SLC45A1

Summary

SLC45A1 (solute carrier family 45 member 1, HGNC:17939) is a protein-coding gene on chromosome 1p36.23, encoding Proton-associated sugar transporter A (Q9Y2W3). Proton-associated glucose transporter in the brain.

This gene was isolated initially from a region on chromosome 1p that is frequently deleted in human neuroblastoma, although no causal relationship has since been demonstrated. The encoded protein belongs to the glycoside-pentoside-hexuronide cation symporter transporter family and may play a role in glucose uptake.

Source: NCBI Gene 50651 — RefSeq curated summary.

At a glance

• Gene–disease (curated): intellectual developmental disorder with neuropsychiatric features (Strong, GenCC) — +1 more curated relationship
• GWAS associations: 25
• Clinical variants (ClinVar): 226 total — 1 likely-pathogenic
• Phenotypes (HPO): 15
• MANE Select transcript: NM_001080397

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:17939
Approved symbol	SLC45A1
Name	solute carrier family 45 member 1
Location	1p36.23
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000162426
Ensembl biotype	protein_coding
OMIM	605763
Entrez	50651

Gene structure

Transcript identifiers

Ensembl transcripts: 6 — 4 protein_coding, 1 protein_coding_CDS_not_defined, 1 retained_intron

ENST00000289877, ENST00000471889, ENST00000481265, ENST00000497660, ENST00000876632, ENST00000876633

RefSeq mRNA: 6 — MANE Select: NM_001080397 NM_001080397, NM_001379614, NM_001379615, NM_001379616, NM_001379617, NM_001379618

CCDS: CCDS30577

Canonical transcript exons

ENST00000471889 — 9 exons

Exon	Start	End
ENSE00001065058	8330209	8330936
ENSE00001474059	8325818	8326042
ENSE00001474060	8325298	8325390
ENSE00001853612	8343747	8344165
ENSE00001895492	8318114	8318186
ENSE00003496041	8339493	8339698
ENSE00003533576	8324306	8324726
ENSE00003551212	8335437	8335590
ENSE00003658326	8337816	8337992

Expression profiles

Bgee: expression breadth ubiquitous, 167 present calls, max score 93.55.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 4.4293 / max 90.6709, expressed in 1119 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
466	4.0975	1072
467	0.3318	160

Top tissues by expression

249 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	93.55	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	92.39	gold quality
prefrontal cortex	UBERON:0000451	85.95	gold quality
right frontal lobe	UBERON:0002810	85.00	gold quality
right hemisphere of cerebellum	UBERON:0014890	84.29	gold quality
Brodmann (1909) area 9	UBERON:0013540	83.96	gold quality
cerebellar hemisphere	UBERON:0002245	83.17	gold quality
cerebellar cortex	UBERON:0002129	83.08	gold quality
middle temporal gyrus	UBERON:0002771	83.05	silver quality
Brodmann (1909) area 23	UBERON:0013554	82.93	silver quality
frontal cortex	UBERON:0001870	82.82	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	82.48	gold quality
neocortex	UBERON:0001950	82.45	gold quality
primary visual cortex	UBERON:0002436	82.31	gold quality
anterior cingulate cortex	UBERON:0009835	82.18	gold quality
cortical plate	UBERON:0005343	81.97	gold quality
cerebellum	UBERON:0002037	81.80	gold quality
cerebral cortex	UBERON:0000956	80.44	gold quality
hypothalamus	UBERON:0001898	80.16	gold quality
adenohypophysis	UBERON:0002196	80.14	gold quality
lower esophagus muscularis layer	UBERON:0035833	80.06	gold quality
putamen	UBERON:0001874	79.98	gold quality
lower esophagus	UBERON:0013473	79.95	gold quality
caudate nucleus	UBERON:0001873	79.74	gold quality
endothelial cell	CL:0000115	79.59	silver quality
pituitary gland	UBERON:0000007	78.90	gold quality
nucleus accumbens	UBERON:0001882	78.75	gold quality
forebrain	UBERON:0001890	78.57	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	78.24	gold quality
brain	UBERON:0000955	78.22	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	2.81

