SMUG1

Summary

SMUG1 (single-strand-selective monofunctional uracil-DNA glycosylase 1, HGNC:17148) is a protein-coding gene on chromosome 12q13.13, encoding Single-strand selective monofunctional uracil DNA glycosylase (Q53HV7). Recognizes base lesions in the genome and initiates base excision DNA repair.

This gene encodes a protein that participates in base excision repair by removing uracil from single- and double-stranded DNA. Many alternatively spliced transcript variants exist for this gene; the full-length nature is known for some but not all of the variants.

Source: NCBI Gene 23583 — RefSeq curated summary.

At a glance

• GWAS associations: 4
• Clinical variants (ClinVar): 60 total
• Druggable target: yes
• MANE Select transcript: NM_001243787

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:17148
Approved symbol	SMUG1
Name	single-strand-selective monofunctional uracil-DNA glycosylase 1
Location	12q13.13
Locus type	gene with protein product
Status	Approved
Aliases	UNG3, FDG, HMUDG
Ensembl gene	ENSG00000123415
Ensembl biotype	protein_coding
OMIM	607753
Entrez	23583

Gene structure

Transcript identifiers

Ensembl transcripts: 86 — 75 protein_coding, 5 protein_coding_CDS_not_defined, 4 retained_intron, 2 nonsense_mediated_decay

ENST00000243112, ENST00000337581, ENST00000401977, ENST00000503231, ENST00000503306, ENST00000503447, ENST00000504338, ENST00000504797, ENST00000505128, ENST00000505597, ENST00000505662, ENST00000506169, ENST00000506595, ENST00000507904, ENST00000508394, ENST00000509078, ENST00000509864, ENST00000511522, ENST00000511854, ENST00000513838, ENST00000514196, ENST00000514685, ENST00000634429, ENST00000635234, ENST00000635546, ENST00000682136, ENST00000879411, ENST00000879412, ENST00000879413, ENST00000879414, ENST00000879415, ENST00000879416, ENST00000879417, ENST00000879418, ENST00000879419, ENST00000879420, ENST00000879421, ENST00000879422, ENST00000879423, ENST00000879424, ENST00000879425, ENST00000879426, ENST00000879427, ENST00000879428, ENST00000879429, ENST00000879430, ENST00000879431, ENST00000879432, ENST00000879433, ENST00000879434, ENST00000879435, ENST00000879436, ENST00000879437, ENST00000879438, ENST00000879439, ENST00000879440, ENST00000879441, ENST00000879442, ENST00000879443, ENST00000879444, ENST00000879445, ENST00000879446, ENST00000879447, ENST00000879448, ENST00000879449, ENST00000938158, ENST00000938159, ENST00000938160, ENST00000938161, ENST00000938162, ENST00000938163, ENST00000938164, ENST00000938165, ENST00000938166, ENST00000938167, ENST00000938168, ENST00000938169, ENST00000938170, ENST00000938171, ENST00000938172, ENST00000948772, ENST00000948773, ENST00000948774, ENST00000948775, ENST00000948776, ENST00000948777

RefSeq mRNA: 31 — MANE Select: NM_001243787 NM_001243787, NM_001243788, NM_001243789, NM_001243790, NM_001243791, NM_001351237, NM_001351238, NM_001351239, NM_001351240, NM_001351241, NM_001351242, NM_001351243, NM_001351244, NM_001351245, NM_001351246, NM_001351247, NM_001351248, NM_001351249, NM_001351250, NM_001351251, NM_001351252, NM_001351253, NM_001351254, NM_001351255, NM_001351256, NM_001351257, NM_001351258, NM_001351260, NM_001351261, NM_001351262, NM_014311

CCDS: CCDS58239, CCDS86305, CCDS8874

Canonical transcript exons

ENST00000682136 — 4 exons

Exon	Start	End
ENSE00000838346	54183656	54183959
ENSE00002024137	54187819	54187902
ENSE00002036636	54188951	54188985
ENSE00003920094	54180366	54182623

Expression profiles

Bgee: expression breadth ubiquitous, 213 present calls, max score 93.30.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 1.8670 / max 16.4304, expressed in 1298 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
131295	1.8670	1298

