
1064456	NM_000341.4(SLC3A1):c.916A>T (p.Lys306Ter)	Pathogenic
1066532	NC_000002.11:g.(?44508506)(44541110_?)del	Pathogenic
1179117	GRCh37/hg19 2p21(chr2:44527089-44541110)	Pathogenic
1179158	GRCh37/hg19 2p21(chr2:44507834-44508700)	Pathogenic
1457004	NM_000341.4(SLC3A1):c.1592C>G (p.Ser531Ter)	Pathogenic
1457305	NM_000341.4(SLC3A1):c.670C>T (p.Gln224Ter)	Pathogenic
1469318	NM_000341.4(SLC3A1):c.1366C>A (p.Arg456Ser)	Pathogenic
1508324	NM_000341.4(SLC3A1):c.638C>G (p.Pro213Arg)	Pathogenic
155566	GRCh38/hg38 2p21(chr2:44307367-44316296)x0	Pathogenic
18118	NM_000341.4(SLC3A1):c.542G>A (p.Arg181Gln)	Pathogenic
18121	NG_008233.1:g.17226_17227[ins17227_48142;GTTTGCATAGGCACAGAATGTAT]	Pathogenic
1975826	NM_000341.4(SLC3A1):c.1136+1G>T	Pathogenic
2041060	NC_000002.12:g.44304143del	Pathogenic
2203058	NM_000341.4(SLC3A1):c.1307dup (p.Glu437fs)	Pathogenic
2422931	NC_000002.11:g.(?44507835)(44508700_?)del	Pathogenic
2422933	NC_000002.11:g.(?44527090)(44528286_?)del	Pathogenic
2422936	NC_000002.11:g.(?44527090)(44541110_?)del	Pathogenic
2581131	NM_000341.4(SLC3A1):c.1431_1434dup (p.Tyr479fs)	Pathogenic
2636765	NM_000341.4(SLC3A1):c.1108C>T (p.Gln370Ter)	Pathogenic
2734175	NM_000341.4(SLC3A1):c.1011G>A (p.Pro337=)	Pathogenic
2755673	NM_000341.4(SLC3A1):c.774_775del (p.Tyr259fs)	Pathogenic
284275	NM_000341.4(SLC3A1):c.1500+1G>T	Pathogenic
2855712	NM_000341.4(SLC3A1):c.620T>G (p.Leu207Ter)	Pathogenic
3046942	NM_000341.4(SLC3A1):c.1221dup (p.Pro408fs)	Pathogenic
3247120	NC_000002.11:g.(?44502646)(44503124_?)del	Pathogenic
3247121	NC_000002.11:g.(?44502646)(44508700_?)del	Pathogenic
3247122	NC_000002.11:g.(?44502646)(44531497_?)del	Pathogenic
3359151	NM_000341.4(SLC3A1):c.664del (p.Trp222fs)	Pathogenic
3359159	NM_000341.4(SLC3A1):c.1158T>A (p.Tyr386Ter)	Pathogenic

SpliceAI

1839 predictions. Top by Δscore:

Variant	Effect	Δscore
2:44275933:A:T	donor_gain	1.0000
2:44275944:G:GT	donor_gain	1.0000
2:44275964:AGGT:A	donor_loss	1.0000
2:44275965:GGTAC:G	donor_loss	1.0000
2:44275967:T:G	donor_loss	1.0000
2:44280710:CTTCA:C	acceptor_loss	1.0000
2:44280712:TCA:T	acceptor_loss	1.0000
2:44280713:CAGGT:C	acceptor_loss	1.0000
2:44280714:A:AG	acceptor_gain	1.0000
2:44280714:AGG:A	acceptor_loss	1.0000
2:44280715:G:GG	acceptor_gain	1.0000
2:44280891:TAAAG:T	donor_gain	1.0000
2:44280892:AAAG:A	donor_gain	1.0000
2:44280893:AAG:A	donor_gain	1.0000
2:44280894:AG:A	donor_gain	1.0000
2:44280894:AGGT:A	donor_loss	1.0000
2:44280895:GG:G	donor_gain	1.0000
2:44280896:G:GG	donor_gain	1.0000
2:44286028:CCA:C	acceptor_loss	1.0000
2:44286029:CAGT:C	acceptor_loss	1.0000
2:44286030:A:AG	acceptor_gain	1.0000
2:44286030:A:T	acceptor_loss	1.0000
2:44286031:G:GG	acceptor_gain	1.0000
2:44286031:G:GT	acceptor_loss	1.0000
2:44286031:GTT:G	acceptor_gain	1.0000
2:44286031:GTTA:G	acceptor_gain	1.0000
2:44286031:GTTAA:G	acceptor_gain	1.0000
2:44286155:AAAGT:A	donor_loss	1.0000
2:44286156:AA:A	donor_gain	1.0000
2:44286157:AGT:A	donor_loss	1.0000

