SMOX

Summary

SMOX (spermine oxidase, HGNC:15862) is a protein-coding gene on chromosome 20p13, encoding Spermine oxidase (Q9NWM0). Flavoenzyme which catalyzes the oxidation of spermine to spermidine.

Polyamines are ubiquitous polycationic alkylamines which include spermine, spermidine, putrescine, and agmatine. These molecules participate in a broad range of cellular functions which include cell cycle modulation, scavenging reactive oxygen species, and the control of gene expression. These molecules also play important roles in neurotransmission through their regulation of cell-surface receptor activity, involvement in intracellular signalling pathways, and their putative roles as neurotransmitters. This gene encodes an FAD-containing enzyme that catalyzes the oxidation of spermine to spermadine and secondarily produces hydrogen peroxide. Multiple transcript variants encoding different isoenzymes have been identified for this gene, some of which have failed to demonstrate significant oxidase activity on natural polyamine substrates. The characterized isoenzymes have distinctive biochemical characteristics and substrate specificities, suggesting the existence of additional levels of complexity in polyamine catabolism.

Source: NCBI Gene 54498 — RefSeq curated summary.

At a glance

• Gene–disease (curated): mosaic SMO syndrome (Definitive, ClinGen) — +4 more curated relationships
• GWAS associations: 59
• Clinical variants (ClinVar): 282 total — 10 pathogenic, 2 likely-pathogenic
• Phenotypes (HPO): 165
• Druggable target: yes
• MANE Select transcript: NM_175839

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:15862
Approved symbol	SMOX
Name	spermine oxidase
Location	20p13
Locus type	gene with protein product
Status	Approved
Aliases	FLJ20746, dJ779E11.1, PAO, PAOh1, MGC1010, SMO
Ensembl gene	ENSG00000088826
Ensembl biotype	protein_coding
OMIM	615854
Entrez	54498

Gene structure

Transcript identifiers

Ensembl transcripts: 31 — 26 protein_coding, 5 protein_coding_CDS_not_defined

ENST00000278795, ENST00000305958, ENST00000339123, ENST00000346595, ENST00000379460, ENST00000457205, ENST00000466004, ENST00000484515, ENST00000486998, ENST00000493223, ENST00000494098, ENST00000621355, ENST00000908987, ENST00000908988, ENST00000908989, ENST00000908990, ENST00000908991, ENST00000908992, ENST00000908993, ENST00000908994, ENST00000908995, ENST00000908996, ENST00000908997, ENST00000908998, ENST00000929649, ENST00000929650, ENST00000957318, ENST00000957319, ENST00000957320, ENST00000957321, ENST00000957322

RefSeq mRNA: 5 — MANE Select: NM_175839 NM_001270691, NM_175839, NM_175840, NM_175841, NM_175842

CCDS: CCDS13075, CCDS13076, CCDS13077, CCDS13078, CCDS74702

Canonical transcript exons

ENST00000305958 — 7 exons

Exon	Start	End
ENSE00001346935	4182089	4182848
ENSE00003496612	4177351	4177577
ENSE00003516995	4175030	4175263
ENSE00003568178	4181803	4181976
ENSE00003637211	4183494	4183654
ENSE00003843509	4187270	4187727
ENSE00003845475	4148828	4148977

Expression profiles

Bgee: expression breadth ubiquitous, 258 present calls, max score 94.66.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 12.3292 / max 280.3324, expressed in 1632 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
183256	9.6449	1579
183257	1.7693	1006
183264	0.8789	43
183263	0.0204	3
183261	0.0158	8

Top tissues by expression

287 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
amygdala	UBERON:0001876	94.66	gold quality
lower esophagus mucosa	UBERON:0035834	94.40	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	93.60	gold quality
spinal cord	UBERON:0002240	93.26	gold quality
putamen	UBERON:0001874	93.01	gold quality
substantia nigra	UBERON:0002038	92.85	gold quality
hypothalamus	UBERON:0001898	92.72	gold quality
nucleus accumbens	UBERON:0001882	92.66	gold quality
midbrain	UBERON:0001891	92.39	gold quality
monocyte	CL:0000576	92.33	gold quality
mononuclear cell	CL:0000842	92.28	gold quality
tongue squamous epithelium	UBERON:0006919	92.24	silver quality
cartilage tissue	UBERON:0002418	92.17	gold quality
caudate nucleus	UBERON:0001873	92.12	gold quality
CA1 field of hippocampus	UBERON:0003881	91.65	gold quality
right frontal lobe	UBERON:0002810	91.45	gold quality
leukocyte	CL:0000738	91.31	gold quality
temporal lobe	UBERON:0001871	91.09	gold quality
cingulate cortex	UBERON:0003027	91.09	gold quality
anterior cingulate cortex	UBERON:0009835	91.00	gold quality
Ammon’s horn	UBERON:0001954	90.97	gold quality
cranial nerve II	UBERON:0000941	90.75	gold quality
Brodmann (1909) area 9	UBERON:0013540	89.70	gold quality
pancreatic ductal cell	CL:0002079	89.66	silver quality
telencephalon	UBERON:0001893	89.40	gold quality
decidua	UBERON:0002450	89.37	gold quality
dorsal motor nucleus of vagus nerve	UBERON:0002870	89.17	gold quality
stromal cell of endometrium	CL:0002255	89.14	gold quality
ventral tegmental area	UBERON:0002691	89.12	gold quality
forebrain	UBERON:0001890	88.94	gold quality

Single-cell (SCXA)

Detected in 4 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-MTAB-10042	yes	33.36
E-ANND-3	yes	14.62
E-MTAB-9067	no	3.31
E-MTAB-9467	no	0.74

