SLURP1

Summary

SLURP1 (secreted LY6/PLAUR domain containing 1, HGNC:18746) is a protein-coding gene on chromosome 8q24.3, encoding Secreted Ly-6/uPAR-related protein 1 (P55000). Has an antitumor activity.

The protein encoded by this gene is a member of the Ly6/uPAR family but lacks a GPI-anchoring signal sequence. It is thought that this secreted protein contains antitumor activity. Mutations in this gene have been associated with Mal de Meleda, a rare autosomal recessive skin disorder. This gene maps to the same chromosomal region as several members of the Ly6/uPAR family of glycoprotein receptors.

Source: NCBI Gene 57152 — RefSeq curated summary.

At a glance

• Gene–disease (curated): mal de Meleda (Strong, GenCC) — +2 more curated relationships
• Clinical variants (ClinVar): 49 total — 12 pathogenic, 5 likely-pathogenic
• Phenotypes (HPO): 21
• Dosage sensitivity (ClinGen): haploinsufficiency autosomal recessive, triplosensitivity no evidence
• MANE Select transcript: NM_020427

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:18746
Approved symbol	SLURP1
Name	secreted LY6/PLAUR domain containing 1
Location	8q24.3
Locus type	gene with protein product
Status	Approved
Aliases	ARS, ANUP, MDM, ArsB, LY6LS, LY6-MT
Ensembl gene	ENSG00000126233
Ensembl biotype	protein_coding
OMIM	606119
Entrez	57152

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000246515

RefSeq mRNA: 1 — MANE Select: NM_020427 NM_020427

CCDS: CCDS6387

Canonical transcript exons

ENST00000246515 — 3 exons

Exon	Start	End
ENSE00000704299	142741803	142741922
ENSE00000704300	142742328	142742406
ENSE00001115334	142740949	142741276

Expression profiles

Bgee: expression breadth ubiquitous, 155 present calls, max score 99.73.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 2.7120 / max 868.5067, expressed in 143 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
95420	2.7120	143

Top tissues by expression

285 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
lower esophagus mucosa	UBERON:0035834	99.73	gold quality
skin of leg	UBERON:0001511	98.38	gold quality
esophagus mucosa	UBERON:0002469	98.24	gold quality
pharyngeal mucosa	UBERON:0000355	98.22	gold quality
penis	UBERON:0000989	98.20	gold quality
upper arm skin	UBERON:0004263	98.17	gold quality
tongue squamous epithelium	UBERON:0006919	97.68	gold quality
skin of abdomen	UBERON:0001416	97.60	gold quality
oral cavity	UBERON:0000167	97.32	gold quality
upper leg skin	UBERON:0004262	97.30	gold quality
zone of skin	UBERON:0000014	97.26	gold quality
body of tongue	UBERON:0011876	96.56	gold quality
mammalian vulva	UBERON:0000997	93.52	gold quality
gingiva	UBERON:0001828	92.63	gold quality
cervix epithelium	UBERON:0004801	92.25	gold quality
epithelium of esophagus	UBERON:0001976	91.32	gold quality
skin of hip	UBERON:0001554	90.78	gold quality
gingival epithelium	UBERON:0001949	90.78	gold quality
esophagus squamous epithelium	UBERON:0006920	90.42	gold quality
squamous epithelium	UBERON:0006914	89.99	gold quality
buccal mucosa cell	CL:0002336	89.87	gold quality
tongue	UBERON:0001723	86.04	gold quality
nipple	UBERON:0002030	85.64	gold quality
cervix squamous epithelium	UBERON:0006922	85.45	gold quality
vagina	UBERON:0000996	81.68	gold quality
esophagus	UBERON:0001043	79.97	gold quality
superior surface of tongue	UBERON:0007371	72.54	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	72.36	gold quality
oviduct epithelium	UBERON:0004804	72.26	gold quality
uterine cervix	UBERON:0000002	71.82	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	11.99

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): SOX17, STAT1

miRNA regulators (miRDB)

