SLC5A3

Summary

SLC5A3 (solute carrier family 5 member 3, HGNC:11038) is a protein-coding gene on chromosome 21q22.11, encoding Sodium/myo-inositol cotransporter (P53794). Electrogenic Na(+)-coupled sugar symporter that actively transports myo-inositol and its stereoisomer scyllo-inositol across the plasma membrane, with a Na(+) to sugar coupling ratio of 2:1.

Enables myo-inositol:sodium symporter activity; potassium channel regulator activity; and transmembrane transporter binding activity. Predicted to be involved in several processes, including inositol metabolic process; monosaccharide transmembrane transport; and myo-inositol import across plasma membrane. Predicted to act upstream of or within several processes, including positive regulation of protein localization to membrane; positive regulation of reactive oxygen species biosynthetic process; and regulation of respiratory gaseous exchange. Located in perinuclear region of cytoplasm and plasma membrane.

Source: NCBI Gene 6526 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• MANE Select transcript: NM_006933

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:11038
Approved symbol	SLC5A3
Name	solute carrier family 5 member 3
Location	21q22.11
Locus type	gene with protein product
Status	Approved
Aliases	SMIT, SMIT1
Ensembl gene	ENSG00000198743
Ensembl biotype	protein_coding
OMIM	600444
Entrez	6526

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000381151

RefSeq mRNA: 1 — MANE Select: NM_006933 NM_006933

CCDS: CCDS33549

Canonical transcript exons

ENST00000381151 — 2 exons

Exon	Start	End
ENSE00001487667	34094863	34106260
ENSE00001487668	34073578	34073745

Expression profiles

Bgee: expression breadth ubiquitous, 291 present calls, max score 99.83.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 96.7010 / max 2310.0496, expressed in 1828 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
188911	96.7010	1828

Top tissues by expression

295 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
renal medulla	UBERON:0000362	99.83	gold quality
choroid plexus epithelium	UBERON:0003911	99.64	gold quality
tibia	UBERON:0000979	99.10	gold quality
cartilage tissue	UBERON:0002418	98.50	gold quality
pigmented layer of retina	UBERON:0001782	97.79	gold quality
trabecular bone tissue	UBERON:0002483	97.57	gold quality
trigeminal ganglion	UBERON:0001675	97.37	gold quality
adult organism	UBERON:0007023	96.93	gold quality
dorsal root ganglion	UBERON:0000044	96.53	gold quality
visceral pleura	UBERON:0002401	96.39	gold quality
mucosa of paranasal sinus	UBERON:0005030	96.26	gold quality
nipple	UBERON:0002030	95.91	gold quality
CA1 field of hippocampus	UBERON:0003881	95.66	gold quality
nephron tubule	UBERON:0001231	95.41	gold quality
saphenous vein	UBERON:0007318	94.94	gold quality
decidua	UBERON:0002450	94.54	gold quality
blood vessel layer	UBERON:0004797	94.44	gold quality
kidney epithelium	UBERON:0004819	94.27	gold quality
seminal vesicle	UBERON:0000998	94.23	gold quality
pylorus	UBERON:0001166	94.21	gold quality
middle temporal gyrus	UBERON:0002771	94.14	gold quality
cranial nerve II	UBERON:0000941	94.11	gold quality
Brodmann (1909) area 23	UBERON:0013554	94.01	gold quality
endothelial cell	CL:0000115	93.50	gold quality
skin of hip	UBERON:0001554	93.46	gold quality
mammalian vulva	UBERON:0000997	93.14	gold quality
pleura	UBERON:0000977	93.04	gold quality
upper leg skin	UBERON:0004262	92.86	gold quality
jejunal mucosa	UBERON:0000399	92.78	gold quality
ileal mucosa	UBERON:0000331	92.75	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-CURD-135	no	1200.41
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): NFAT5

miRNA regulators (miRDB)

343 targeting SLC5A3, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6873-3P	100.00	71.42	2626
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-9-5P	100.00	72.28	2361
HSA-MIR-30A-5P	100.00	76.31	3233
HSA-MIR-30B-5P	100.00	76.29	3248
HSA-MIR-30C-5P	100.00	76.29	3248
HSA-MIR-30D-5P	100.00	76.32	3233
HSA-MIR-30E-5P	100.00	76.32	3242
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-7110-3P	100.00	73.18	2486
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-4768-5P	100.00	69.49	2861
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-4747-5P	100.00	67.90	2681
HSA-MIR-5196-5P	100.00	67.98	2761
HSA-MIR-450A-1-3P	100.00	69.33	1837
HSA-MIR-200B-3P	100.00	73.31	2693
HSA-MIR-200C-3P	100.00	73.35	2685
HSA-MIR-429	100.00	73.44	2698
HSA-MIR-196A-1-3P	99.99	72.15	2772
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-4789-3P	99.99	70.75	2484