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

23 targeting SMOX, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4531	99.99	69.70	3181
HSA-MIR-6721-5P	99.93	68.92	2981
HSA-MIR-4493	99.90	66.48	977
HSA-MIR-124-3P	99.89	73.74	3043
HSA-MIR-506-3P	99.89	73.55	3057
HSA-MIR-605-3P	99.88	69.22	1833
HSA-MIR-139-5P	99.80	69.50	1399
HSA-MIR-3714	99.71	70.74	2671
HSA-MIR-6126	99.62	68.09	996
HSA-MIR-4516	99.61	67.78	3390
HSA-MIR-940	99.37	66.14	2064
HSA-MIR-6893-5P	99.31	66.25	2119
HSA-MIR-6808-5P	99.31	66.23	2150
HSA-MIR-4254	99.11	65.15	1315
HSA-MIR-4434	99.10	67.01	1984
HSA-MIR-5703	99.10	67.09	2053
HSA-MIR-1286	99.09	66.23	1046
HSA-MIR-423-5P	98.69	67.48	1522
HSA-MIR-3184-5P	98.56	67.13	1491
HSA-MIR-6864-5P	98.38	66.59	1079
HSA-MIR-6847-5P	97.93	66.74	1808
HSA-MIR-4733-5P	97.75	67.44	866
HSA-MIR-3918	96.13	64.65	1300

Literature-anchored findings (GeneRIF, showing 21)

• There are at least four isoenzymes of human PAO, each with different biochemical characteristics and roles in polyamine catabolism (PMID:12398765)
• The results of these studies are consistent with the hypothesis that polyamine oxidase 1 (PAOh1/SMO) represents a new addition to the polyamine metabolic pathway. (PMID:12727196)
• SSAT and SMO(PAOh1) activities are the major mediators of the cellular response of breast tumor cells to polyamines while PAO plays little or no role in this response (PMID:16207710)
• Tissues from patients with prostate cancer and prostatic intraepithelial neoplasia exhibit increased spermine oxidase expression. (PMID:18302221)
• analysis of nuclear localization of human spermine oxidase isoforms (PMID:18422650)
• Knockdown studies suggest that induction of SSAT and SMO is correlated with the antiproliferative effects of BENSpm with 5-FU or paclitaxel in MDA-MB-231 cells. (PMID:19727732)
• Fully protonated forms of the inhibitors and the unprotonated form of an amino acid residue with a pK(a) of approximately 7.4 in the active site are preferred for binding. (PMID:20000632)
• the genetic and epigenetic factors examined in this study show little influence on the expression level of SMOX in suicide completers. (PMID:20059804)
• Increased expression of spermine oxidase is associated with ulcerative colitis. (PMID:20127992)
• Spermine oxidase (SMO) has a role in response to BENSpm and CPENSpm in breast tumor cells (PMID:20946629)
• each gene was associated with at least one main outcome: anxiety (SAT1, SMS), mood disorders (SAT1, SMOX), and suicide attempts (SAT1, OATL1). (PMID:21152090)
• Spermine oxidase mediates the gastric cancer risk associated with Helicobacter pylori CagA. (PMID:21839041)
• Tat was found to induce reactive oxygen species production and to affect cell viability in SH-SY5Y cells, these effects being mediated by spermine oxidase (SMO) (PMID:23665428)
• study postulates a mechanism for SAT1 and SMOX down-regulation by post-transcriptional activity of miRNAs. (PMID:24025154)
• During H. pylori infection, the enzyme spermine oxidase (SMOX) is induced, which generates hydrogen peroxide from the catabolism of the polyamine spermine, and increases gastric cancer risk. (PMID:25174398)
• effect of Tat on Nrf2 activation in human neuroblastoma cells and the role of NMDA receptor and spermine oxidase on Tat-induced nuclear factor erythroid 2-related factor 2 (Nrf2) activation (PMID:26895301)
• These results indicate a protective role for miR-124 through the inhibition of SMOX-mediated DNA damage in the etiology of H. pylori-associated gastric cancer. (PMID:27041578)
• SMOX plays a central role in the formation of bile canalicular lumen in liver cells by activating Akt pathway through acrolein production. (PMID:29093526)
• Data suggest that intermolecular disulfide bond links spermine oxidase (SMOX) molecules to form the homodimer and plays a critical role in the stabilization of the overall three-dimensional SMOX structure. (PMID:29138259)
• Genetic regulation of spermine oxidase activity and cancer risk: a Mendelian randomization study. (PMID:34465810)
• Protective Role of Spermidine in Colitis and Colon Carcinogenesis. (PMID:34767785)

Cross-species orthologs

13 orthologs

Organism	Symbol	Gene ID
danio_rerio	smox	ENSDARG00000036967
mus_musculus	Smox	ENSMUSG00000027333
rattus_norvegicus	Smox	ENSRNOG00000021255
rattus_norvegicus	RGD1564480	ENSRNOG00000059641
drosophila_melanogaster	CG10561	FBGN0002036
drosophila_melanogaster	CG7737	FBGN0033584
drosophila_melanogaster	CG5653	FBGN0035943
drosophila_melanogaster	CG7460	FBGN0036749
drosophila_melanogaster	CG6034	FBGN0036750
drosophila_melanogaster	CG8032	FBGN0037606
caenorhabditis_elegans		WBGENE00000137
caenorhabditis_elegans	spr-5	WBGENE00005010
caenorhabditis_elegans		WBGENE00011615

Paralogs (7): KDM1A (ENSG00000004487), MAOB (ENSG00000069535), IL4I1 (ENSG00000104951), PPOX (ENSG00000143224), PAOX (ENSG00000148832), KDM1B (ENSG00000165097), MAOA (ENSG00000189221)

Protein

Protein identifiers

Spermine oxidase — Q9NWM0 (reviewed: Q9NWM0)

Alternative names: Polyamine oxidase 1

All UniProt accessions (2): Q9NWM0, Q5TE25

UniProt curated annotations — full annotation on UniProt →

Function. Flavoenzyme which catalyzes the oxidation of spermine to spermidine. Can also use N(1)-acetylspermine and spermidine as substrates, with different affinity depending on the isoform (isozyme) and on the experimental conditions. Plays an important role in the regulation of polyamine intracellular concentration and has the potential to act as a determinant of cellular sensitivity to the antitumor polyamine analogs. May contribute to beta-alanine production via aldehyde dehydrogenase conversion of 3-amino-propanal.