AlphaMissense

4594 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
2:44313867:G:C	W511C	0.994
2:44313867:G:T	W511C	0.994
2:44313889:T:C	F519L	0.994
2:44313891:T:A	F519L	0.994
2:44313891:T:G	F519L	0.994
2:44286056:T:A	W264R	0.993
2:44286056:T:C	W264R	0.993
2:44301085:G:C	R365P	0.992
2:44313865:T:A	W511R	0.992
2:44313865:T:C	W511R	0.992
2:44275889:G:C	W118C	0.990
2:44275889:G:T	W118C	0.990
2:44281443:T:C	F223L	0.989
2:44281445:T:A	F223L	0.989
2:44281445:T:G	F223L	0.989
2:44281452:A:C	S226R	0.989
2:44281454:T:A	S226R	0.989
2:44281454:T:G	S226R	0.989
2:44286058:G:C	W264C	0.987
2:44286058:G:T	W264C	0.987
2:44281539:T:A	W255R	0.986
2:44281539:T:C	W255R	0.986
2:44286053:A:C	S263R	0.985
2:44286055:T:A	S263R	0.985
2:44286055:T:G	S263R	0.985
2:44304333:T:A	W443R	0.985
2:44304333:T:C	W443R	0.985
2:44312668:T:C	L472P	0.985
2:44281493:G:C	W239C	0.984
2:44281493:G:T	W239C	0.984

dbSNP variants (sampled 300 via entrez): RS1000076539 (2:44285242 A>G), RS1000088685 (2:44282569 C>T), RS1000117266 (2:44297722 T>A), RS1000124572 (2:44282318 C>A), RS1000155532 (2:44282152 G>A), RS1000231268 (2:44317724 T>C), RS1000252533 (2:44317560 C>T), RS1000423905 (2:44317746 C>G), RS1000444426 (2:44288041 T>A), RS1000484730 (2:44293093 A>G), RS1000495071 (2:44305333 G>T), RS1000505300 (2:44302187 C>G), RS1000593642 (2:44313231 C>T), RS1000666037 (2:44277750 T>A), RS1000692638 (2:44309029 G>T)

Disease associations

OMIM: gene MIM:104614 | disease phenotypes: MIM:220100

GenCC curated gene-disease

Disease	Classification	Inheritance
cystinuria	Definitive	Autosomal recessive
cystinuria type A	Supportive	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
cystinuria	Definitive	AR

Mondo (6): cystinuria (MONDO:0009067), kidney disorder (MONDO:0005240), autism spectrum disorder (MONDO:0005258), nephrocalcinosis (MONDO:0001567), nephrolithiasis (MONDO:0008171), cystinuria type A (MONDO:0019745)

Orphanet (2): Cystinuria (Orphanet:214), NON RARE IN EUROPE: Autism (Orphanet:106)

HPO phenotypes

32 total (30 of 32 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000007	Autosomal recessive inheritance
HP:0000010	Recurrent urinary tract infections
HP:0000083	Renal insufficiency
HP:0000135	Hypogonadism
HP:0000268	Dolichocephaly
HP:0000278	Retrognathia
HP:0000286	Epicanthus
HP:0000358	Posteriorly rotated ears
HP:0000508	Ptosis
HP:0000527	Long eyelashes
HP:0000787	Nephrolithiasis
HP:0001250	Seizure
HP:0001252	Hypotonia
HP:0001263	Global developmental delay
HP:0001508	Failure to thrive
HP:0001510	Growth delay
HP:0001558	Decreased fetal movement
HP:0001611	Hypernasal speech
HP:0001943	Hypoglycemia
HP:0002007	Frontal bossing
HP:0002342	Moderate intellectual disability
HP:0002591	Polyphagia
HP:0002901	Hypocalcemia
HP:0003128	Lactic acidosis
HP:0003131	Cystinuria
HP:0003268	Argininuria
HP:0003297	Hyperlysinuria
HP:0003532	Ornithinuria
HP:0005280	Depressed nasal bridge