Literature-anchored findings (GeneRIF, showing 11)

• Tumor cells silence SLC5A8 and convert pyruvate into lactate as complementary mechanisms to avoid pyruvate-induced cell death. (PMID:17178845)
• Expression and/or function of SMIT2 may be reduced in diabetes mellitus, insulin resistance and polycystic ovary syndrome causing abnormal inositol meteabolism (PMID:19032932)
• JAK2 contributes to the regulation of the myoinositol transporter SMIT. (PMID:23207989)
• A kinetic model has been generated for the transport mechanism of SMIT2 allowing insight into the transport of members of the LeuT structural family at the millisecond timescale. (PMID:24944204)
• Hypotonic stress causes a significant upregulation of SLC5A3 gene expression as detected by semiquantitative RT-PCR and Western blot analysis. (PMID:25756525)
• overexpression of the Na(+)/myo-inositol cotransporter (SMIT1) and myo-inositol supplementation enlarged intracellular PI(4,5)P2 pools, modulated several PI(4,5)P2-dependent ion channels including KCNQ2/3 channels, and attenuated the action potential firing of superior cervical ganglion neurons (PMID:27217553)
• Results show that SMIT1 is expressed in the heart. SMIT1 is able to detect increased extracellular glucose levels and triggers signaling leading to NOX2 activation and ROS production. (PMID:28128227)
• SMIT1 Modifies KCNQ Channel Function and Pharmacology by Physical Interaction with the Pore (PMID:28793216)
• Myo-Inositol Transporter SLC5A3 Associates with Degenerative Changes and Inflammation in Sporadic Inclusion Body Myositis. (PMID:32235474)
• The sodium/myo-inositol co-transporter SLC5A3 promotes non-small cell lung cancer cell growth. (PMID:35760803)
• SLC5A3 is important for cervical cancer cell growth. (PMID:37324953)

Cross-species orthologs

14 orthologs

Organism	Symbol	Gene ID
danio_rerio	slc5a3a	ENSDARG00000010376
danio_rerio	slc5a3b	ENSDARG00000077812
mus_musculus	Slc5a3	ENSMUSG00000089774
rattus_norvegicus	Slc5a3	ENSRNOG00000067988
drosophila_melanogaster	CG2187	FBGN0017448
drosophila_melanogaster	rumpel	FBGN0029950
drosophila_melanogaster	SLC5A11	FBGN0031998
drosophila_melanogaster	bumpel	FBGN0037895
drosophila_melanogaster	salt	FBGN0039872
drosophila_melanogaster	Smvt	FBGN0039873
drosophila_melanogaster	CG31262	FBGN0051262
drosophila_melanogaster	CG31668	FBGN0051668
drosophila_melanogaster	CG33124	FBGN0053124
drosophila_melanogaster	kumpel	FBGN0250757

Paralogs (12): SLC5A1 (ENSG00000100170), SLC5A4 (ENSG00000100191), SLC5A5 (ENSG00000105641), SLC5A7 (ENSG00000115665), SLC5A9 (ENSG00000117834), SLC5A6 (ENSG00000138074), SLC5A2 (ENSG00000140675), SLC5A12 (ENSG00000148942), SLC5A10 (ENSG00000154025), SLC5A11 (ENSG00000158865), SLC5A8 (ENSG00000256870), (ENSG00000293606)

Protein

Protein identifiers

Sodium/myo-inositol cotransporter — P53794 (reviewed: P53794)

Alternative names: Sodium/myo-inositol transporter 1, Solute carrier family 5 member 3

