SNORD13B-1

Summary

SNORD13B-1 (small nucleolar RNA, C/D box 13B-1, HGNC:52250) is a gene on chromosome 5q13.2.

Predicted to be involved in RNA processing. Predicted to be located in nucleolus.

Source: NCBI Gene 109617019 — RefSeq curated summary.

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:52250
Approved symbol	SNORD13B-1
Name	small nucleolar RNA, C/D box 13B-1
Location	5q13.2
Locus type	RNA, small nucleolar
Status	Approved
Entrez	109617019
RNAcentral	URS00006CAD88 — snoRNA, 104 nt, 3 organism(s)

Gene structure

Transcript identifiers

Ensembl transcripts: 0

RefSeq mRNA: 0 — MANE Select: None

Canonical transcript exons

None — 0 exons

Expression profiles

Top tissues by expression

0 total, by Bgee expression score (0-100, higher = more expressed):

Regulation

Is transcription factor: no

Cross-species orthologs

0 orthologs

Protein

Protein identifiers

Canonical reviewed UniProt: None (reviewed: )

All UniProt accessions (0):

RefSeq proteins (0): (*=MANE)

Domains & families (InterPro)

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 0 (showing top):

GO Biological Process (0):

GO Molecular Function (0):

GO Cellular Component (0):

Protein interactions and networks

STRING

0 interactions, top by confidence (×1000):

IntAct

0 interactions, top by confidence:

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

0 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

0 predictions. Top by Δscore:

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 233 via entrez): RS1008125837 (5:69538748 C>T), RS1014322793 (5:69539262 GACCAATTTGCAGAACTTTCATACATA>G), RS1019975765 (5:69538839 CTAAGT>C), RS1025494189 (5:69538730 A>T), RS1028995579 (5:69539042 A>G), RS1055474338 (5:69539750 C>A), RS111906095 (5:69539651 T>C), RS111963051 (5:69540631 G>A), RS1160516871 (5:69538703 T>C), RS1161962629 (5:69539681 C>T), RS1165866296 (5:69539065 G>A), RS1167791988 (5:69539281 C>G), RS1170957573 (5:69539116 A>G), RS1179247594 (5:69539556 C>CTTTTA), RS1179540027 (5:69538660 T>C)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 0 entries

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.