Top tissues by expression

255 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
lower esophagus mucosa	UBERON:0035834	93.30	gold quality
right lobe of liver	UBERON:0001114	92.41	gold quality
body of stomach	UBERON:0001161	92.11	gold quality
mucosa of transverse colon	UBERON:0004991	92.11	gold quality
apex of heart	UBERON:0002098	91.19	gold quality
right adrenal gland cortex	UBERON:0035827	91.08	gold quality
right adrenal gland	UBERON:0001233	91.06	gold quality
body of pancreas	UBERON:0001150	90.91	gold quality
esophagus mucosa	UBERON:0002469	90.90	gold quality
right uterine tube	UBERON:0001302	90.43	gold quality
left adrenal gland	UBERON:0001234	90.29	gold quality
left adrenal gland cortex	UBERON:0035825	90.22	gold quality
metanephros cortex	UBERON:0010533	90.05	gold quality
stomach	UBERON:0000945	89.91	gold quality
hindlimb stylopod muscle	UBERON:0004252	89.79	gold quality
esophagus	UBERON:0001043	89.77	gold quality
skin of abdomen	UBERON:0001416	89.50	gold quality
skin of leg	UBERON:0001511	89.34	gold quality
granulocyte	CL:0000094	89.16	gold quality
stromal cell of endometrium	CL:0002255	89.03	gold quality
minor salivary gland	UBERON:0001830	88.81	gold quality
adrenal cortex	UBERON:0001235	88.74	gold quality
lower esophagus	UBERON:0013473	88.72	gold quality
lower esophagus muscularis layer	UBERON:0035833	88.69	gold quality
right lobe of thyroid gland	UBERON:0001119	88.59	gold quality
gall bladder	UBERON:0002110	88.58	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	88.51	gold quality
adrenal gland	UBERON:0002369	88.46	gold quality
ganglionic eminence	UBERON:0004023	88.46	gold quality
small intestine Peyer’s patch	UBERON:0003454	88.43	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	6.71

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): NFIA, NFIC

miRNA regulators (miRDB)

88 targeting SMUG1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6758-5P	100.00	66.21	1470
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-6856-5P	100.00	65.47	1298
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-4500	99.99	72.72	2367
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775
HSA-LET-7A-5P	99.98	72.29	1790
HSA-LET-7B-5P	99.98	72.31	1790
HSA-LET-7C-5P	99.98	72.29	1790
HSA-LET-7E-5P	99.98	72.29	1790
HSA-LET-7F-5P	99.98	72.56	1784
HSA-LET-7G-5P	99.98	72.37	1784
HSA-LET-7I-5P	99.98	72.37	1788
HSA-MIR-98-5P	99.98	72.33	1787
HSA-MIR-6778-3P	99.96	67.29	2693
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-4666A-3P	99.96	71.71	3434
HSA-LET-7D-5P	99.96	71.76	1632
HSA-MIR-4458	99.96	71.64	1650
HSA-MIR-10523-5P	99.91	69.22	2038
HSA-MIR-6780A-5P	99.88	66.69	2776
HSA-MIR-221-5P	99.86	65.45	1052
HSA-MIR-8073	99.86	65.21	1118
HSA-MIR-4668-5P	99.79	70.58	3782

Literature-anchored findings (GeneRIF, showing 27)