All UniProt accessions (1): P53794

UniProt curated annotations — full annotation on UniProt →

Function. Electrogenic Na(+)-coupled sugar symporter that actively transports myo-inositol and its stereoisomer scyllo-inositol across the plasma membrane, with a Na(+) to sugar coupling ratio of 2:1. Maintains myo-inositol concentration gradient that defines cell volume and fluid balance during osmotic stress, in particular in the fetoplacental unit and central nervous system. Forms coregulatory complexes with voltage-gated K(+) ion channels, allosterically altering ion selectivity, voltage dependence and gating kinetics of the channel. In turn, K(+) efflux through the channel forms a local electrical gradient that modulates electrogenic Na(+)-coupled myo-inositol influx through the transporter. Associates with KCNQ1-KCNE2 channel in the apical membrane of choroid plexus epithelium and regulates the myo-inositol gradient between blood and cerebrospinal fluid with an impact on neuron excitability. Associates with KCNQ2-KCNQ3 channel altering ion selectivity, increasing Na(+) and Cs(+) permeation relative to K(+) permeation. Provides myo-inositol precursor for biosynthesis of phosphoinositides such as PI(4,5)P2, thus indirectly affecting the activity of phosphoinositide-dependent ion channels and Ca(2+) signaling upon osmotic stress.

Subunit / interactions. Interacts with KCNQ2 (via the pore module). Interacts with KCNQ1; this interaction is direct. Forms coregulatory complexes with ion channels KCNQ2-KCNQ3 and KCNQ1-KCNE2.

Subcellular location. Apical cell membrane. Basolateral cell membrane.

Induction. Induced by hyperosmotic stress.

Similarity. Belongs to the sodium:solute symporter (SSF) (TC 2.A.21) family.

RefSeq proteins (1): NP_008864* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001734	Na/solute_symporter	Family
IPR018212	Na/solute_symporter_CS	Conserved_site
IPR038377	Na/Glc_symporter_sf	Homologous_superfamily
IPR042731	SMIT	Family

Pfam: PF00474

Catalyzed reactions (Rhea), 2 shown:

• myo-inositol(out) + 2 Na(+)(out) = myo-inositol(in) + 2 Na(+)(in) (RHEA:72987)
• scyllo-inositol(out) + 2 Na(+)(out) = scyllo-inositol(in) + 2 Na(+)(in) (RHEA:72991)

UniProt features (34 total): topological domain 13, transmembrane region 12, site 2, modified residue 2, sequence variant 2, chain 1, glycosylation site 1, sequence conflict 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P53794-F1	78.65	0.50

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (2): 24 (implicated in sodium coupling); 285 (implicated in sodium coupling)

Post-translational modifications (2): 594, 632

Glycosylation sites (1): 232

Function

Pathways and Gene Ontology

Reactome pathways

4 pathways

ID	Pathway
R-HSA-429593	Inositol transporters
R-HSA-382551	Transport of small molecules
R-HSA-425366
R-HSA-425407	SLC-mediated transmembrane transport

MSigDB gene sets: 289 (showing top): TONKS_TARGETS_OF_RUNX1_RUNX1T1_FUSION_MONOCYTE_UP, GOBP_CARBOHYDRATE_TRANSPORT, HORIUCHI_WTAP_TARGETS_DN, WANG_CLIM2_TARGETS_UP, GOBP_CIRCULATORY_SYSTEM_PROCESS, GOBP_SODIUM_ION_TRANSMEMBRANE_TRANSPORT, GOBP_POSITIVE_REGULATION_OF_REACTIVE_OXYGEN_SPECIES_BIOSYNTHETIC_PROCESS, GCM_ZNF198, GOBP_POSITIVE_REGULATION_OF_PROTEIN_LOCALIZATION, AMIT_SERUM_RESPONSE_20_MCF10A, MITSIADES_RESPONSE_TO_APLIDIN_DN, BILD_SRC_ONCOGENIC_SIGNATURE, GOBP_MONOATOMIC_CATION_TRANSPORT, GOBP_ORGANIC_HYDROXY_COMPOUND_TRANSPORT, TONKS_TARGETS_OF_RUNX1_RUNX1T1_FUSION_ERYTHROCYTE_UP

GO Biological Process (14): inositol metabolic process (GO:0006020), pentose transmembrane transport (GO:0015750), fucose transmembrane transport (GO:0015756), polyol transmembrane transport (GO:0015791), myo-inositol transport (GO:0015798), transport across blood-brain barrier (GO:0150104), positive regulation of reactive oxygen species biosynthetic process (GO:1903428), D-glucose transmembrane transport (GO:1904659), myo-inositol import across plasma membrane (GO:1904679), positive regulation of protein localization to membrane (GO:1905477), monoatomic ion transport (GO:0006811), sodium ion transport (GO:0006814), sodium ion transmembrane transport (GO:0035725), transmembrane transport (GO:0055085)