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST003341_14	antipsychotic drug dosage in schizophrenia or schizoaffective disorder	5.000000e-06
GCST010002_389	Refractive error	3.000000e-26

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0007792	antipsychotic drug use measurement

MeSH disease descriptors (5)

Descriptor	Name	Tree numbers
D003555	Cystinuria	C12.050.351.968.419.815.885.250; C12.200.777.419.815.885.250; C12.950.419.815.885.250; C16.320.831.885.250
D007674	Kidney Diseases	C12.050.351.968.419; C12.200.777.419; C12.950.419
D009397	Nephrocalcinosis	C12.050.351.968.419.590; C12.200.777.419.590; C12.950.419.590; C18.452.174.130.560
D053040	Nephrolithiasis	C12.050.351.968.419.600; C12.050.351.968.967.249; C12.200.777.419.600; C12.200.777.967.249; C12.950.419.600; C12.950.967.249
C565652	Cystinuria, Type A (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: transporter — SLC3 family

CTD chemical–gene interactions

36 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	affects expression, increases expression, increases methylation	3
Ethinyl Estradiol	affects expression, decreases expression	3
Tetrachlorodibenzodioxin	affects expression, increases expression	3
Cystine	affects cotreatment, increases uptake	2
Estradiol	affects cotreatment, increases expression, decreases expression	2
Phenylmercuric Acetate	affects cotreatment, decreases expression	2
Progesterone	affects cotreatment, increases expression	2
Cyclosporine	decreases expression	2
selenomethylselenocysteine	increases uptake	1
methyleugenol	increases expression	1
selenocystine	increases uptake	1
sodium arsenite	decreases expression	1
CGP 52608	affects binding, increases reaction	1
entinostat	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
2-amino-3-(2-amino-2-carboxyethylsulfanyl-mercuricsulfanyl)-propionic acid	affects cotreatment, increases uptake	1
abrine	decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Zoledronic Acid	decreases expression	1
Acetaminophen	decreases expression	1
Benzo(a)pyrene	increases methylation	1
Copper	affects cotreatment, decreases expression	1
Cysteine	increases uptake	1
Endosulfan	decreases expression	1
Methionine	increases uptake	1
Methylmercury Compounds	affects transport	1
Phenobarbital	decreases expression	1
Rifampin	decreases expression	1
Selenomethionine	increases uptake	1

Cellosaurus cell lines

7 cell lines: 5 transformed cell line, 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_0E66	GM16387	Transformed cell line	Female
CVCL_0E67	GM16481	Transformed cell line	Male
CVCL_0E69	GM16483	Transformed cell line	Male
CVCL_0E70	GM16500	Transformed cell line	Female
CVCL_0E72	GM17575	Transformed cell line	Female
CVCL_D4TM	HuH7-SLC3A1-KO-c1	Cancer cell line	Male
CVCL_D4TN	HuH7-SLC3A1-KO-c2	Cancer cell line	Male