• hSMUG1 is a broad specificity backup for hUNG2, the major enzyme for removal of deaminated cytosine in single strnaded DNA (PMID:12161446)
• This enzyme has a role in repair of 5-formyluracil and other oxidized and deaminated base lesions. (PMID:12718543)
• The structure and specificity of SMUG1 have been solved. (PMID:12820976)
• Site-directed mutagenesis was used to determine the catalytic and DNA damage-recognition mechanism of hSMUG1. (PMID:15466595)
• SMUG1 plays little natural role in antibody diversification. (PMID:16407970)
• A G44T missense mutation was found in familial colorectal cancer DNA suggesting a limited role for this gene in the devlopment of CRC. (PMID:17029639)
• Analysis of the catalytic and precision damage recognition mechanisms of SMUG1. (PMID:17150750)
• SMUG1 and UNG2 coordinate the initial steps in base excision repair of U:G mismatches by different molecular mechanisms. (PMID:17537817)
• proline substitution at the G63 position switches the Gme SMUG1 enzyme to an exclusive UDG as demonstrated by the uniform excision of uracil in both double-stranded and single-stranded DNA and the complete loss of XDG activity (PMID:18835277)
• Properties used by hSMUG1 to select damaged pyrimidines include the size and free energy of solvation of the 5-substituent but not electronic inductive properties. (PMID:19324873)
• hSMUG1 excised fU from DNA opposite all normal bases with the highest activity when opposite non-cognate C or T followed by G and cognate A (PMID:19365746)
• there was increased risk of breast cancer among postmenopausal women heterozygous for either SMUG1 rs2029166 or rs7296239. Among premenopausal women, the increased risk associated with SMUG1 rs2029166 was limited to those with low folate intake. (PMID:21427733)
• analysis of species specific differences between mouse and humans in regulation of SMUG1 and UNG2 (PMID:21454529)
• Data show that uracil-DNA glycosylases SMUG1 and UNG2 display widely different sequence preferences. (PMID:22483865)
• SMUG1 is a DKC1 interaction partner that contributes to rRNA quality control, partly by regulating 5-hydroxymethyluridine levels. (PMID:23246433)
• There was no difference between SMUG1 proficient and depleted cells following continuous exposure. (PMID:23253900)
• The results obtained suggest the potential role of the g.4235T>C and the c.-31A>G polymorphisms in AMD pathogenesis. (PMID:23714858)
• A case-control study of 801 bladder cancer patients and 801 matched controls, the associations of 167 single nucleotide polymorphisms (SNPs) from 19 genes of the BER pathway with the risk of bladder cancer; 13 SNPs in 10 Base excision repair (BER) pathway genes were significantly associated with bladder cancer risk; most significant SNP was rs2029167 in the SMUG1 gene. (PMID:24038406)
• Single-strand selective monofunctional uracil-DNA glycosylase (SMUG1) deficiency is linked to aggressive breast cancer and predicts response to adjuvant therapy. (PMID:24253812)
• This analysis showed a relative increase in the expression of E2F6 in gastric adenocarcinoma with no lymph node metastasis (chi (2), P = 0.04 and OR, P = 0.08), while overexpression of RhoA and SMUG1 was found more often in the diffuse subtype of gastric adenocarcinoma as compared to the intestinal subtype. (PMID:27909884)
• Our study showed that c.-31A/G-SMUG1 genotypes/alleles do not have any association with the occurrence or severity of advanced type age-related macular degeneration (AMD). There was no interaction of CRP levels and SMUG1 genotypes in AMD susceptibility. (PMID:28095127)
• Exposure of DNA oligomers with deoxyuridine monophosphate incorporated at a specific site (U-DNA) to hSMUG1 causes strand cleavage at the lesion site, indicating that the enzyme incises DNA after uracil removal. (PMID:30496516)
• Data shows that SMUG1 forms an extensive network of contacts with DNA involving certain amino acids. Phe98 is involved in the stacking interaction in the base-binding pocket of the active site. His239 handles the DNA backbone via a contact with a phosphate group, and Arg243 gets inserted into the void formed after Ura base flipping out from the DNA duplex and forms a network of hydrogen bonds with neighboring nucleobases. (PMID:31466351)
• Role of Arg243 and His239 Residues in the Recognition of Damaged Nucleotides by Human Uracil-DNA Glycosylase SMUG1. (PMID:32571189)
• Ablation of SMUG1 Reduces Cell Viability and Increases UVC-Mediated Apoptosis in Hepatocarcinoma HepG2 Cells. (PMID:33573186)
• [Comparative Analysis of the Activity of the Polymorphic Variants of Human Uracil-DNA-Glycosylases SMUG1 and MBD4]. (PMID:33871441)
• Genetic variations in 3’UTRs of SMUG1 and NEIL2 genes modulate breast cancer risk, survival and therapy response. (PMID:34097065)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	smug1	ENSDARG00000101308
mus_musculus	Smug1	ENSMUSG00000036061
rattus_norvegicus	Smug1	ENSRNOG00000036842
drosophila_melanogaster	Smug	FBGN0038490

Protein

Protein identifiers

Single-strand selective monofunctional uracil DNA glycosylase — Q53HV7 (reviewed: Q53HV7)

All UniProt accessions (12): A0A024RAZ8, A0A0S2Z526, A0A0U1RRE6, Q53HV7, D6RA25, D6RA78, D6RAI1, D6RAS0, D6RD88, D6RI04, D6RIA4, H0YA95

UniProt curated annotations — full annotation on UniProt →

Function. Recognizes base lesions in the genome and initiates base excision DNA repair. Acts as a monofunctional DNA glycosylase specific for uracil (U) residues in DNA with a preference for single-stranded DNA substrates. The activity is greater toward mismatches (U/G) compared to matches (U/A). Excises uracil (U), 5-formyluracil (fU) and uracil derivatives bearing an oxidized group at C5 [5-hydroxyuracil (hoU) and 5-hydroxymethyluracil (hmU)] in ssDNA and dsDNA, but not analogous cytosine derivatives (5-hydroxycytosine and 5-formylcytosine), nor other oxidized bases. The activity is damage-specific and salt-dependent. The substrate preference is the following: ssDNA > dsDNA (G pair) = dsDNA (A pair) at low salt concentration, and dsDNA (G pair) > dsDNA (A pair) > ssDNA at high salt concentration.

Subcellular location. Nucleus.