Subcellular location. Cytoplasm. Nucleus Cytoplasm. Nucleus.

Tissue specificity. Widely expressed. Expressed in human tumor cell lines. Isoform 4 is only found in an embryonal kidney cell line.

Activity regulation. Inhibited at more than 90% by SL-11144, SL-11150 and SL-11158, at concentrations less than 1 uM.

Cofactor. Binds 1 FAD per subunit.

Induction. By antitumor polyamine analogs.

Pathway. Amine and polyamine degradation; spermine degradation.

Miscellaneous. Low affinity for acetylated polyamine. Low affinity for acetylated polyamine. Major isoform. Has the highest affinity for the 3 substrates. Has a greater affinity for spermidine and spermine than for N(1)-acetylspermine. Has the lowest Km values for the different substrates and has the highest affinity for spermidine. Does not seem to display oxidase activity towards spermidine or N(1)-acetyl-spermine, but this has to be confirmed. Substrate specificities and affinities comparable to those of isoform 1.

Similarity. Belongs to the flavin monoamine oxidase family.

Isoforms (6)

UniProt ID	Names	Canonical?
Q9NWM0-1	1, PAOh1, SMO	yes
Q9NWM0-2	2, PAOh2
Q9NWM0-3	3, PAOh3
Q9NWM0-4	4, PAOh4
Q9NWM0-5	5
Q9NWM0-6	6, SMO5, SMOX5

RefSeq proteins (5): NP_001257620, NP_787033, NP_787034, NP_787035, NP_787036 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002937	Amino_oxidase	Domain
IPR036188	FAD/NAD-bd_sf	Homologous_superfamily
IPR050281	Flavin_monoamine_oxidase	Family

Pfam: PF01593

Enzyme classification (BRENDA):

• EC 1.5.3.16 — spermine oxidase (BRENDA: 10 organisms, 96 substrates, 53 inhibitors, 66 Km, 40 kcat entries)

Substrate kinetics (BRENDA)

20 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
SPERMINE	0.0005–0.53	32
N1-ACETYLSPERMINE	0.0016–2.125	5
NORSPERMINE	0.09–6.9	3
O2	0.0046–11	3
SPERMIDINE	0.139–2.34	3
ALPHA-METHYLSPERMINE	0.034–0.067	2
BENZYLAMIDINE	1.6	1
N,N’-BIS(3-AMINOPROPYL)ETHYLENEDIAMINE	1.898	1
N1-(3-[[(THIOPHEN-2-YL)METHYL]AMINO]PROPYL)OCTAN	1.06	1
N1-ACETYLSPERMIDINE	0.066	1
N1-BENZYLDODECANE-1,12-DIAMINE	1.99	1
N1-BENZYLSPERMINE	0.019	1
N1-[(NAPHTHALEN-2-YL)METHYL]SPERMINE	0.015	1
N1-[(PYRIDIN-2-YL)METHYL]SPERMINE	0.245	1
N1-[(THIOPHEN-2-YL)METHYL]DODECANE-1,12-DIAMINE	1.74	1

Catalyzed reactions (Rhea), 1 shown:

• spermine + O2 + H2O = 3-aminopropanal + spermidine + H2O2 (RHEA:25804)

UniProt features (68 total): strand 22, helix 16, sequence conflict 8, binding site 7, splice variant 4, turn 4, sequence variant 3, chain 1, region of interest 1, mutagenesis site 1, compositionally biased region 1

Structure

Experimental structures (PDB)

2 structures.

PDB	Method	Resolution (Å)
7OY0	X-RAY DIFFRACTION	2.09
7OXL	X-RAY DIFFRACTION	2.4

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9NWM0-F1	87.64	0.78

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (7): 35; 55; 63; 79–80; 261; 519; 528–529

Mutagenesis-validated functional residues (1):

Position	Phenotype
320	no change in enzymatic activity.

Function

Pathways and Gene Ontology

Reactome pathways

2 pathways

ID	Pathway
R-HSA-141334	PAOs oxidise polyamines to amines
R-HSA-351200	Interconversion of polyamines

MSigDB gene sets: 1064 (showing top): GOBP_CARDIAC_CHAMBER_DEVELOPMENT, GOBP_SPINAL_CORD_DEVELOPMENT, GOBP_MORPHOGENESIS_OF_AN_EPITHELIUM, GOBP_METANEPHRIC_NEPHRON_MORPHOGENESIS, GOBP_DENTATE_GYRUS_DEVELOPMENT, GOBP_HINDBRAIN_DEVELOPMENT, GOBP_EMBRYO_DEVELOPMENT_ENDING_IN_BIRTH_OR_EGG_HATCHING, GOBP_EPITHELIUM_DEVELOPMENT, REACTOME_BIOLOGICAL_OXIDATIONS, GOBP_METENCEPHALON_DEVELOPMENT, GOBP_MUSCLE_TISSUE_DEVELOPMENT, GOBP_CARDIAC_SEPTUM_DEVELOPMENT, GOBP_EPIDERMIS_MORPHOGENESIS, GOBP_AXIS_SPECIFICATION, GOBP_REGULATION_OF_MORPHOGENESIS_OF_A_BRANCHING_STRUCTURE

GO Biological Process (4): polyamine biosynthetic process (GO:0006596), polyamine catabolic process (GO:0006598), xenobiotic metabolic process (GO:0006805), spermine catabolic process (GO:0046208)

GO Molecular Function (3): polyamine oxidase activity (GO:0046592), spermine oxidase activity (GO:0052901), oxidoreductase activity (GO:0016491)

GO Cellular Component (5): nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), cytosol (GO:0005829), nuclear membrane (GO:0031965)

Reactome top-level categories

Rollup of top-2 pathways:

Category	Pathways
Amine Oxidase reactions	1
Metabolism of polyamines	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
polyamine metabolic process	2
biogenic amine biosynthetic process	1
biogenic amine catabolic process	1
metabolic process	1
cellular response to xenobiotic stimulus	1
polyamine catabolic process	1
spermine metabolic process	1
oxidoreductase activity, acting on the CH-NH group of donors, oxygen as acceptor	1
polyamine oxidase activity	1
catalytic activity	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
intracellular anatomical structure	1
cytoplasm	1
nucleus	1
nuclear envelope	1
organelle membrane	1

Protein interactions and networks

STRING

696 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SMOX	SAT1	P21673	853
SMOX	SMS	P52788	819
SMOX	SRM	P19623	776
SMOX	ODC1	P11926	755
SMOX	AZIN1	O14977	623
SMOX	OAZ2	O95190	613
SMOX	DHPS	P49366	526
SMOX	AGMAT	Q9BSE5	523
SMOX	AZIN2	Q96A70	516
SMOX	ARG2	P78540	479
SMOX	SLC22A16	Q86VW1	457
SMOX	DOHH	Q9BU89	452
SMOX	SPEF1	Q9Y4P9	451
SMOX	AOC1	P19801	443
SMOX	CYP24A1	Q07973	435

IntAct

4 interactions, top by confidence:

A	B	Type	Score
SMOX	HSPA5	psi-mi:“MI:0915”(physical association)	0.400
SMOX	PRPH	psi-mi:“MI:0915”(physical association)	0.400
SMOX	ALDH1A3	psi-mi:“MI:0914”(association)	0.350

BioGRID (17): ALDH1A3 (Affinity Capture-MS), CCT6B (Affinity Capture-MS), HERC1 (Affinity Capture-MS), CCT3 (Affinity Capture-MS), CCT2 (Affinity Capture-MS), FLNC (Affinity Capture-MS), SMOX (Affinity Capture-RNA), SMOX (Two-hybrid), SMOX (Proximity Label-MS), SMOX (Affinity Capture-RNA), ALDH1A3 (Affinity Capture-MS), CCT3 (Affinity Capture-MS), HERC1 (Affinity Capture-MS), CCT2 (Affinity Capture-MS), CCT6B (Affinity Capture-MS)

ESM2 similar proteins: A0A5F8AH41, A0AVI4, A0JMH2, A1Y9I9, A5WVX1, B0X4N1, B4P925, D3ZX08, O55171, O88512, O95050, O97972, P0DPD7, P0DPE0, P0DPE1, P10937, P10938, P11086, P40935, P40936, Q06AU9, Q08DK0, Q14CH7, Q32PE2, Q32Q92, Q3SZG9, Q3URQ7, Q568P9, Q5E9L5, Q5JTZ9, Q5RCH4, Q5RFR7, Q6NTR1, Q6NZB1, Q7QIL2, Q7TMC8, Q80YU0, Q8HY87, Q8K304, Q8NFF5

Diamond homologs: A0A024BTN9, A0A2U8QPE6, A2XDA1, A6MFL0, A8QL51, A8QL52, A8QL58, B0VXW0, B3EWI9, B5AR80, B5U6Y8, C0HJE7, C3VEP9, F8S0Z5, G8XQX1, J7H670, K9N7B7, O08615, O09046, O24164, O34363, O60341, O93364, P0C2D1, P0C2D2, P0C2D3, P0C2D4, P0C2D5, P0C2D6, P0C2D7, P0CC17, P0CJ40, P0DI84, P0DI87, P0DI88, P0DI89, P0DI91, P0DPS2, P0DQH9, P0DV78

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

282 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	10
Likely pathogenic	2
Uncertain significance	166
Likely benign	45
Benign	26

Top pathogenic / likely-pathogenic (12)

Variant ID	HGVS	Classification
245609	NM_005631.5(SMO):c.1234C>T (p.Leu412Phe)	Pathogenic
443339	GRCh37/hg19 20p13-q13.33(chr20:61569-62915555)	Pathogenic
8117	NM_005631.5(SMO):c.1604G>T (p.Trp535Leu)	Pathogenic
8118	NM_005631.5(SMO):c.1685G>A (p.Arg562Gln)	Pathogenic
975032	NM_005631.5(SMO):c.2291_2292del (p.Gln764fs)	Pathogenic
975033	NM_005631.5(SMO):c.781C>T (p.Arg261Cys)	Pathogenic
975034	NM_005631.5(SMO):c.1339G>T (p.Glu447Ter)	Pathogenic
975035	NM_005631.5(SMO):c.1727G>A (p.Arg576Gln)	Pathogenic
975036	NM_005631.5(SMO):c.1726C>T (p.Arg576Trp)	Pathogenic
975037	NM_005631.5(SMO):c.1285A>T (p.Ile429Phe)	Pathogenic
982409	NM_005631.5(SMO):c.754T>C (p.Phe252Leu)	Likely pathogenic
982410	NM_005631.5(SMO):c.1198C>T (p.Arg400Cys)	Likely pathogenic

SpliceAI

1832 predictions. Top by Δscore:

Variant	Effect	Δscore
20:4148974:AAAG:A	donor_loss	1.0000
20:4148977:GGTAC:G	donor_loss	1.0000
20:4148979:T:G	donor_loss	1.0000
20:4175028:A:AG	acceptor_gain	1.0000
20:4175029:G:GG	acceptor_gain	1.0000
20:4175259:ACTTG:A	donor_gain	1.0000
20:4175260:CTTG:C	donor_gain	1.0000
20:4175261:TTG:T	donor_gain	1.0000
20:4175261:TTGG:T	donor_loss	1.0000
20:4175262:TG:T	donor_gain	1.0000
20:4175263:GG:G	donor_gain	1.0000
20:4175264:G:GA	donor_loss	1.0000
20:4175264:G:GG	donor_gain	1.0000
20:4175265:T:A	donor_loss	1.0000
20:4177542:G:GT	donor_gain	1.0000
20:4177574:CGAG:C	donor_loss	1.0000
20:4177575:GAG:G	donor_gain	1.0000
20:4177575:GAGG:G	donor_loss	1.0000
20:4177576:AGGT:A	donor_loss	1.0000
20:4177578:G:GG	donor_gain	1.0000
20:4177579:T:A	donor_loss	1.0000
20:4181799:GCA:G	acceptor_loss	1.0000
20:4181800:CAGGT:C	acceptor_loss	1.0000
20:4181801:AGGT:A	acceptor_loss	1.0000
20:4181802:G:C	acceptor_loss	1.0000
20:4181974:AAGG:A	donor_loss	1.0000
20:4181975:AGGT:A	donor_loss	1.0000
20:4181976:GGTAT:G	donor_loss	1.0000
20:4181977:G:GC	donor_loss	1.0000
20:4181978:T:A	donor_loss	1.0000