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

4 targeting SLC45A1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-4699-3P	99.71	70.15	3142
HSA-MIR-4729	99.69	72.18	4233
HSA-MIR-3922-5P	98.77	66.53	1059

Literature-anchored findings (GeneRIF, showing 1)

• Our data strongly suggest that recessive mutations in SLC45A1 cause intellectual disability and epilepsy. SLC45A1 thus represents the second cerebral glucose transporter, in addition to GLUT1, to be involved in neurodevelopmental disability. (PMID:28434495)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	slc45a1	ENSDARG00000004302
mus_musculus	Slc45a1	ENSMUSG00000039838
rattus_norvegicus	Slc45a1	ENSRNOG00000018229
drosophila_melanogaster	Slc45-1	FBGN0035968
drosophila_melanogaster	lovit	FBGN0267429

Paralogs (3): SLC45A4 (ENSG00000022567), SLC45A3 (ENSG00000158715), SLC45A2 (ENSG00000164175)

Protein

Protein identifiers

Proton-associated sugar transporter A — Q9Y2W3 (reviewed: Q9Y2W3)

Alternative names: Deleted in neuroblastoma 5 protein, Solute carrier family 45 member 1

All UniProt accessions (1): Q9Y2W3

UniProt curated annotations — full annotation on UniProt →

Function. Proton-associated glucose transporter in the brain.

Subcellular location. Membrane.

Tissue specificity. Expressed in adult heart, brain, muscle and kidney, with very strong expression in brain. Also expressed in fetal brain, kidney and lung.

Disease relevance. Intellectual developmental disorder with neuropsychiatric features (IDDNPF) [MIM:617532] An autosomal recessive disorder characterized by moderate to severe intellectual disability, epilepsy, and variable neuropsychiatric features, such as anxiety, obsessive-compulsive behavior, and autistic features. Mild facial dysmorphism may also be present. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the glycoside-pentoside-hexuronide (GPH) cation symporter transporter (TC 2.A.2) family.

RefSeq proteins (6): NP_001073866, NP_001366543, NP_001366544, NP_001366545, NP_001366546, NP_001366547 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR011701	MFS	Family
IPR036259	MFS_trans_sf	Homologous_superfamily

Pfam: PF07690

Catalyzed reactions (Rhea), 2 shown:

• D-galactose(in) + H(+)(in) = D-galactose(out) + H(+)(out) (RHEA:29019)
• D-glucose(out) + H(+)(out) = D-glucose(in) + H(+)(in) (RHEA:69556)

UniProt features (21 total): transmembrane region 12, sequence variant 3, sequence conflict 2, chain 1, region of interest 1, compositionally biased region 1, modified residue 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9Y2W3-F1	66.26	0.30

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 497

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 74 (showing top): GOBP_CARBOHYDRATE_TRANSPORT, GOMF_PROTON_TRANSMEMBRANE_TRANSPORTER_ACTIVITY, GOBP_TRANSMEMBRANE_TRANSPORT, MARIADASON_RESPONSE_TO_BUTYRATE_SULINDAC_6, GOMF_MONOATOMIC_CATION_TRANSMEMBRANE_TRANSPORTER_ACTIVITY, GOMF_SUGAR_TRANSMEMBRANE_TRANSPORTER_ACTIVITY, GOMF_ACTIVE_TRANSMEMBRANE_TRANSPORTER_ACTIVITY, GOMF_SOLUTE_MONOATOMIC_CATION_SYMPORTER_ACTIVITY, GOMF_SOLUTE_PROTON_SYMPORTER_ACTIVITY, GOMF_SECONDARY_ACTIVE_TRANSMEMBRANE_TRANSPORTER_ACTIVITY, GOMF_SYMPORTER_ACTIVITY, GOMF_TRANSPORTER_ACTIVITY, chr1p36, MEISSNER_NPC_HCP_WITH_H3_UNMETHYLATED, MIKKELSEN_IPS_HCP_WITH_H3_UNMETHYLATED

GO Biological Process (4): galactose transmembrane transport (GO:0015757), D-glucose transmembrane transport (GO:1904659), sucrose transport (GO:0015770), transmembrane transport (GO:0055085)