Similarity. Belongs to the uracil-DNA glycosylase (UDG) superfamily. SMUG1 family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q53HV7-1	1	yes
Q53HV7-2	2

RefSeq proteins (31): NP_001230716, NP_001230717, NP_001230718, NP_001230719, NP_001230720, NP_001338166, NP_001338167, NP_001338168, NP_001338169, NP_001338170, NP_001338171, NP_001338172, NP_001338173, NP_001338174, NP_001338175, NP_001338176, NP_001338177, NP_001338178, NP_001338179, NP_001338180, NP_001338181, NP_001338182, NP_001338183, NP_001338184, NP_001338185, NP_001338186, NP_001338187, NP_001338189, NP_001338190, NP_001338191, NP_055126 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR005122	Uracil-DNA_glycosylase-like	Domain
IPR036895	Uracil-DNA_glycosylase-like_sf	Homologous_superfamily
IPR039134	SMUG1	Family

Pfam: PF03167

Enzyme classification (BRENDA):

• EC 3.2.2.27 — uracil-DNA glycosylase (BRENDA: 47 organisms, 259 substrates, 76 inhibitors, 79 Km, 70 kcat entries)

Substrate kinetics (BRENDA)

15 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
URACIL-CONTAINING CALF THYMUS DNA	0.0004–0.0028	18
URACIL-MISMATCHED DOUBLE-STRANDED DNA	—	18
URACIL-MISMATCHED SINGLE-STRANDED DNA	0.0005–0.0022	8
DOUBLE STRANDED DNA CONTAINING G-U MISMATCH	0.0002–0.001	4
DUMP DNA	0.0004–0.0028	4
URACIL-MISMATCHED DOUBLE-STRANDED DNA WITH U-G M	—	4
URACIL-CONTAINING DOUBLE-STRANDED DNA	0.0001	2
URACIL-CONTAINING SINGLE-STRANDED DNA	—	2
URACIL-MISMATCHED DOUBLE-STRANDED DNA WITH U-A M	0.0007–0.004	2
5-HYDROXYMETHYLURACIL-MISMATCHED DOUBLE-STRANDED	0.0046	1
5-HYDROXYMETHYLURACIL-MISMATCHED DOUBLE-STRANDED	0.0027	1
5-HYDROXYMETHYLURACIL-MISMATCHED SINGLE-STRANDED	0.0038	1
GGACTTCUCTCCTTTCCAGA/TCTGGAAAGGAGGGAAGTCC DUPLEX	0.0003	1
TCCCTTCUCTCCTTTCCTTC/TCCCTTCUCTCCTTTCCTTC DUPLEX	0.0004	1
URACIL-MISMATCHED DOUBLE-STRANDED DNA WITH A-U M	—	0

UniProt features (31 total): sequence conflict 12, mutagenesis site 9, binding site 4, splice variant 2, sequence variant 2, chain 1, region of interest 1

Structure

Experimental structures (PDB)

5 structures.

PDB	Method	Resolution (Å)
9GK0	X-RAY DIFFRACTION	0.95
9GGS	X-RAY DIFFRACTION	1.38
9RQP	X-RAY DIFFRACTION	1.9
9GM2	X-RAY DIFFRACTION	2.1
9SQ2	X-RAY DIFFRACTION, NEUTRON DIFFRACTION	1.54,2.31

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q53HV7-F1	92.78	0.90

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (4): 84; 98; 163; 239

Mutagenesis-validated functional residues (9):

Position	Phenotype
85	markedly impaired damage-excising activity for u/g, hou/g, hmu/a and fu/a. no cytosine-excising activity for c/g, c/a, c
87	impaired the damage-excising activity for u/g, hou/g, hmu/a and fu/a.
87	loss of damage-excising activity.
89	no effect on damage-excising activity for u/g, hou/g, hmu/a and fu/a.
90	loss of damage-excising activity for u/g. weak, but significant activity toward hou/g, hmu/a and fu/a.
91	no effect on damage-excising activity for u/g, hou/g, hmu/a and fu/a.
98	impaired the damage-excising activity for u/g, hou/g, hmu/a and fu/a.
163	impaired the damage-excising activity for u/g, hou/g, hmu/a and fu/a. no cytosine-excising activity for c/g, c/a, c/t an
239	markedly impaired the damage-excising activity for u/g, hou/g, hmu/a and fu/a.