AlphaMissense

3641 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
20:4182758:T:A	W427R	0.999
20:4182758:T:C	W427R	0.999
20:4183538:T:A	W472R	0.999
20:4183538:T:C	W472R	0.999
20:4187286:T:C	F516S	0.999
20:4187331:G:A	G531D	0.999
20:4175242:C:A	R63S	0.998
20:4177380:T:A	W80R	0.998
20:4177380:T:C	W80R	0.998
20:4177386:C:G	H82D	0.998
20:4177403:C:A	N87K	0.998
20:4177403:C:G	N87K	0.998
20:4182152:T:A	W225R	0.998
20:4182152:T:C	W225R	0.998
20:4182261:T:A	V261D	0.998
20:4182580:G:C	K367N	0.998
20:4182580:G:T	K367N	0.998
20:4182588:T:C	L370P	0.998
20:4182750:T:C	L424P	0.998
20:4182760:G:C	W427C	0.998
20:4182760:G:T	W427C	0.998
20:4183540:G:C	W472C	0.998
20:4183540:G:T	W472C	0.998
20:4187295:A:T	E519V	0.998
20:4187346:G:A	G536D	0.998
20:4175162:G:A	G36D	0.997
20:4177371:G:A	G77R	0.997
20:4177371:G:C	G77R	0.997
20:4177372:G:A	G77E	0.997
20:4177384:T:C	I81T	0.997

dbSNP variants (sampled 300 via entrez): RS1000030121 (20:4166591 C>A,G), RS1000065137 (20:4181429 TA>T), RS1000094963 (20:4156624 C>G,T), RS1000264299 (20:4148771 A>G), RS1000272354 (20:4150988 C>T), RS1000286157 (20:4161315 G>A), RS1000293789 (20:4171907 T>C), RS1000449035 (20:4184394 G>A), RS1000557228 (20:4178509 T>A,G), RS1000575198 (20:4164352 ACATCTGGCTCTGGGATAAGC>A), RS1000729795 (20:4166079 G>A), RS1000799654 (20:4172591 G>T), RS1000980760 (20:4172345 G>T), RS1001001982 (20:4155630 A>G), RS1001050405 (20:4155108 C>A)

Disease associations

OMIM: gene MIM:615854 | disease phenotypes: MIM:241800, MIM:601707, MIM:605462

GenCC curated gene-disease

Disease	Classification	Inheritance
Curry-Jones syndrome	Definitive	Autosomal dominant
congenital hypothalamic hamartoma syndrome	Strong	Autosomal recessive
Hirschsprung disease	Supportive	Autosomal dominant
medulloblastoma	Limited	Autosomal dominant

ClinGen Gene-Disease Validity (2)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
congenital hypothalamic hamartoma syndrome	Moderate	AR
mosaic SMO syndrome	Definitive	AD

Mondo (7): congenital hypothalamic hamartoma syndrome (MONDO:0009436), Curry-Jones syndrome (MONDO:0011134), basal cell carcinoma, susceptibility to, 1 (MONDO:0011556), coloboma (MONDO:0001476), microcephaly (MONDO:0001149), medulloblastoma (MONDO:0007959), Hirschsprung disease (MONDO:0018309)

Orphanet (3): Curry-Jones syndrome (Orphanet:1553), OBSOLETE: Ocular coloboma (Orphanet:194), Congenital hypothalamic hamartoma syndrome (Orphanet:2113)

HPO phenotypes

165 total (30 of 165 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000020	Urinary incontinence
HP:0000044	Hypogonadotropic hypogonadism
HP:0000054	Micropenis
HP:0000110	Renal dysplasia
HP:0000141	Amenorrhea
HP:0000161	Median cleft upper lip
HP:0000171	Microglossia
HP:0000175	Cleft palate
HP:0000238	Hydrocephalus
HP:0000252	Microcephaly
HP:0000256	Macrocephaly
HP:0000316	Hypertelorism
HP:0000324	Facial asymmetry
HP:0000347	Micrognathia
HP:0000360	Tinnitus
HP:0000520	Proptosis
HP:0000568	Microphthalmia
HP:0000581	Blepharophimosis
HP:0000588	Optic disc coloboma
HP:0000602	Ophthalmoplegia
HP:0000612	Iris coloboma
HP:0000618	Blindness
HP:0000646	Amblyopia
HP:0000712	Emotional lability
HP:0000750	Delayed speech and language development
HP:0000773	Short ribs
HP:0000802	Impotence
HP:0000830	Anterior hypopituitarism
HP:0000870	Increased circulating prolactin concentration

GWAS associations

59 associations (top):