6 targeting SLURP1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6851-5P	100.00	65.63	1294
HSA-MIR-3689D	100.00	66.14	1181
HSA-MIR-4307	99.82	70.45	3374
HSA-MIR-6722-3P	99.45	67.62	1919
HSA-MIR-1909-3P	99.03	66.56	1662
HSA-MIR-6742-5P	96.32	64.01	869

Functional genomics

ClinGen dosage: haploinsufficiency 30 (autosomal recessive), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 39)

• Our findings indicate that the MDM type of transgressive PPK is caused by SLURP-1 mutations in patients from various origins and demonstrate allelic heterogeneity for mutations in SLURP-1. (PMID:12483299)
• Novel mutations in the gene encoding protein-SLURP-1 and 5 haplotypes in Mal de Meleda. Founder mutation, conserved cysteine residue to tyrosine (C99Y), in inbred pedigree, and a signal sequence mutation (W15R), homozygous and heterozygous. (PMID:12603845)
• Recurrent nonsense mutation, R96X, in four families of Turkish descent. These families share common ancestral haplotype at mal de Meleda locus, suggesting founder effect. (PMID:12787122)
• Identification of SLURP1 as an epidermal neurotransmitter explains the clinical phenotype of Mal de Meleda. (PMID:14506129)
• ARS Component B and its protein product SLURP1 are implicated in maintaining the physiological and structural integrity of the keratinocyte layers of the skin. (PMID:14721776)
• Mutation analysis revealed a homozygous missense mutation (G86R) in exon 3 of ARS gene of this patient (PMID:15909066)
• Biological role of SLURP-1 in the epidermis is to provide fine tuning of the physiologic regulation of keratinocyt functions through the cholinergic pathways. (PMID:16354194)
• anti-tumorigenic activities of SLURP-1 and -2 were demonstrated both in vitro and in vivo. (PMID:17643396)
• SLURP-1 participates in the regulation of gut immune functions and motility, as well as possibly playing a role in colon carcinogenesis/cancer progression. (PMID:18764860)
• these results expand the spectrum of mutations in SLURP-1 gene. (PMID:19692209)
• These findings suggest that SLURP-1 may play an important role in the control and maintenance of the periodontal ligament by protecting the periodontal ligament fibroblasts from apoptosis. (PMID:20337899)
• Those findings suggest that diminished expression of SLURP-1 in asthma attenuates its negative regulation of airway inflammation, and that perhaps changes in SLURP-1 expression could serve as a marker of airway damage in asthma. (PMID:20621062)
• Results indicate that activation of alpha(7)-nAChR by SLURP-1 leads to upregulation of NF-kappaB gene expression due to activation of the Raf-1/MEK1/ERK1/2 cascade that proceeds via two complementary signaling pathways. (PMID:20660165)
• Patients with Mal de Meleda with the homozygous SLURP-1 G86R mutation may have an impaired T-cell activation (PMID:20854438)
• The pro-oncogenic effects of tobacco nitrosamine (4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone) can be abolished, in part, by rSLURP-1 that also upregulated RUNX3. (PMID:22369755)
• mutations in SLURP1 as a cause for mal de Meleda and suggest an ancient founder effect for p.W15R in the western European population. (PMID:23290002)
• Those findings suggested that SLURP-1 and stimulus through alpha7 nicotinic ACh receptors actively controlled asthmatic condition by stimulating ciliary beating and also by suppressing airway inflammation. (PMID:23876317)
• This report further expands the spectrum of clinical phenotypes associated with mutations in SLURP1 in the Mediterranean population. (PMID:24093092)
• Palmoplantar keratoderma of the Gamborg-Nielsen type is caused by mutations in the SLURP1 gene and represents a variant of Mal de Meleda. (PMID:24604124)