Function

Pathways and Gene Ontology

Reactome pathways

8 pathways

ID	Pathway
R-HSA-110328	Recognition and association of DNA glycosylase with site containing an affected pyrimidine
R-HSA-110329	Cleavage of the damaged pyrimidine
R-HSA-110357	Displacement of DNA glycosylase by APEX1
R-HSA-73884	Base Excision Repair
R-HSA-73894	DNA Repair
R-HSA-73928	Depyrimidination
R-HSA-73929	Base-Excision Repair, AP Site Formation
R-HSA-73933	Resolution of Abasic Sites (AP sites)

MSigDB gene sets: 134 (showing top): GSE45365_CTRL_VS_MCMV_INFECTION_NK_CELL_DN, GOBP_CARBOHYDRATE_DERIVATIVE_CATABOLIC_PROCESS, GOBP_ORGANOPHOSPHATE_METABOLIC_PROCESS, KAUFFMANN_DNA_REPAIR_GENES, GOBP_CARBOHYDRATE_DERIVATIVE_METABOLIC_PROCESS, GOBP_NUCLEOBASE_CONTAINING_SMALL_MOLECULE_METABOLIC_PROCESS, GOBP_PYRIMIDINE_CONTAINING_COMPOUND_CATABOLIC_PROCESS, GOBP_PYRIMIDINE_NUCLEOTIDE_METABOLIC_PROCESS, GOBP_DNA_MODIFICATION, GOBP_PYRIMIDINE_NUCLEOTIDE_CATABOLIC_PROCESS, GGAANCGGAANY_UNKNOWN, GOBP_DNA_DAMAGE_RESPONSE, GOBP_PYRIMIDINE_CONTAINING_COMPOUND_METABOLIC_PROCESS, GOBP_ORGANOPHOSPHATE_CATABOLIC_PROCESS, GOBP_NUCLEOSIDE_PHOSPHATE_CATABOLIC_PROCESS

GO Biological Process (4): base-excision repair (GO:0006284), depyrimidination (GO:0045008), DNA repair (GO:0006281), DNA damage response (GO:0006974)

GO Molecular Function (8): oxidized pyrimidine nucleobase lesion DNA N-glycosylase activity (GO:0000703), DNA binding (GO:0003677), uracil DNA N-glycosylase activity (GO:0004844), single-strand selective uracil DNA N-glycosylase activity (GO:0017065), DNA N-glycosylase activity (GO:0019104), identical protein binding (GO:0042802), protein binding (GO:0005515), hydrolase activity (GO:0016787)

GO Cellular Component (5): fibrillar center (GO:0001650), nucleoplasm (GO:0005654), nucleolus (GO:0005730), cytosol (GO:0005829), nucleus (GO:0005634)

Reactome top-level categories

Rollup of top-5 pathways:

Category	Pathways
Depyrimidination	2
Base Excision Repair	2
Resolution of Abasic Sites (AP sites)	1
DNA Repair	1
Base-Excision Repair, AP Site Formation	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
nuclear lumen	2
DNA repair	1
base-excision repair, AP site formation	1
DNA modification	1
pyrimidine deoxyribonucleotide catabolic process	1
DNA metabolic process	1
DNA damage response	1
cellular response to stress	1
oxidized base lesion DNA N-glycosylase activity	1
nucleic acid binding	1
deaminated base DNA N-glycosylase activity	1
uracil DNA N-glycosylase activity	1
hydrolase activity, hydrolyzing N-glycosyl compounds	1
catalytic activity, acting on DNA	1
protein binding	1
binding	1
catalytic activity	1
nucleolus	1
intracellular membraneless organelle	1
cytoplasm	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

1482 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SMUG1	UNG	P13051	950
SMUG1	TDG	Q13569	917
SMUG1	MBD4	O95243	860
SMUG1	POLL	Q9UGP5	792
SMUG1	NEIL1	Q96FI4	791
SMUG1	POLB	P06746	742
SMUG1	NTHL1	P78549	741
SMUG1	OGG1	P78554	721
SMUG1	APEX1	P27695	715
SMUG1	AICDA	Q9GZX7	713
SMUG1	NEIL2	Q969S2	704
SMUG1	MAS1	P04201	650
SMUG1	FEN1	P39748	647
SMUG1	MPG	P29372	637
SMUG1	LIG1	P18858	636

IntAct

22 interactions, top by confidence:

A	B	Type	Score
VAC14	SMUG1	psi-mi:“MI:0915”(physical association)	0.670
SMUG1	VAC14	psi-mi:“MI:0915”(physical association)	0.670
SMUG1	CDC23	psi-mi:“MI:0915”(physical association)	0.560
SMUG1	SKIL	psi-mi:“MI:0915”(physical association)	0.560
SMUG1	CRX	psi-mi:“MI:0915”(physical association)	0.560
RBPMS	SMUG1	psi-mi:“MI:0915”(physical association)	0.510
SMUG1	RBPMS	psi-mi:“MI:0915”(physical association)	0.510
vpr	SMUG1	psi-mi:“MI:0915”(physical association)	0.400
XPO7	SMUG1	psi-mi:“MI:0915”(physical association)	0.400
SMUG1	SLC27A4	psi-mi:“MI:0915”(physical association)	0.400
TRIP13	SMUG1	psi-mi:“MI:0915”(physical association)	0.370
Xpo7	HAT1	psi-mi:“MI:0914”(association)	0.350
SMUG1	ZNF318	psi-mi:“MI:0914”(association)	0.350