Study	Trait	p-value
GCST000320_16	Panic disorder	6.000000e-06
GCST000817_128	Height	3.000000e-09
GCST002593_25	Dementia and core Alzheimer’s disease neuropathologic changes	9.000000e-07
GCST002647_165	Height	3.000000e-12
GCST004611_157	High light scatter reticulocyte count	1.000000e-12
GCST004611_158	High light scatter reticulocyte count	0.000000e+00
GCST004611_159	High light scatter reticulocyte count	1.000000e-106
GCST004612_178	High light scatter reticulocyte percentage of red cells	3.000000e-13
GCST004612_179	High light scatter reticulocyte percentage of red cells	0.000000e+00
GCST004619_124	Reticulocyte fraction of red cells	1.000000e-108
GCST004619_191	Reticulocyte fraction of red cells	0.000000e+00
GCST004619_24	Reticulocyte fraction of red cells	2.000000e-62
GCST004622_83	Reticulocyte count	2.000000e-57
GCST004622_84	Reticulocyte count	1.000000e-103
GCST004622_85	Reticulocyte count	0.000000e+00
GCST004628_118	Immature fraction of reticulocytes	8.000000e-09
GCST004628_119	Immature fraction of reticulocytes	1.000000e-22
GCST004628_120	Immature fraction of reticulocytes	3.000000e-46
GCST004630_69	Mean corpuscular hemoglobin	1.000000e-11
GCST006628_19	Systolic blood pressure	1.000000e-13
GCST006926_7	Osteoarthritis (hip)	8.000000e-12
GCST008839_433	Height	1.000000e-16
GCST009276_10	Response to placebo treatment in childhood asthma (FVC change)	2.000000e-06
GCST009391_1664	Metabolite levels	1.000000e-06
GCST010320_116	PR interval	2.000000e-15
GCST010321_92	PR interval	7.000000e-16
GCST011742_38	Triglyceride levels in HIV infection	9.000000e-06
GCST012226_825	Waist circumference adjusted for body mass index	5.000000e-10
GCST012227_1356	Hip circumference adjusted for BMI	3.000000e-08
GCST90000025_628	Appendicular lean mass	5.000000e-12

EFO canonical traits (16, from GWAS)

EFO ID	Trait name
EFO:0006801	Alzheimer’s disease neuropathologic change
EFO:0007986	reticulocyte count
EFO:0004527	mean corpuscular hemoglobin
EFO:0006335	systolic blood pressure
EFO:0008344	response to placebo
EFO:0010339	FVC change measurement
EFO:0010470	carnosine measurement
EFO:0004462	PR interval
EFO:0004530	triglyceride measurement
EFO:0007789	BMI-adjusted waist circumference
EFO:0008039	BMI-adjusted hip circumference
EFO:0004980	appendicular lean mass
EFO:0004509	hemoglobin measurement
EFO:0004528	mean corpuscular hemoglobin concentration
EFO:0010701	mean reticulocyte volume
EFO:0009188	Red cell distribution width

MeSH disease descriptors (6)

Descriptor	Name	Tree numbers
D003103	Coloboma	C11.250.110; C11.270.147; C16.131.384.282
D006627	Hirschsprung Disease	C06.198.439; C06.405.469.158.701.439; C16.131.314.439
D008527	Medulloblastoma	C04.557.465.625.600.380.515; C04.557.465.625.600.590.500; C04.557.470.670.380.515; C04.557.470.670.590.500; C04.557.580.625.600.380.515; C04.557.580.625.600.590.500
D008831	Microcephaly	C05.660.207.620; C10.500.507.400.500; C16.131.621.207.620; C16.131.666.507.400.500
C537158	Hypothalamic hamartomas (supp.)
C536735	Winter Shortland Temple syndrome (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL2176769 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

Binding affinities (BindingDB)

118 measured of 122 human assays (123 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
N-(3-imidazol-1-ylpropyl)-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	10000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-[3-(1H-imidazol-5-yl)propyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	15000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
7-cyclohexyl-N-(3-imidazol-1-ylpropyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	22000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(3-imidazol-1-ylpropyl)-5-phenyl-7-piperidin-1-ylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	24000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
7-(4-fluorophenyl)-N-(3-imidazol-1-ylpropyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	24000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
3-iodo-N-(1-methylazetidin-3-yl)-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	33000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
7-(3-fluorophenyl)-N-(3-imidazol-1-ylpropyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	36000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(3-imidazol-1-ylpropyl)-5-phenyl-7-pyridin-2-ylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	43000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-[3-(2-methylimidazol-1-yl)propyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	45000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-[3-(1-methylimidazol-2-yl)propyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	46000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(1-methylazetidin-3-yl)-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	49000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
7-(3-fluoropiperidin-1-yl)-N-(3-imidazol-1-ylpropyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	49000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(3-imidazol-1-ylpropyl)-7-(oxan-2-yl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	58000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
5,7-diphenyl-N-(5,6,7,8-tetrahydroimidazo[1,2-a]pyridin-6-ylmethyl)pyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	65000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(3-imidazol-1-ylpropyl)-7-phenyl-5-[4-(trifluoromethyl)phenyl]pyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	72000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
7-(4-cyanophenyl)-N-(3-imidazol-1-ylpropyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	78000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
7-(4-hydroxyphenyl)-N-(3-imidazol-1-ylpropyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	102000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
3-chloro-N-(1-methylazetidin-3-yl)-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	108000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
3-methyl-N-(1-methylazetidin-3-yl)-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	110000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
5-(3-fluorophenyl)-N-(1-methylazetidin-3-yl)-7-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	114000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-[(1,3-dimethylpyrrolidin-3-yl)methyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	117000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(3-imidazol-1-ylpropyl)-7-(3-methylphenyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	122000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
3-iodo-N-(1-methylpyrrolidin-3-yl)-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	125000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
5,7-diphenyl-N-(pyrrolidin-2-ylmethyl)pyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	142000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(1-methylazetidin-3-yl)-5-phenyl-7-piperidin-1-ylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	147000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
5,7-diphenyl-N-[2-(pyridin-2-ylamino)ethyl]pyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	156000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-[(1-methylpyrrolidin-3-yl)methyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	158000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
7-(3-cyanophenyl)-N-(3-imidazol-1-ylpropyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	159000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-[3-(dimethylamino)propyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	161000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
5-(4-fluorophenyl)-N-(1-methylazetidin-3-yl)-7-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	164000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(3-imidazol-1-ylpropyl)-5-phenyl-7-(propan-2-ylamino)pyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	176000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
7-[(3R)-3-hydroxypiperidin-1-yl]-N-(1-methylazetidin-3-yl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	177000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-[[(2R)-1-ethylpyrrolidin-2-yl]methyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	192000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
5,7-diphenyl-N-(3-pyridin-4-ylpropyl)pyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	195000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
3-fluoro-N-(1-methylazetidin-3-yl)-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	215000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(1-methylpyrrolidin-3-yl)-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	230000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-[3-(methylamino)propyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	230000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(2-imidazol-1-ylethyl)-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	231000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(1-methylazetidin-3-yl)-5-phenyl-7-pyridin-2-ylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	239000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
7-(4-fluoropiperidin-1-yl)-N-(3-imidazol-1-ylpropyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	241000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(3-imidazol-1-ylpropyl)-7-(4-methoxyphenyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	242000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-[2-(1H-imidazol-2-yl)ethyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	253000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(3-imidazol-1-ylpropyl)-7-(3-methoxyphenyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	256000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-[2-(1H-imidazol-5-yl)ethyl]-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	262000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
3-cyano-N-(1-methylazetidin-3-yl)-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	273000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(azetidin-3-yl)-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	282000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(3-imidazol-1-ylpropyl)-7-(2-methoxyphenyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	285000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
N-(3-aminopropyl)-5,7-diphenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	296000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
5,7-diphenyl-N-(4-pyrrolidin-1-ylbutyl)pyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	297000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE
7-(3-hydroxyphenyl)-N-(3-imidazol-1-ylpropyl)-5-phenylpyrazolo[1,5-a]pyrimidine-2-carboxamide	IC50	303000 nM	US-20250161307: PYRAZOLOPYRIMIDINES AS MODULATORS OF SPERMINE OXIDASE