• To our knowledge, the present study is the fi rst report on molecular investigation of Mal de Meleda from Libya. (PMID:24738704)
• rSLURP-1 decreased production of TNFalpha by T-cells, downregulated IL-1 beta and IL-6 secretion by macrophages, and moderately upregulated IL-10 production by both types of immunocytes (PMID:24877120)
• Results of this study suggest understand Mal de Meleda, it will be important to identify proteins that interact with mutatated SLURP1. In any such studies, it will be important to assess binding of mutant SLURP1 proteins that cause Mal de Meleda. (PMID:25919322)
• novel splice site mutation c.58+5G>T in mal de Meleda in India (PMID:26254200)
• SLURP1 participates in pathophysiology of psoriasis by regulating keratinocyte proliferation and differentiation, and by suppressing the growth of S. aureus (PMID:26474319)
• This supports the hypothesis that the antiproliferative activity of SLURP-1 is related to ‘metabotropic’ signaling pathway through alpha7-nAChR, that activates intracellular signaling cascades without opening the receptor channel. (PMID:26905431)
• This is the first mal de Meleda case of Javanese ethnicity to be documented, and the unique mutation has not previously been reported. (PMID:29023701)
• Our results are discussed in the context of recent studies on heterologously produced SLURP-1 and indicate that N-terminal extensions of SLURP-1 may affect its activity and selectivity on its targets. In this respect, synthetic SLURP-1 appears to be a better probe for structure-function studies. (PMID:29192197)
• We identified a mutation in SLURP1 in five members of a consanguineous family in Pakistan, who had Mal de Meleda. (PMID:29226984)
• These findings strongly suggest that down regulation of SLURP1 expression may be implicated in the pathogenesis of various solid tumors, particularly malignancies of squamous lineage, and thus this gene may be a squamous lineage-specific tumor suppressor. (PMID:29231248)
• SLURPs inhibit growth of epithelial cancer cells in vitro and merit further investigation as potential agents for anticancer therapy (PMID:29505672)
• SLURP1 immunostaining is significantly increased in lesional skin of psoriasis vulgaris and not in psoriasiform dermatitis, which demonstrates the role of SLURP1 in the pathogenesis of psoriasis (PMID:30395407)
• Slurp1 regulate the synthesis pathway of Triglycerides through Sfrp5 in hepatocyte steatosis model. (PMID:30879770)
• these results elucidate the beneficial effects of SLURP1 in stabilizing the Human Corneal Limbal Epithelial intercellular junctions. (PMID:31387745)
• More than 20 genes have been reported to be associated with PPKs including desmoglein 1 (DSG1) a key molecular component for epidermal adhesion and differentiation. Mal de Meleda (MDM) is a rare inherited autosomal recessive genodermatosis characterized by transgrediens PPK, associated with mutations in the secreted LY6/PLAUR domain containing 1 (SLURP1) gene. (PMID:31443639)
• Recombinant Analogue of the Human Protein SLURP-1 Inhibits the Growth of U251 MG and A172 Glioma Cells. (PMID:32894468)
• Structural Diversity and Dynamics of Human Three-Finger Proteins Acting on Nicotinic Acetylcholine Receptors. (PMID:33019770)
• Biochemical Basis of Skin Disease Mal de Meleda: SLURP-1 Mutants Differently Affect Keratinocyte Proliferation and Apoptosis. (PMID:33741389)
• Endogenous alpha7 nAChR Agonist SLURP1 Facilitates Escherichia coli K1 Crossing the Blood-Brain Barrier. (PMID:34721415)
• Identification of a novel compound heterozygous mutation and a homozygous mutation of SLURP1 in Chinese families with Mal de Meleda. (PMID:37393290)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Slurp1	ENSMUSG00000022596
rattus_norvegicus	Slurp1	ENSRNOG00000005944