BioGRID (55): VAC14 (Two-hybrid), SMUG1 (Two-hybrid), SMUG1 (Two-hybrid), SMUG1 (Affinity Capture-Western), SMUG1 (Affinity Capture-RNA), CRX (Two-hybrid), SKIL (Two-hybrid), CDC23 (Two-hybrid), SMUG1 (Affinity Capture-RNA), SMUG1 (Two-hybrid), SMUG1 (Two-hybrid), SMUG1 (Two-hybrid), SMUG1 (Two-hybrid), SMUG1 (Two-hybrid), SMUG1 (Two-hybrid)

ESM2 similar proteins: A2AI05, A3KCL7, D3ZDK7, D3ZDM7, E1BNQ4, O55240, O60294, P21139, P50336, P51175, P56602, P60487, Q0VGK3, Q27979, Q2KJF7, Q2T9S4, Q2TBI8, Q32M88, Q3T0A0, Q3ZBF9, Q501J2, Q53HV7, Q569C4, Q59I47, Q5E9V4, Q5H879, Q60HD5, Q6AYG0, Q6P3E7, Q6P5C5, Q6P9U1, Q6QHF9, Q6XQN1, Q8BNV1, Q8BP56, Q8BYR1, Q8BZG5, Q8CC86, Q8CHP8, Q8IVS8

Diamond homologs: Q53HV7, Q59I47, Q6P5C5, Q811Q1, Q9YGN6

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
SMUG1	up-regulates	Base-excision_repair

Disease & clinical

Clinical variants and AI predictions

ClinVar

60 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	42
Likely benign	1
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

800 predictions. Top by Δscore:

Variant	Effect	Δscore
12:54182622:ACCT:A	acceptor_loss	1.0000
12:54182625:T:A	acceptor_loss	1.0000
12:54183654:ACC:A	donor_gain	1.0000
12:54183655:CCC:C	donor_gain	1.0000
12:54183705:A:AC	donor_gain	1.0000
12:54183705:ACTT:A	donor_gain	1.0000
12:54183706:C:CC	donor_gain	1.0000
12:54183706:CTTC:C	donor_gain	1.0000
12:54183708:T:TA	donor_gain	1.0000
12:54183709:C:A	donor_gain	1.0000
12:54183740:G:C	donor_gain	1.0000
12:54183754:C:CA	donor_gain	1.0000
12:54183766:C:CA	donor_gain	1.0000
12:54183957:CAC:C	acceptor_gain	1.0000
12:54183960:C:CC	acceptor_gain	1.0000
12:54182399:C:CT	acceptor_gain	0.9900
12:54182400:A:T	acceptor_gain	0.9900
12:54183646:AAC:A	donor_gain	0.9900
12:54183650:CTTTA:C	donor_loss	0.9900
12:54183651:TTTAC:T	donor_loss	0.9900
12:54183652:TTA:T	donor_loss	0.9900
12:54183653:TA:T	donor_loss	0.9900
12:54183654:AC:A	donor_gain	0.9900
12:54183655:CC:C	donor_gain	0.9900
12:54183671:G:A	donor_gain	0.9900
12:54183680:T:TA	donor_gain	0.9900
12:54183692:G:A	donor_gain	0.9900
12:54183739:A:AC	donor_gain	0.9900
12:54183763:A:AC	donor_gain	0.9900
12:54183764:C:CC	donor_gain	0.9900

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000034681 (12:54188932 C>A), RS1000280756 (12:54160640 A>C), RS1000330330 (12:54174331 G>A), RS1000428458 (12:54188607 G>C), RS1000554730 (12:54174853 T>A), RS1000631402 (12:54189328 T>A), RS1000703370 (12:54160899 G>A), RS1000770831 (12:54168238 T>G), RS1000825097 (12:54167551 G>A), RS1000932155 (12:54173086 C>G), RS1001035220 (12:54187085 T>A), RS1001037452 (12:54187333 A>C,G), RS1001150626 (12:54188142 AC>A), RS1001271164 (12:54180084 C>T), RS1001356786 (12:54160758 C>T)

Disease associations

OMIM: gene MIM:607753 | disease phenotypes:

GenCC curated gene-disease

Mondo (1): prostate cancer (MONDO:0008315)

Orphanet (1): Familial prostate cancer (Orphanet:1331)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

4 associations (top):