ChEMBL bioactivities

4 potent at pChembl≥5 of 8 total, top 4 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
8.00	IC50	10	nM	CHEMBL5094181
8.00	Ki	9.9	nM	CHEMBL5094181
7.40	IC50	40	nM	CHEMBL3621615
5.92	IC50	1200	nM	CHEMBL5094181

PubChem BioAssay actives

2 with measured affinity, of 58 total; 2 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
3-N-[(2-chloro-6-phenoxyphenyl)methyl]-1H-1,2,4-triazole-3,5-diamine	1711597: Inhibition of recombinant human SMOX	ic50	0.0400	uM
Chlorhexidine	1803253: Enzyme Inhibition Assay from Article 10.3109/14756366.2011.650691: “Inhibition of acetylpolyamine and spermine oxidases by the polyamine analogue chlorhexidine.”	ki	0.5500	uM

CTD chemical–gene interactions

95 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	increases methylation, decreases methylation, increases expression	5
Estradiol	increases expression, affects expression, affects cotreatment, affects reaction	5
sodium arsenite	affects cotreatment, increases abundance, increases expression, decreases expression	3
bisphenol A	affects expression, increases expression	2
Acetaminophen	increases expression	2
Air Pollutants	increases expression, increases abundance	2
Cisplatin	increases expression	2
Tretinoin	increases expression	2
Cyclosporine	increases expression	2
Aflatoxin B1	increases expression	2
Asbestos, Crocidolite	affects expression, increases expression	2
Genistein	increases expression	2
aristolochic acid I	increases expression	1
alpha phellandrene	increases expression	1
triphenyl phosphate	affects expression	1
deoxynivalenol	increases expression	1
lead acetate	decreases expression	1
2,5,2’,5’-tetrachlorobiphenyl	increases expression	1
2-methyl-4-isothiazolin-3-one	increases expression	1
trichostatin A	increases expression	1
sulforaphane	increases expression	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
didecyldimethylammonium	increases expression	1
potassium chromate(VI)	affects cotreatment, increases expression	1
periodate-oxidized adenosine	affects expression	1
aflatoxin B2	decreases methylation	1
cupric chloride	decreases expression	1
epigallocatechin gallate	affects cotreatment, increases expression	1
tamibarotene	increases expression	1
perfluorooctane sulfonic acid	increases expression	1

ChEMBL screening assays

18 unique, capped per target: 15 binding, 3 admet

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL2185107	Binding	Activity of spermine oxidase in human DU145 cells assessed per ug DNA at 100 uM after 72 hrs in presence of serum amine oxidase inhibitor aminoguanidine (RVb = 742 +/- 10 pmol/h per ug DNA)	The use of novel C-methylated spermidine derivatives to investigate the regulation of polyamine metabolism. — J Med Chem
CHEMBL4324839	ADMET	Substrate activity at recombinant human SMOX at 1 mM	Unforeseen Possibilities To Investigate the Regulation of Polyamine Metabolism Revealed by Novel C-Methylated Spermine Derivatives. — J Med Chem

Cellosaurus cell lines

2 cell lines: 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_TP67	HAP1 SMOX (-) 1	Cancer cell line	Male
CVCL_TP68	HAP1 SMOX (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