Paralogs (3): CD59 (ENSG00000085063), LYPD1 (ENSG00000150551), LYPD2 (ENSG00000197353)

Protein

Protein identifiers

Secreted Ly-6/uPAR-related protein 1 — P55000 (reviewed: P55000)

Alternative names: ARS component B, ARS(component B)-81/S, Anti-neoplastic urinary protein

All UniProt accessions (1): P55000

UniProt curated annotations — full annotation on UniProt →

Function. Has an antitumor activity. Was found to be a marker of late differentiation of the skin. Implicated in maintaining the physiological and structural integrity of the keratinocyte layers of the skin. In vitro down-regulates keratinocyte proliferation; the function may involve the proposed role as modulator of nicotinic acetylcholine receptors (nAChRs) activity. In vitro inhibits alpha-7-dependent nAChR currents in an allosteric manner. In T cells may be involved in regulation of intracellular Ca(2+) signaling. Seems to have an immunomodulatory function in the cornea. The function may implicate a possible role as a scavenger receptor for PLAU thereby blocking PLAU-dependent functions of PLAUR such as in cell migration and proliferation.

Subunit / interactions. Homodimer. Interacts with PLAU. Interacts with CHRNA7.

Subcellular location. Secreted.

Tissue specificity. Granulocytes. Expressed in skin. Predominantly expressed in the granular layer of skin, notably the acrosyringium. Identified in several biological fluids such as sweat, saliva, tears, plasma and urine.

Disease relevance. Mal de Meleda (MDM) [MIM:248300] A rare autosomal recessive skin disorder, characterized by diffuse transgressive palmoplantar keratoderma with keratotic lesions extending onto the dorsa of the hands and the feet (transgrediens). Patients may have hyperhidrosis. Other features include perioral erythema, lichenoid plaques on the knees and the elbows, and nail abnormalities. The disease is caused by variants affecting the gene represented in this entry.

Induction. Regulated by retinoic acid, EGF and IFNG/IFN-gamma. Down-regulated by IL-13 in cultured human bronchial epithelial cells (related to asthmatic condition).

RefSeq proteins (1): NP_065160* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR016054	LY6_UPA_recep-like	Domain
IPR045860	Snake_toxin-like_sf	Homologous_superfamily
IPR051110	Ly-6/neurotoxin-like_GPI-ap	Family

Pfam: PF00021

UniProt features (27 total): sequence variant 9, strand 7, disulfide bond 5, sequence conflict 3, signal peptide 1, chain 1, domain 1

Structure

Experimental structures (PDB)

2 structures.

PDB	Method	Resolution (Å)
6ZZE	SOLUTION NMR
6ZZF	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P55000-F1	84.32	0.47

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Disulfide bonds (5): 25–50, 28–37, 43–73, 77–93, 94–99

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 508 (showing top): GOBP_NEGATIVE_REGULATION_OF_EPITHELIAL_CELL_PROLIFERATION, AP1_01, HORIUCHI_WTAP_TARGETS_DN, REACTOME_INNATE_IMMUNE_SYSTEM, GOBP_LYSOSOMAL_TRANSPORT, GOBP_BEHAVIOR, TGCGCANK_UNKNOWN, RODRIGUES_THYROID_CARCINOMA_POORLY_DIFFERENTIATED_UP, GOBP_VACUOLE_ORGANIZATION, GOCC_SECRETORY_GRANULE, GOBP_KERATINOCYTE_PROLIFERATION, ENK_UV_RESPONSE_KERATINOCYTE_UP, GOBP_REGULATION_OF_EPITHELIAL_CELL_MIGRATION, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, GOBP_CARBOHYDRATE_DERIVATIVE_CATABOLIC_PROCESS

GO Biological Process (8): cell activation (GO:0001775), cell adhesion (GO:0007155), locomotory behavior (GO:0007626), negative regulation of cell population proliferation (GO:0008285), negative regulation of keratinocyte proliferation (GO:0010839), negative regulation of cell migration (GO:0030336), urokinase plasminogen activator signaling pathway (GO:0038195), neuromuscular process controlling posture (GO:0050884)

GO Molecular Function (3): cytokine activity (GO:0005125), acetylcholine receptor activator activity (GO:0030549), protein binding (GO:0005515)