Study	Trait	p-value
GCST005956_70	Waist-to-hip ratio adjusted for BMI	4.000000e-13
GCST005958_9	Waist-to-hip ratio adjusted for BMI (age >50)	1.000000e-08
GCST005962_20	Waist-to-hip ratio adjusted for BMI x sex x age interaction (4df test)	7.000000e-13
GCST010479_25	Coronary artery disease	2.000000e-09

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0007788	BMI-adjusted waist-hip ratio
EFO:0008007	age at assessment
EFO:0008343	sex interaction measurement

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D011471	Prostatic Neoplasms	C04.588.945.440.770; C12.100.500.260.750; C12.100.500.565.625; C12.200.294.260.750; C12.200.294.565.625; C12.200.758.409.750; C12.900.619.750

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL5723576 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

40 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, decreases methylation, increases expression	3
sodium arsenite	decreases expression, affects cotreatment, increases abundance, increases expression	2
Cisplatin	affects expression, affects cotreatment, increases expression	2
Cadmium Chloride	increases expression, increases abundance	2
GSK-J4	decreases expression	1
triphenyl phosphate	affects expression	1
alpha-pinene	affects cotreatment, increases oxidation, increases abundance	1
bisphenol A	increases expression	1
5-chlorouracil	affects metabolic processing	1
manganese chloride	affects cotreatment, increases abundance, increases expression	1
3,4-dihydroxy-1,2-epoxy-1,2,3,4-tetrahydrobenz(a)anthracene	increases expression	1
potassium chromate(VI)	decreases expression, decreases reaction, affects cotreatment	1
methacrylaldehyde	affects cotreatment, increases oxidation, increases abundance	1
epigallocatechin gallate	decreases reaction, affects cotreatment, decreases expression	1
di-n-butylphosphoric acid	affects expression	1
CPG-oligonucleotide	decreases expression	1
jinfukang	affects cotreatment, increases expression	1
Temozolomide	increases expression	1
Decitabine	affects expression	1
Acrolein	affects cotreatment, increases oxidation, increases abundance	1
Air Pollutants	affects cotreatment, increases abundance, increases oxidation	1
Arsenic	affects cotreatment, increases abundance, increases expression	1
Atrazine	decreases expression	1
Benzo(a)pyrene	decreases methylation	1
Cadmium	increases abundance, increases expression	1
Doxorubicin	decreases expression	1
Ketoconazole	decreases expression	1
Lead	increases expression	1
Manganese	affects cotreatment, increases abundance, increases expression	1
Ozone	increases oxidation, increases abundance, affects cotreatment	1

ChEMBL screening assays

1 unique, capped per target: 1 functional

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5665451	Functional	Inhibition of SMUG1 by quantifying inhibition of SMUG1-mediated cleavage and dissociation of quenched duplex DNA oligonucleotides, measured as fluorescence at 594 nm. To generate a functional strand incision and increase turn-over this assa	Enzyme Inhibitor Single Concentration assay results for EUbOPEN Chemogenomics Library

Cellosaurus cell lines

1 cell lines: 1 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_TP73	HAP1 SMUG1 (-)	Cancer cell line	Male