GO Molecular Function (5): D-glucose:proton symporter activity (GO:0005356), sucrose:proton symporter activity (GO:0008506), galactose:proton symporter activity (GO:0015517), symporter activity (GO:0015293), transmembrane transporter activity (GO:0022857)

GO Cellular Component (1): membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
hexose transmembrane transport	2
hexose:proton symporter activity	2
disaccharide transport	1
transport	1
cellular process	1
D-glucose transmembrane transporter activity	1
carbohydrate:proton symporter activity	1
sucrose:monoatomic cation symporter activity	1
galactose transmembrane transporter activity	1
secondary active transmembrane transporter activity	1
transporter activity	1
transmembrane transport	1
cellular anatomical structure	1

Protein interactions and networks

STRING

1482 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SLC45A1	RERE	Q9P2R6	557
SLC45A1	LZIC	Q8WZA0	520
SLC45A1	DPY19L4	Q7Z388	507
SLC45A1	ERRFI1	Q9UJM3	500
SLC45A1	TMEM9B	Q9NQ34	480
SLC45A1	CCNQ	Q8N1B3	475
SLC45A1	NOC4L	Q9BVI4	469
SLC45A1	VWA7	Q9Y334	464
SLC45A1	SLC16A8	O95907	461
SLC45A1	GK5	Q6ZS86	459
SLC45A1	SLC2A7	Q6PXP3	456
SLC45A1	LRRC3	Q9BY71	446
SLC45A1	KCNK17	Q96T54	446
SLC45A1	SLC5A1	P13866	445
SLC45A1	HABP4	Q5JVS0	445

IntAct

5 interactions, top by confidence:

A	B	Type	Score
PPP1CA	SLC45A1	psi-mi:“MI:0915”(physical association)	0.370
	DENND11	psi-mi:“MI:0914”(association)	0.350
SLC45A1	TBC1D4	psi-mi:“MI:0914”(association)	0.350
FOXD3	CLUH	psi-mi:“MI:0914”(association)	0.350
SLC45A1	MYL12B	psi-mi:“MI:0914”(association)	0.350

ESM2 similar proteins: A0A125YQS6, A0A125YY03, A0A7J6K338, A1Z7R6, A4IHK6, A5K9W3, G4SDH4, J9UD11, O43306, O60266, O75387, O76269, O76343, P14773, P30804, P48768, Q01341, Q03343, Q04400, Q0C8L9, Q0VCM6, Q41706, Q4D3E8, Q4X251, Q57VW6, Q5B0V6, Q5BKX6, Q5RF58, Q5ZMT9, Q6C520, Q6CGU8, Q7Z8U2, Q8BIV7, Q8BSM7, Q8CGA3, Q8K4S3, Q8K596, Q8N370, Q93380, Q93Z75

Diamond homologs: A2X6E6, A2ZN77, B8AF63, O80605, Q03411, Q0ILJ3, Q10R54, Q39231, Q39232, Q67YF8, Q69JW3, Q6A329, Q6YK44, Q8BIV7, Q944W2, Q948L0, Q9C8X2, Q9FE59, Q9FG00, Q9LKH3, Q9Y2W3, Q9ZVK6, P58355, Q0P5V9, Q4LE88, Q5BKX6, Q8K4S3, Q9UMX9, Q8K0H7, Q95KI5, Q96JT2, O14091

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

226 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	1
Uncertain significance	138
Likely benign	67
Benign	11

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
428598	NM_001080397.3(SLC45A1):c.629C>T (p.Ala210Val)	Likely pathogenic

SpliceAI

1452 predictions. Top by Δscore:

Variant	Effect	Δscore
1:8325812:GTCCA:G	acceptor_loss	1.0000
1:8325813:TCCAG:T	acceptor_loss	1.0000
1:8325814:CCAGG:C	acceptor_loss	1.0000
1:8325815:CAG:C	acceptor_loss	1.0000
1:8325816:A:AG	acceptor_gain	1.0000
1:8325816:A:AT	acceptor_loss	1.0000
1:8325816:AG:A	acceptor_gain	1.0000
1:8325816:AGG:A	acceptor_gain	1.0000
1:8325816:AGGG:A	acceptor_gain	1.0000
1:8325817:G:A	acceptor_gain	1.0000
1:8325817:G:GC	acceptor_gain	1.0000
1:8325817:GGG:G	acceptor_gain	1.0000
1:8325817:GGGG:G	acceptor_gain	1.0000
1:8325817:GGGGC:G	acceptor_gain	1.0000
1:8326040:CAGGT:C	donor_loss	1.0000
1:8326041:AGGT:A	donor_loss	1.0000
1:8326043:G:GC	donor_loss	1.0000
1:8326044:T:G	donor_loss	1.0000
1:8330205:CCAG:C	acceptor_loss	1.0000
1:8330206:CA:C	acceptor_loss	1.0000
1:8330207:A:AC	acceptor_loss	1.0000
1:8335557:GCGC:G	donor_gain	1.0000
1:8335589:GG:G	donor_gain	1.0000
1:8335590:GG:G	donor_gain	1.0000
1:8335591:G:GG	donor_gain	1.0000
1:8337813:CA:C	acceptor_loss	1.0000
1:8337814:A:AG	acceptor_gain	1.0000
1:8337814:A:AT	acceptor_loss	1.0000
1:8337814:AG:A	acceptor_gain	1.0000
1:8337814:AGG:A	acceptor_gain	1.0000

AlphaMissense

5059 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:8324714:A:C	S163R	0.999
1:8324716:C:A	S163R	0.999
1:8324716:C:G	S163R	0.999
1:8337818:T:A	W568R	0.999
1:8337818:T:C	W568R	0.999
1:8343903:A:C	S747R	0.999
1:8343905:C:A	S747R	0.999
1:8343905:C:G	S747R	0.999
1:8337974:A:C	S620R	0.998
1:8337976:T:A	S620R	0.998
1:8337976:T:G	S620R	0.998
1:8339630:G:T	G672W	0.998
1:8324705:T:A	W160R	0.997
1:8324705:T:C	W160R	0.997
1:8325330:A:C	S178R	0.997
1:8325332:T:A	S178R	0.997
1:8325332:T:G	S178R	0.997
1:8325362:A:C	R188S	0.997
1:8325362:A:T	R188S	0.997
1:8325829:G:C	G202R	0.997
1:8330252:G:C	W287C	0.997
1:8330252:G:T	W287C	0.997
1:8330925:T:C	F512L	0.997
1:8330927:C:A	F512L	0.997
1:8330927:C:G	F512L	0.997
1:8335590:G:A	G567R	0.997
1:8335590:G:C	G567R	0.997
1:8335590:G:T	G567W	0.997
1:8337944:G:C	G610R	0.997
1:8339630:G:A	G672R	0.997

dbSNP variants (sampled 300 via entrez): RS1000021856 (1:8344585 T>C), RS1000024143 (1:8316161 G>A), RS1000029902 (1:8334421 G>A), RS1000117518 (1:8332647 G>A), RS1000173843 (1:8321888 T>G), RS1000458384 (1:8329733 T>C), RS1000577207 (1:8339178 C>T), RS1000653006 (1:8338029 G>A), RS1000671507 (1:8342952 A>T), RS1000769847 (1:8318003 G>A,C), RS1000779468 (1:8334818 A>G), RS1000805245 (1:8342500 C>T), RS1000835051 (1:8323303 C>T), RS1000944194 (1:8320676 TGTTTCTCTCTCTCTCTACACAC>T), RS1000978936 (1:8333626 G>C)

Disease associations

OMIM: gene MIM:605763 | disease phenotypes: MIM:617532

GenCC curated gene-disease

Disease	Classification	Inheritance
intellectual developmental disorder with neuropsychiatric features	Strong	Autosomal recessive
autosomal recessive non-syndromic intellectual disability	Supportive	Autosomal recessive

Mondo (2): intellectual developmental disorder with neuropsychiatric features (MONDO:0044322), autosomal recessive non-syndromic intellectual disability (MONDO:0019502)

Orphanet (0):