GO Molecular Function (12): myo-inositol transmembrane transporter activity (GO:0005365), myo-inositol:sodium symporter activity (GO:0005367), D-glucose:sodium symporter activity (GO:0005412), pentose transmembrane transporter activity (GO:0015146), fucose transmembrane transporter activity (GO:0015150), polyol transmembrane transporter activity (GO:0015166), potassium channel regulator activity (GO:0015459), transmembrane transporter binding (GO:0044325), protein binding (GO:0005515), symporter activity (GO:0015293), solute:sodium symporter activity (GO:0015370), transmembrane transporter activity (GO:0022857)

GO Cellular Component (5): plasma membrane (GO:0005886), membrane (GO:0016020), basolateral plasma membrane (GO:0016323), apical plasma membrane (GO:0016324), perinuclear region of cytoplasm (GO:0048471)

Reactome top-level categories

Rollup of top-2 pathways:

Category	Pathways
SLC-mediated transmembrane transport	1
Transport of small molecules	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
hexose transmembrane transport	2
organic hydroxy compound transport	2
transmembrane transport	2
polyol transmembrane transport	2
myo-inositol transport	2
transport	2
solute:sodium symporter activity	2
cellular anatomical structure	2
plasma membrane region	2
polyol metabolic process	1
monosaccharide transmembrane transport	1
vascular transport	1
positive regulation of biosynthetic process	1
reactive oxygen species biosynthetic process	1
regulation of reactive oxygen species biosynthetic process	1
positive regulation of reactive oxygen species metabolic process	1
import across plasma membrane	1
positive regulation of cellular process	1
protein localization to membrane	1
positive regulation of protein localization	1
regulation of protein localization to membrane	1
metal ion transport	1
sodium ion transport	1
monoatomic cation transmembrane transport	1
cellular process	1
polyol transmembrane transporter activity	1
myo-inositol transmembrane transporter activity	1
carbohydrate:monoatomic cation symporter activity	1
D-glucose transmembrane transporter activity	1
monosaccharide transmembrane transporter activity	1
pentose transmembrane transport	1
hexose transmembrane transporter activity	1
fucose transmembrane transport	1
transmembrane transporter activity	1
potassium channel activity	1
ion channel regulator activity	1
protein binding	1
binding	1
secondary active transmembrane transporter activity	1
sodium ion transmembrane transporter activity	1

Protein interactions and networks

STRING

959 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SLC5A3	SLC6A12	P48065	877
SLC5A3	NFAT5	O94916	783
SLC5A3	AKR1B1	P15121	741
SLC5A3	SLC2A13	Q96QE2	725
SLC5A3	MRPS6	P82932	637
SLC5A3	KCNE2	Q9Y6J6	632
SLC5A3	KCNQ2	O43526	625
SLC5A3	SLC6A6	P31641	599
SLC5A3	IMPA1	P29218	578
SLC5A3	ISYNA1	Q9NPH2	479
SLC5A3	CYBB	P04839	465
SLC5A3	GPX7	Q96SL4	434
SLC5A3	GPX2	P18283	434
SLC5A3	MIOX	Q9UGB7	426
SLC5A3	GPX6	P59796	423
SLC5A3	GPX5	O75715	423

IntAct

46 interactions, top by confidence:

A	B	Type	Score
APLNR	METTL15	psi-mi:“MI:0914”(association)	0.530
TMEM184A	SLC33A1	psi-mi:“MI:0914”(association)	0.530
NRAS	ESYT2	psi-mi:“MI:2364”(proximity)	0.480
	ESYT2	psi-mi:“MI:0914”(association)	0.350
VIPR2	C15orf61	psi-mi:“MI:0914”(association)	0.350
P2RY12	GPR89A	psi-mi:“MI:0914”(association)	0.350
OPRM1	EXOC5	psi-mi:“MI:0914”(association)	0.350
SLC37A3	CYB5R3	psi-mi:“MI:0914”(association)	0.350
SLX4	SMAP	psi-mi:“MI:0914”(association)	0.350
IQCB1	PCP4L1	psi-mi:“MI:0914”(association)	0.350
TTYH1	TMEM223	psi-mi:“MI:0914”(association)	0.350
CRELD1	TMEM223	psi-mi:“MI:0914”(association)	0.350
AVPR2	GXYLT2	psi-mi:“MI:0914”(association)	0.350
CMTM5	TMEM120B	psi-mi:“MI:0914”(association)	0.350
GPR17	TMEM120B	psi-mi:“MI:0914”(association)	0.350
PLAAT4	PLEKHG3	psi-mi:“MI:0914”(association)	0.350
GPR88	POTEF	psi-mi:“MI:0914”(association)	0.350
C5AR1	TCAF2	psi-mi:“MI:0914”(association)	0.350
VIPR2	RABGAP1L	psi-mi:“MI:0914”(association)	0.350
GCGR	GPR89A	psi-mi:“MI:0914”(association)	0.350
GPR12	TLCD2	psi-mi:“MI:0914”(association)	0.350
SLC5A6	SLC31A1	psi-mi:“MI:0914”(association)	0.350
OR4N2	EMC8	psi-mi:“MI:0914”(association)	0.350
CACNG6	TSPAN3	psi-mi:“MI:0914”(association)	0.350
SLC37A3	APOB	psi-mi:“MI:0914”(association)	0.350
C5AR1	SLC12A8	psi-mi:“MI:0914”(association)	0.350
GPR182	SLC12A8	psi-mi:“MI:0914”(association)	0.350

ESM2 similar proteins: A0A2K1ZPK4, B3MRS1, B4L7U0, B4NDL8, B9GNS0, B9NAE4, D3ZIS0, O49423, O64759, O77741, P23978, P30531, P31636, P31637, P31648, P38778, P38925, P48057, P49283, P51905, P53793, P53794, P65544, P65545, Q10177, Q10Q65, Q12078, Q21433, Q21434, Q2QN30, Q5R6J1, Q67UC7, Q695T7, Q6YSA9, Q6ZG85, Q84YJ9, Q869V1, Q8UEM1, Q91ZP4, Q92BT1

Diamond homologs: A0PJK1, A8I1B9, A8WHP3, D3ZIS0, P11170, P13866, P26429, P26430, P31636, P31637, P31639, P53790, P53791, P53792, P53793, P53794, P96169, Q28610, Q28728, Q2M3M2, Q3ZC26, Q5FY69, Q5SWY8, Q6R4Q5, Q8C3K6, Q8K0E3, Q8VDT1, Q8WWX8, Q91ZP4, Q923I7, Q9ET37, Q9JKZ2, Q9NY91, Q9Z1F2, P31448

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 68 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
G alpha (s) signalling events	5	9.6×	6e-04
G alpha (i) signalling events	6	6.2×	1e-03

GO biological processes:

GO term	Partners	Fold	FDR
adenylate cyclase-inhibiting G protein-coupled receptor signaling pathway	5	19.5×	1e-03
G protein-coupled receptor signaling pathway	10	6.5×	1e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

0 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1055 predictions. Top by Δscore:

Variant	Effect	Δscore
21:34073742:GCGG:G	donor_gain	1.0000
21:34073744:GG:G	donor_gain	1.0000
21:34073745:GG:G	donor_gain	1.0000
21:34073745:GGT:G	donor_loss	1.0000
21:34073746:G:C	donor_loss	1.0000
21:34073746:G:GG	donor_gain	1.0000
21:34073746:GTAA:G	donor_loss	1.0000
21:34073747:T:G	donor_loss	1.0000
21:34102909:G:GG	donor_gain	1.0000
21:34073741:AGCGG:A	donor_gain	0.9900
21:34073742:GCGGG:G	donor_gain	0.9900
21:34073743:CGG:C	donor_gain	0.9900
21:34073744:GGG:G	donor_gain	0.9900
21:34102905:GGCA:G	donor_gain	0.9800
21:34102906:GCA:G	donor_gain	0.9800
21:34102906:GCAG:G	donor_gain	0.9800
21:34097275:C:T	donor_gain	0.9500
21:34074359:T:A	acceptor_gain	0.9300
21:34078382:C:G	donor_gain	0.9300
21:34092439:G:GT	donor_gain	0.9300
21:34097279:T:G	donor_gain	0.9300
21:34097287:A:AG	donor_gain	0.9300
21:34097279:TTA:T	donor_gain	0.9200
21:34097284:G:GG	donor_gain	0.9100
21:34097283:A:AG	donor_gain	0.8900
21:34074808:G:GT	donor_gain	0.8800
21:34077511:A:G	donor_gain	0.8800
21:34078320:GCTT:G	acceptor_gain	0.8800
21:34077507:GT:G	donor_gain	0.8700
21:34077508:TT:T	donor_gain	0.8700