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00029224	PHASE4	COMPLETED	Treatment With Zoledronic Acid in Patients With Breast Cancer, Multiple Myeloma, and Prostate Cancer With Cancer Related Bone Lesions
NCT00035997	PHASE4	COMPLETED	Open-label Trial on the Effect of I.V. Zoledronic Acid 4 mg on Bone Density in Hormone Sensitive Prostate Cancer Patients With Bone Metastasis
NCT00063609	PHASE4	COMPLETED	The Effect of Zoledronic Acid on Bone Loss in Prostate Cancer Patients Undergoing Androgen Deprivation Therapy
NCT00103623	PHASE4	SUSPENDED	The Plenaxis® Experience Study
NCT00106392	PHASE4	COMPLETED	A Safety and Efficacy Study of Prograf in the Prevention of Erectile Dysfunction After Radical Prostatectomy
NCT00185029	PHASE4	UNKNOWN	MR-Lymphography and Lymph Node Staging in Prostate Cancer
NCT00199485	PHASE4	COMPLETED	Angelica Sinensis for the Treatment of Hot Flashes in Men Undergoing LHRH Therapy for Prostate Cancer
NCT00219219	PHASE4	COMPLETED	Zoledronic Acid in the Prevention of Skeletal-related Events in Hormone Refractory and Hormone-sensitive Prostate Cancer Patients With Bone Metastases
NCT00219271	PHASE4	COMPLETED	Effect Of Zoledronic Acid On Circulating And Bone Marrow-Residing Prostate Cancer Cells In Patients With Clinically Localized Prostate Cancer
NCT00237146	PHASE4	COMPLETED	Study to Evaluate Zoledronic Acid on Quality of Life and Skeletal-related Events as Adjuvant Treatment in Patients With Hormone-naïve Prostate Cancer and Bone Metastasis Who Have Undergone Orchiectomy
NCT00242554	PHASE4	COMPLETED	Open-label Phase IV Clinical Trial to Evaluate the Safety and Tolerability of Zoledronic Acid in Patients With Prostate Cancer and Bone Metastases
NCT00280098	PHASE4	COMPLETED	Docetaxel in the Treatment of Hormone Refractory Prostate Cancer
NCT00293696	PHASE4	COMPLETED	Casodex/Zoladex Biomarkers in Localised Prostate Cancer
NCT00334139	PHASE4	COMPLETED	Effect of Zoledronic Acid on Bone Metabolism in Patients With Bone Metastasis and Prostate or Breast Cancer
NCT00375765	PHASE4	COMPLETED	Effects On Dihydrotestosterone Regulated Gene Expression In Benign Prostatic Hyperplasia Or Prostate Cancer
NCT00391690	PHASE4	COMPLETED	Evaluation of Bone Markers as Diagnostic Tools for Early Detection of Bone Metastases in Patients With High Risk Prostate Cancer
NCT00422708	PHASE4	COMPLETED	Local Anesthesia for Prostate Biopsy
NCT00526331	PHASE4	COMPLETED	Evaluation of Arterial Pressure Based Cardiac Output for Goal-Directed Perioperative Therapy
NCT00590213	PHASE4	COMPLETED	Compare the Value of Prophylactic Versus Therapeutic Breast Radiotherapy in CASODEX
NCT00629330	PHASE4	TERMINATED	Dissemination of Prostate Cancer Screening to PCP’s in African American Communities
NCT00771966	PHASE4	COMPLETED	Radical Prostatectomy and Perioperative Fluid Therapy
NCT00805701	PHASE4	COMPLETED	Study Assessing The Efficacy And Safety Of Avodart (Dutasteride) At Improving Urinary Symptoms In Men With Prostate Cancer Who Are Undergoing Seed Implantation
NCT00859027	PHASE4	COMPLETED	Effect Of Risedronate On Bone Mass In Older Men Receiving Neoadjuvant Therapy For Prostate Cancer
NCT00906269	PHASE4	UNKNOWN	Can Hyperbaric Oxygen Improve Erectile Function Following Surgery for Prostate Cancer
NCT00953277	PHASE4	COMPLETED	Study of Nerve Reconstruction Using AVANCE in Subjects Who Undergo Robotic Assisted Prostatectomy for Treatment of Prostate Cancer
NCT00982800	PHASE4	COMPLETED	Does Postoperative Gabapentin Reduce Pain, Opioid Consumption and Anxiety and Have a Positive Effect on Health Related Quality of Life After Radical Prostatectomy?
NCT01083199	PHASE4	COMPLETED	Global Performance Evaluation of the AMS CONTINUUM™ Device
NCT01136226	PHASE4	COMPLETED	Evaluate Recovery of Testosterone for Patients Using Eligard
NCT01161563	PHASE4	COMPLETED	Randomized Crossover Trial to Assess the Tolerability of Gonadotropin Releasing Hormone (GnRH) Analogue Administration
NCT01230905	PHASE4	COMPLETED	Study to Monitor the Effects of Androgen Suppression Treatment on the Heart
NCT01296672	PHASE4	COMPLETED	3 Month Finasteride Challenge Test Can Significantly Improve the Performance of Screening for Prostate Cancer
NCT01365143	PHASE4	TERMINATED	Prospective Randomized Trial Comparing Robotic Versus Open Radical Prostatectomy
NCT01379742	PHASE4	UNKNOWN	Comparison of Between ThinSeed™ and OncoSeed™ for Permanent Prostate Brachytherapy
NCT01486563	PHASE4	COMPLETED	Hydroxyethyl Starch and Renal Function After Radical Prostatectomy
NCT01511874	PHASE4	COMPLETED	Efficacy and Safety Study of ELIGARD 22.5mg With Prostate Cancer
NCT01512472	PHASE4	TERMINATED	Firmagon (Degarelix) Intermittent Therapy
NCT01547416	PHASE4	COMPLETED	The Effect of Combined General/Epidural Anesthesia Versus General Anesthesia on Diaphragmatic Function
NCT01571544	PHASE4	COMPLETED	The Use of Thermal Suits as Preventing Hypothermia During Surgery
NCT01581749	PHASE4	UNKNOWN	Evaluation of Truebeam for Low-Intermediate Risk Prostate Cancer
NCT01649635	PHASE4	COMPLETED	Study of Cabazitaxel Combined With Prednisone and Prophylaxis of Neutropenia Complications in the Treatment of Patients With Metastatic Castration-resistant Prostate Cancer