GO Cellular Component (3): extracellular region (GO:0005576), obsolete extracellular space (GO:0005615), extracellular exosome (GO:0070062)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular process	2
multicellular organismal process	1
behavior	1
cell population proliferation	1
regulation of cell population proliferation	1
negative regulation of cellular process	1
regulation of keratinocyte proliferation	1
keratinocyte proliferation	1
negative regulation of epithelial cell proliferation	1
cell migration	1
regulation of cell migration	1
negative regulation of cell motility	1
cell surface receptor signaling pathway	1
musculoskeletal movement	1
neuromuscular process	1
receptor ligand activity	1
acetylcholine receptor activity	1
signaling receptor activator activity	1
acetylcholine receptor regulator activity	1
binding	1
cellular anatomical structure	1
extracellular vesicle	1

Protein interactions and networks

STRING

598 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SLURP1	LYNX1	P0DP58	964
SLURP1	LYPD6	Q86Y78	953
SLURP1	LYPD1	Q8N2G4	795
SLURP1	LY6H	O94772	719
SLURP1	PLAUR	Q03405	717
SLURP1	LY6K	Q17RY6	717
SLURP1	CAPN3	P20807	689
SLURP1	SLURP2	P0DP57	688
SLURP1	TTN	Q8WZ42	638
SLURP1	GPIHBP1	Q8IV16	628
SLURP1	PATE4	P0C8F1	591
SLURP1	LYPD4	Q6UWN0	582
SLURP1	ACADVL	P49748	581
SLURP1	LYPD5	Q6UWN5	570
SLURP1	PSCA	O43653	551

IntAct

8 interactions, top by confidence:

A	B	Type	Score
SLURP1	PLAU	psi-mi:“MI:0407”(direct interaction)	0.590
SLURP1	CHRNA7	psi-mi:“MI:0915”(physical association)	0.400
SLURP1	MANBA	psi-mi:“MI:0914”(association)	0.350
SLURP1	MAN2B1	psi-mi:“MI:0914”(association)	0.350
INSR	RIMOC1	psi-mi:“MI:0914”(association)	0.350
ASXL2	OGT	psi-mi:“MI:0914”(association)	0.350

BioGRID (143): SLURP1 (Affinity Capture-MS), ARSB (Affinity Capture-MS), ITPA (Affinity Capture-MS), MICA (Affinity Capture-MS), PCSK5 (Affinity Capture-MS), FBLN1 (Affinity Capture-MS), LMLN (Affinity Capture-MS), LOXL2 (Affinity Capture-MS), NID2 (Affinity Capture-MS), DSTYK (Affinity Capture-MS), GDF11 (Affinity Capture-MS), NTN1 (Affinity Capture-MS), TUBA4A (Affinity Capture-MS), GUSB (Affinity Capture-MS), SIK3 (Affinity Capture-MS)

ESM2 similar proteins: A2VE33, A6NC86, C0STK9, H3BJG9, O55006, O55186, O57690, P05533, P0CW03, P0DP59, P0DQP7, P0DQX3, P0DUK6, P35456, P35459, P35460, P35461, P49616, P55000, P58019, P60592, P81827, P82143, P82144, P83106, Q03405, Q05588, Q14210, Q148C3, Q63317, Q6UWN5, Q6UX82, Q78CF9, Q7LZI2, Q7TQN2, Q8R2S8, Q924B5, Q9BY14, Q9CQD7, Q9D7Z7

Diamond homologs: P55000, P58019, Q6UXB3, Q9DD23, Q9Z0K7, O55186, O62680, O77541, P13987, P27274, P35459, P46657, P47777, P51447, Q00996, Q28216, Q28785, Q5R510, Q8SQ46, O43653, P0DP57, P0DP61, P57096, Q16553, Q90986

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

49 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	12
Likely pathogenic	5
Uncertain significance	20
Likely benign	6
Benign	3

Top pathogenic / likely-pathogenic (17)