AlphaMissense

4722 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
21:34096462:A:C	S422R	1.000
21:34096464:C:A	S422R	1.000
21:34096464:C:G	S422R	1.000
21:34095316:T:C	F40L	0.999
21:34095317:T:C	F40S	0.999
21:34095318:C:A	F40L	0.999
21:34095318:C:G	F40L	0.999
21:34095353:G:A	G52D	0.999
21:34095362:T:C	L55P	0.999
21:34095375:T:A	N59K	0.999
21:34095375:T:G	N59K	0.999
21:34095382:A:C	S62R	0.999
21:34095384:T:A	S62R	0.999
21:34095384:T:G	S62R	0.999
21:34095397:G:A	G67R	0.999
21:34095397:G:C	G67R	0.999
21:34095398:G:A	G67E	0.999
21:34095401:T:C	L68P	0.999
21:34095413:G:A	G72E	0.999
21:34095425:G:A	G76E	0.999
21:34095442:T:A	W82R	0.999
21:34095442:T:C	W82R	0.999
21:34095532:T:G	Y112D	0.999
21:34095545:G:C	R116P	0.999
21:34095979:T:A	W261R	0.999
21:34095979:T:C	W261R	0.999
21:34096024:T:A	W276R	0.999
21:34096024:T:C	W276R	0.999
21:34096050:G:C	Q284H	0.999
21:34096050:G:T	Q284H	0.999

dbSNP variants (sampled 300 via entrez): RS1000064656 (21:34079990 T>C), RS1000090050 (21:34093571 A>G), RS1000156894 (21:34079854 T>G), RS1000190074 (21:34105135 G>A), RS1000196042 (21:34101557 C>G), RS1000204647 (21:34082853 T>A,C), RS1000362222 (21:34099044 A>C,G), RS1000373829 (21:34077518 A>G), RS1000517518 (21:34084485 A>G), RS1000651003 (21:34098717 A>ACTCTAACTTGACATGGCTTGGCACC), RS1000761932 (21:34078631 C>T), RS1000766232 (21:34077726 T>C), RS1000783364 (21:34076074 C>T), RS1000786137 (21:34093195 A>G), RS1000831032 (21:34105417 T>C)

Disease associations

OMIM: gene MIM:600444 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST000340_3	Myocardial infarction (early onset)	6.000000e-11
GCST010479_48	Coronary artery disease	1.000000e-10

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: transporter — Sodium myo-inositol cotransporter transporters

CTD chemical–gene interactions

54 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, decreases expression, decreases methylation	5
bisphenol A	decreases expression, increases expression	2
trichostatin A	affects cotreatment, increases expression	2
Acetaminophen	increases expression	2
Cadmium	increases abundance, increases expression, decreases expression	2
Phenylmercuric Acetate	affects cotreatment, increases expression	2
Tobacco Smoke Pollution	increases expression	2
aristolochic acid I	decreases expression	1
N-(1,3-dimethylbutyl)-N’-phenyl-p-phenylenediamine quinone	affects expression	1
triphenyl phosphate	affects expression	1
potassium chromate(VI)	affects cotreatment, decreases expression	1
hydroquinone	decreases expression	1
epigallocatechin gallate	affects cotreatment, decreases expression	1
avobenzone	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
abrine	decreases expression	1
dorsomorphin	affects cotreatment, increases expression	1
jinfukang	affects cotreatment, increases expression	1
2,3,5-trichloro-6-phenyl-(1,4)benzoquinone	decreases expression	1
Sunitinib	increases expression	1
Zoledronic Acid	decreases expression	1
Vorinostat	decreases expression	1
Air Pollutants	increases expression	1
Ethanol	increases expression	1
Amiodarone	increases expression	1
Calcitriol	increases expression	1
Carbamazepine	affects expression	1
Chenodeoxycholic Acid	affects cotreatment, increases expression	1
Cisplatin	affects cotreatment, increases expression	1
Coumestrol	increases expression	1

Cellosaurus cell lines

3 cell lines: 3 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_D4Q2	HCT116-SLC5A3-KO-c6	Cancer cell line	Male
CVCL_D4Q3	HCT116-SLC5A3-KO-c7	Cancer cell line	Male
CVCL_TN98	HAP1 SLC5A3 (-)	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.