218 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT02875314	PHASE4	ACTIVE_NOT_RECRUITING	HeadStart4: Newly Diagnosed Children (<10 y/o) With Medulloblastoma and Other CNS Embryonal Tumors
NCT04081701	PHASE4	RECRUITING	68-Ga DOTATATE PET/MRI in the Diagnosis and Management of Somatostatin Receptor Positive CNS Tumors.
NCT02343562	PHASE4	UNKNOWN	Probiotics for Prophylaxis of Postoperative Hirschsprungs Associated Enterocolitis
NCT07186647	PHASE4	COMPLETED	Laparoscopic-Assisted Transanal Pull-Through for Hirschsprung Disease in Pediatric:Short and Intermediate Outcomes of Two Different Techniques
NCT00085735	PHASE3	COMPLETED	Comparison of Radiation Therapy Regimens in Combination With Chemotherapy in Treating Young Patients With Newly Diagnosed Standard-Risk Medulloblastoma
NCT00336024	PHASE3	COMPLETED	Combination Chemotherapy Followed By Peripheral Stem Cell Transplant in Treating Young Patients With Newly Diagnosed Supratentorial Primitive Neuroectodermal Tumors or High-Risk Medulloblastoma
NCT00392327	PHASE3	ACTIVE_NOT_RECRUITING	Chemotherapy and Radiation Therapy in Treating Young Patients With Newly Diagnosed, Previously Untreated, High-Risk Medulloblastoma/PNET
NCT01351870	PHASE3	COMPLETED	Hyperfractionated Versus Conventionally Fractionated Radiotherapy in Standard Risk Medulloblastoma (PNET4)
NCT07291102	PHASE3	NOT_YET_RECRUITING	Comparison of Neurocognitive Outcome in Two Standard Regimen for Treatment of Low-risk Medulloblastoma
NCT03660176	PHASE3	UNKNOWN	Effects of Butyrate Enemas on Postoperative Intestinal Mobility Disorders in Hirschsprung’s Disease
NCT04904081	PHASE3	UNKNOWN	Feasibility of Use of Indocyanine Green in Pediatric Colorectal Surgery
NCT00031590	PHASE2	TERMINATED	Low-Dose Radiation and Combination Chemotherapy Following Surgery in Children With Newly Diagnosed Medulloblastoma
NCT00180791	PHASE2	UNKNOWN	High Risk Primitive Neuroectodermal (PNET) Brain Tumors in Childhood
NCT00180947	PHASE2	UNKNOWN	Study of Vinorelbine and Cyclofosfamide Among Patients With Refractory Tumours or in Relapse
NCT00404495	PHASE2	COMPLETED	Combination of Irinotecan and Temozolomide in Children With Brain Tumors.
NCT00407433	PHASE2	COMPLETED	Clinical Studies of Gemcitabine-Oxaliplatin
NCT00520936	PHASE2	COMPLETED	A Study of Pemetrexed in Children With Recurrent Cancer
NCT00601003	PHASE2	COMPLETED	Study of Nifurtimox to Treat Refractory or Relapsed Neuroblastoma or Medulloblastoma
NCT00840047	PHASE2	ACTIVE_NOT_RECRUITING	Methionine PET/CT Studies In Patients With Cancer
NCT01217437	PHASE2	COMPLETED	Temozolomide and Irinotecan Hydrochloride With or Without Bevacizumab in Treating Young Patients With Recurrent or Refractory Medulloblastoma or CNS Primitive Neuroectodermal Tumors
NCT01326104	PHASE2	COMPLETED	Vaccine Immunotherapy for Recurrent Medulloblastoma and Primitive Neuroectodermal Tumor
NCT01356290	PHASE2	RECRUITING	Antiangiogenic Therapy for Children With Recurrent Medulloblastoma, Ependymoma, ATRT and Rare CNS Tumors
NCT01542736	PHASE2	COMPLETED	Concurrent Carboplatin and Reduced Dose Craniospinal Radiation for Medulloblastoma and Primitive Neuroectodermal Tumor (PNET)
NCT01708174	PHASE2	COMPLETED	A Phase II Study of Oral LDE225 in Patients With Hedge-Hog (Hh)-Pathway Activated Relapsed Medulloblastoma (MB)
NCT01857453	PHASE2	UNKNOWN	Interest of a Dose Decrease for Radiotherapy Associated With Chemotherapy for Treatment of Standard Risk Adult Medulloblastomas
NCT01878617	PHASE2	ACTIVE_NOT_RECRUITING	A Clinical and Molecular Risk-Directed Therapy for Newly Diagnosed Medulloblastoma
NCT02017964	PHASE2	COMPLETED	Combination Chemotherapy in Treating Younger Patients With Newly Diagnosed, Non-metastatic Desmoplastic Medulloblastoma
NCT02441062	PHASE2	COMPLETED	Impact of Ga-68 DOTATOC PET-CT Imaging in Management of Neuroendocrine Tumors
NCT02624388	PHASE2	TERMINATED	Study of Genistein in Pediatric Oncology Patients (UVA-Gen001)
NCT02681705	PHASE2	UNKNOWN	Radiation Therapy and Combination Chemotherapy for Medulloblastoma
NCT02689336	PHASE2	WITHDRAWN	Erlotinib in Combination With Temozolomide in Treating Relapsed/Recurrent/Refractory Pediatric Solid Tumors
NCT02724579	PHASE2	ACTIVE_NOT_RECRUITING	Reduced Craniospinal Radiation Therapy and Chemotherapy in Treating Younger Patients With Newly Diagnosed WNT-Driven Medulloblastoma
NCT03013387	PHASE2	WITHDRAWN	Dosimetry Guided PRRT With 90Y-DOTATOC
NCT03155620	PHASE2	ACTIVE_NOT_RECRUITING	Targeted Therapy Directed by Genetic Testing in Treating Pediatric Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphomas, or Histiocytic Disorders (The Pediatric MATCH Screening Trial)
NCT03173950	PHASE2	COMPLETED	Immune Checkpoint Inhibitor Nivolumab in People With Recurrent Select Rare CNS Cancers
NCT03210714	PHASE2	ACTIVE_NOT_RECRUITING	Erdafitinib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With FGFR Mutations (A Pediatric MATCH Treatment Trial)
NCT03213652	PHASE2	ACTIVE_NOT_RECRUITING	Ensartinib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With ALK or ROS1 Genomic Alterations (A Pediatric MATCH Treatment Trial)
NCT03213665	PHASE2	COMPLETED	Tazemetostat in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With EZH2, SMARCB1, or SMARCA4 Gene Mutations (A Pediatric MATCH Treatment Trial)
NCT03213678	PHASE2	COMPLETED	Samotolisib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With TSC or PI3K/MTOR Mutations (A Pediatric MATCH Treatment Trial)
NCT03213704	PHASE2	ACTIVE_NOT_RECRUITING	Larotrectinib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With NTRK Fusions (A Pediatric MATCH Treatment Trial)