Variant ID	HGVS	Classification
2504644	NM_020427.3(SLURP1):c.243C>A (p.Asp81Glu)	Pathogenic
3768003	P82S	Pathogenic
3768005	E60K	Pathogenic
3768006	C73del	Pathogenic
4599	NM_020427.3(SLURP1):c.82del (p.Cys28fs)	Pathogenic
4600	NM_020427.3(SLURP1):c.178+1G>A	Pathogenic
4601	NM_020427.3(SLURP1):c.286C>T (p.Arg96Ter)	Pathogenic
4602	NM_020427.3(SLURP1):c.256G>A (p.Gly86Arg)	Pathogenic
4603	NM_020427.3(SLURP1):c.256G>C (p.Gly86Arg)	Pathogenic
4605	NM_020427.3(SLURP1):c.43T>C (p.Trp15Arg)	Pathogenic
4606	NM_020427.3(SLURP1):c.229T>C (p.Cys77Arg)	Pathogenic
4607	NM_020427.3(SLURP1):c.296G>A (p.Cys99Tyr)	Pathogenic
2446436	NM_020427.3(SLURP1):c.111C>A (p.Cys37Ter)	Likely pathogenic
3679658	NM_020427.3(SLURP1):c.59-1G>A	Likely pathogenic
372509	NM_020427.3(SLURP1):c.240_246delinsAG (p.Asp81fs)	Likely pathogenic
4604	NM_020427.3(SLURP1):c.1A>C (p.Met1Leu)	Likely pathogenic
810319	NM_020427.3(SLURP1):c.178G>A (p.Glu60Lys)	Likely pathogenic

SpliceAI

2771 predictions. Top by Δscore:

Variant	Effect	Δscore
5:78781846:CTCTA:C	donor_loss	1.0000
5:78781847:TCTA:T	donor_loss	1.0000
5:78781848:CTAC:C	donor_loss	1.0000
5:78781849:TACC:T	donor_loss	1.0000
5:78781850:ACCT:A	donor_loss	1.0000
5:78781851:C:CA	donor_loss	1.0000
5:78781974:CCTGG:C	acceptor_loss	1.0000
5:78781975:C:CC	acceptor_gain	1.0000
5:78781976:T:C	acceptor_loss	1.0000
5:78839355:CA:C	donor_gain	1.0000
5:78955290:CTTA:C	donor_loss	1.0000
5:78955291:TTAC:T	donor_loss	1.0000
5:78955292:TA:T	donor_loss	1.0000
5:78955293:A:AC	donor_gain	1.0000
5:78955293:A:AG	donor_loss	1.0000
5:78955294:C:CC	donor_gain	1.0000
5:78964411:CTTA:C	donor_loss	1.0000
5:78964412:TTACC:T	donor_loss	1.0000
5:78964413:TACCT:T	donor_loss	1.0000
5:78964414:A:AC	donor_gain	1.0000
5:78964414:AC:A	donor_gain	1.0000
5:78964415:C:CA	donor_gain	1.0000
5:78964415:CC:C	donor_gain	1.0000
5:78964415:CCTT:C	donor_gain	1.0000
5:78964602:ATATC:A	acceptor_gain	1.0000
5:78964603:TATC:T	acceptor_gain	1.0000
5:78964604:ATC:A	acceptor_gain	1.0000
5:78964604:ATCC:A	acceptor_loss	1.0000
5:78964605:TC:T	acceptor_gain	1.0000
5:78964606:CC:C	acceptor_gain	1.0000

AlphaMissense

672 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
8:142741832:C:G	C50S	0.991
8:142741833:A:T	C50S	0.991
8:142741266:G:C	F63L	0.989
8:142741266:G:T	F63L	0.989
8:142741268:A:G	F63L	0.989
8:142741159:C:G	C99S	0.988
8:142741160:A:T	C99S	0.988
8:142741225:C:G	C77S	0.987
8:142741226:A:T	C77S	0.987
8:142741267:A:C	F63C	0.986
8:142741237:C:G	C73S	0.985
8:142741238:A:T	C73S	0.985
8:142741831:G:C	C50W	0.985
8:142741853:C:G	C43S	0.985
8:142741854:A:T	C43S	0.985
8:142741177:C:G	C93S	0.984
8:142741178:A:T	C93S	0.984
8:142741225:C:T	C77Y	0.983
8:142741907:C:G	C25S	0.982
8:142741908:A:T	C25S	0.982
8:142741159:C:T	C99Y	0.981
8:142741832:C:T	C50Y	0.980
8:142741173:G:C	C94W	0.979
8:142741158:G:C	C99W	0.978
8:142741833:A:G	C50R	0.978
8:142741871:C:G	C37S	0.978
8:142741872:A:T	C37S	0.978
8:142741174:C:G	C94S	0.977
8:142741175:A:T	C94S	0.977
8:142741224:A:C	C77W	0.977