HPO phenotypes

15 total (15 of 15 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000233	Thin vermilion border
HP:0000316	Hypertelorism
HP:0000319	Smooth philtrum
HP:0000325	Triangular face
HP:0000494	Downslanted palpebral fissures
HP:0000708	Atypical behavior
HP:0000739	Anxiety
HP:0001250	Seizure
HP:0001263	Global developmental delay
HP:0001290	Generalized hypotonia
HP:0002342	Moderate intellectual disability
HP:0002553	Highly arched eyebrow
HP:0005280	Depressed nasal bridge
HP:0008770	Obsessive-compulsive trait

GWAS associations

25 associations (top):

Study	Trait	p-value
GCST001877_69	Autism spectrum disorder, attention deficit-hyperactivity disorder, bipolar disorder, major depressive disorder, and schizophrenia (combined)	5.000000e-07
GCST001879_3	Breast cancer	5.000000e-06
GCST002450_1	Plasma omega-6 polyunsaturated fatty acid levels (gamma-linolenic acid)	3.000000e-06
GCST002740_88	Inflammatory skin disease	8.000000e-06
GCST002874_20	Psoriasis	8.000000e-07
GCST004521_274	Autism spectrum disorder or schizophrenia	7.000000e-09
GCST004525_4	Subclinical trait of interstitial lung disease (basilar peel-core ratio of high attentuation areas on CT scan)	3.000000e-08
GCST004946_126	Schizophrenia	5.000000e-11
GCST005007_9	Strep throat	4.000000e-08
GCST005191_1	Hair shape	9.000000e-14
GCST005527_22	Psoriasis	2.000000e-08
GCST005839_23	Depression	3.000000e-08
GCST006075_1	Hair color	1.000000e-100
GCST006409_15	Allergic rhinitis	7.000000e-12
GCST006803_75	Schizophrenia	3.000000e-09
GCST006988_212	Blond vs. brown/black hair color	2.000000e-17
GCST006988_213	Blond vs. brown/black hair color	3.000000e-35
GCST006989_22	Brown vs. black hair color	5.000000e-08
GCST007004_1	Hippocampal volume in normal cognition	3.000000e-07
GCST007565_140	Morning person	6.000000e-26
GCST009600_6	Anorexia nervosa, attention-deficit/hyperactivity disorder, autism spectrum disorder, bipolar disorder, major depression, obsessive-compulsive disorder, schizophrenia, or Tourette syndrome (pleiotropy)	2.000000e-08
GCST010142_72	Fish- and plant-related diet	5.000000e-09
GCST011011_29	Youthful appearance (self-reported)	8.000000e-11
GCST90002385_599	High light scatter reticulocyte count	7.000000e-09
GCST90002386_304	High light scatter reticulocyte percentage of red cells	2.000000e-09

EFO canonical traits (7, from GWAS)

EFO ID	Trait name
EFO:0005680	omega-6 polyunsaturated fatty acid measurement
EFO:0007627	airway imaging measurement
EFO:0003924	hair color
EFO:0005035	hippocampal volume
EFO:0008328	chronotype measurement
EFO:0008111	diet measurement
EFO:0007986	reticulocyte count

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: transporter — SLC45 family of putative sugar transporters

CTD chemical–gene interactions

22 total (human), top 22 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, increases expression, increases methylation	3
bisphenol F	affects cotreatment, increases methylation	1
propionaldehyde	increases expression	1
pirinixic acid	affects binding, decreases expression, increases activity	1
bisphenol A	affects cotreatment, increases methylation, decreases methylation	1
trichostatin A	affects expression	1
ICG 001	increases expression	1
abrine	decreases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	increases expression	1
Fulvestrant	affects cotreatment, increases methylation	1
Acetaminophen	decreases expression	1
Air Pollutants	decreases expression, increases abundance	1
Arsenic	affects methylation	1
Benzo(a)pyrene	affects methylation	1
Cadmium	increases expression	1
Estradiol	increases expression	1
Phthalic Acids	increases methylation	1
Silicon Dioxide	decreases expression	1
Smoke	decreases expression	1
Thiram	decreases expression	1
Tobacco Smoke Pollution	increases expression	1
Particulate Matter	decreases expression, increases abundance	1

Cellosaurus cell lines

2 cell lines: 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_D4PA	HCT116-SLC45A1-KO-c2	Cancer cell line	Male
CVCL_D4PB	HCT116-SLC45A1-KO-c4	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.