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT02125721	PHASE4	COMPLETED	Effect of Increasing Doses of Cystine Binding Thiol Drugs on Cystine Capacity in Patients With Cystinuria
NCT00067990	PHASE4	COMPLETED	Angiotensin II Blockade for Chronic Allograft Nephropathy
NCT00117078	PHASE4	COMPLETED	Aranesp® Monthly Preference Study - 2
NCT00117130	PHASE4	COMPLETED	Study to Evaluate Effectiveness of Aranesp®
NCT00132431	PHASE4	COMPLETED	START: Sensipar Treatment Algorithm to Reach K/DOQI Targets in Chronic Kidney Disease Subjects With Secondary Hyperparathyroidism
NCT00140985	PHASE4	COMPLETED	Antiproteinuric Efficacy of Losartan Potassium in Patients With Non-Diabetic Proteinuric Renal Diseases (0954-213)
NCT00246129	PHASE4	COMPLETED	CamTac Trial:Campath-Tacrolimus vs IL2R MoAb/Tacrolimus/MMF in Renal Transplantation
NCT00275535	PHASE4	COMPLETED	The Comparison of Tacrolimus and Sirolimus Immunosuppression Based Drug Regimens in Kidney Transplant Recipients
NCT00282217	PHASE4	COMPLETED	Study Evaluating Sirolimus in the Treatment of Kidney Transplant
NCT00289614	PHASE4	COMPLETED	Patients With Renal Impairment and Diabetes Undergoing Computed Tomography (CT)
NCT00290069	PHASE4	UNKNOWN	Renal Function Optimization With Mycophenolate Mofetil (MMF) Immunosuppressor Regimes (ALHAMBRA)
NCT00338468	PHASE4	TERMINATED	A Study to Assess Disability in Anemic Elderly Patients With Kidney Disease Receiving PROCRIT (Epoetin Alfa)
NCT00368901	PHASE4	COMPLETED	STAAR-2 Clinical Study
NCT00369733	PHASE4	COMPLETED	STAAR-3 Clinical Study
NCT00369772	PHASE4	COMPLETED	STAAR-1 Clinical Study
NCT00379899	PHASE4	COMPLETED	ADVANCE: Study to Evaluate Cinacalcet Plus Low Dose Vitamin D on Vascular Calcification in Subjects With Chronic Kidney Disease Receiving Hemodialysis
NCT00443508	PHASE4	UNKNOWN	Reduction or Discontinuation of CNI’s With Conversion to Everolimus-Based Immunosuppresion
NCT00452478	PHASE4	TERMINATED	Conversion From Standard Phosphate Binder Therapy to Fosrenol® (Lanthanum Carbonate) in Chronic Kidney Disease Stage 5
NCT00492518	PHASE4	COMPLETED	Acetylcysteine, Theophylline, and a Combination of Both in the Prophylaxis of Contrast-Induced Nephropathy
NCT00505102	PHASE4	UNKNOWN	Safe Renal Function In Long Term Heart Transplanted Patients
NCT00526331	PHASE4	COMPLETED	Evaluation of Arterial Pressure Based Cardiac Output for Goal-Directed Perioperative Therapy
NCT00688480	PHASE4	COMPLETED	Do Xanthine Oxidase Inhibitors Reduce Both Left Ventricular Hypertrophy and Endothelial Dysfunction in Cardiovascular Patients With Renal Dysfunction?
NCT00863707	PHASE4	COMPLETED	A Study of the Safety and Tolerance of Regadenoson in Subjects With Renal Impairment
NCT01101698	PHASE4	UNKNOWN	Vitamin K2 and Vessel Calcification in Chronic Kidney Disease Patients
NCT01150201	PHASE4	COMPLETED	Aliskiren Combined With Losartan in Proteinuric, Non-diabetic Chronic Kidney Disease
NCT01155141	PHASE4	COMPLETED	Idiopathic Focal Segmental Glomerulosclerosis (FSGS) and Treatment With ACTH
NCT01228279	PHASE4	COMPLETED	Sympathetic Activity in Patients With End-stage Renal Disease on Peritoneal Dialysis
NCT01334333	PHASE4	COMPLETED	Comparison of Medication Adherence Between Once and Twice Daily Tacrolimus in Stable Renal Transplant Recipients
NCT01437943	PHASE4	TERMINATED	Effect of Short Term Aliskiren Treatment in Kidney Transplant Patients
NCT01545479	PHASE4	COMPLETED	Increased Renal Oxygenation and Angiotensin Converting Enzyme Inhibition
NCT01614431	PHASE4	COMPLETED	N Acetyl Cysteine for Cystinosis Patients
NCT01631149	PHASE4	COMPLETED	Effect of Deep BLock on Intraoperative Surgical Conditions
NCT01722513	PHASE4	UNKNOWN	Efficacy and Safety of Alprostadil Prevent Contrast Induced Nephropathy
NCT01985360	PHASE4	COMPLETED	ISCHEMIA-Chronic Kidney Disease Trial
NCT02311010	PHASE4	UNKNOWN	Practical Use of Advagraf de Novo After Kidney Transplantation According to Recipient Genetic Polymorphism
NCT02413073	PHASE4	COMPLETED	Whole Body Vibration in Kidney Disease
NCT02444013	PHASE4	UNKNOWN	Folic Acid for Prevention of Contrast Induced Nephropathy
NCT02663713	PHASE4	COMPLETED	A Randomized, Pharmacodynamic Comparison of Low Dose Ticagrelor to Clopidogrel in Patients With Prior Myocardial Infarction
NCT02707809	PHASE4	COMPLETED	Effects of Dexmedetomidine on Microcirculation of Kidney Transplant Recipient
NCT02761577	PHASE4	COMPLETED	A Prospective Study on Incidence and Prevention of Contrast-induced Nephropathy in Croatia