dbSNP variants (sampled 300 via entrez): RS1000206223 (8:142740605 G>A), RS1000624562 (8:142743510 G>T), RS1000904903 (8:142742526 G>A,C,T), RS1001812630 (8:142743433 GGATGGATGGGTAAATGAATGGGA>G), RS1003416217 (8:142742216 T>A,G), RS1004015179 (8:142743404 G>A,C), RS1004470205 (8:142743186 A>G), RS1004789680 (8:142741103 G>A), RS1005212839 (8:142744135 T>A,C,G), RS1008145700 (8:142743286 G>C,T), RS1010776703 (8:142741319 G>A,C), RS1011117274 (8:142742845 C>T), RS1011149788 (8:142743141 G>A), RS1011982329 (8:142742236 C>G), RS1013001393 (8:142741358 G>A)

Disease associations

OMIM: gene MIM:606119 | disease phenotypes: MIM:248300

GenCC curated gene-disease

Disease	Classification	Inheritance
mal de Meleda	Strong	Autosomal recessive
hereditary palmoplantar keratoderma, Gamborg-Nielsen type	Supportive	Autosomal recessive
palmoplantar keratosis	Limited	Autosomal dominant

Mondo (3): mal de Meleda (MONDO:0009552), palmoplantar keratosis (MONDO:0006590), hereditary palmoplantar keratoderma, Gamborg-Nielsen type (MONDO:0009489)

Orphanet (1): Mal de Meleda (Orphanet:87503)

HPO phenotypes

21 total (21 of 21 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000975	Hyperhidrosis
HP:0000982	Palmoplantar keratoderma
HP:0001155	Abnormality of the hand
HP:0001156	Brachydactyly
HP:0001218	Autoamputation
HP:0001371	Flexion contracture
HP:0001760	Abnormal foot morphology
HP:0001808	Fragile nails
HP:0003593	Infantile onset
HP:0007390	Hyperkeratosis with erythema
HP:0007404	Nonepidermolytic palmoplantar hyperkeratosis
HP:0007447	Diffuse palmoplantar hyperkeratosis
HP:0007553	Congenital symmetrical palmoplantar keratosis
HP:0008064	Ichthyosis
HP:0010783	Erythema
HP:0011123	Inflammatory abnormality of the skin
HP:0025092	Epidermal acanthosis
HP:0031190	Superficial dermal perivascular inflammatory infiltrate
HP:0031452	Lichenoid skin lesion
HP:0033194	Perioral erythema

GWAS associations

0 associations (top):

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
C565454	Keratoderma, Palmoplantar, Norrbotten Recessive Type (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

12 total (human), top 12 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenate	decreases expression, increases abundance	1
methyllycaconitine	decreases reaction, increases abundance, increases expression	1
2-palmitoylglycerol	increases expression	1
Acetylcholine	decreases reaction, increases abundance	1
Air Pollutants	increases abundance, increases expression	1
Arsenic	decreases expression, increases abundance	1
Benzo(a)pyrene	affects methylation	1
Nitrosamines	decreases expression	1
Valproic Acid	increases methylation	1
Aflatoxin B1	decreases methylation	1
Antirheumatic Agents	decreases expression	1
Particulate Matter	increases abundance, increases expression	1

Clinical trials (associated diseases)

3 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT06561321	PHASE2	RECRUITING	Study to Evaluate the Safety and Efficacy of Tapinarof in Adults With Palmoplantar Keratoderma
NCT06545695	PHASE1/PHASE2	NOT_YET_RECRUITING	Epidermal Growth Factor Receptor Inhibition for Keratinopathies
NCT05954416	Not specified	RECRUITING	FARD (RaDiCo Cohort) (RaDiCo-FARD)