SNORD13B-1
gene geneOn this page
Summary
SNORD13B-1 (small nucleolar RNA, C/D box 13B-1, HGNC:52250) is a gene on chromosome 5q13.2.
Predicted to be involved in RNA processing. Predicted to be located in nucleolus.
Source: NCBI Gene 109617019 — RefSeq curated summary.
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:52250 |
| Approved symbol | SNORD13B-1 |
| Name | small nucleolar RNA, C/D box 13B-1 |
| Location | 5q13.2 |
| Locus type | RNA, small nucleolar |
| Status | Approved |
| Entrez | 109617019 |
| RNAcentral | URS00006CAD88 — snoRNA, 104 nt, 3 organism(s) |
Gene structure
Transcript identifiers
Ensembl transcripts: 0
RefSeq mRNA: 0 — MANE Select: None
Canonical transcript exons
None — 0 exons
Expression profiles
Top tissues by expression
0 total, by Bgee expression score (0-100, higher = more expressed):
Regulation
Is transcription factor: no
Cross-species orthologs
0 orthologs
Protein
Protein identifiers
Canonical reviewed UniProt: None (reviewed: )
All UniProt accessions (0):
RefSeq proteins (0): (*=MANE)
Domains & families (InterPro)
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
Function
Pathways and Gene Ontology
Reactome pathways
0 pathways
MSigDB gene sets: 0 (showing top):
GO Biological Process (0):
GO Molecular Function (0):
GO Cellular Component (0):
Protein interactions and networks
STRING
0 interactions, top by confidence (×1000):
IntAct
0 interactions, top by confidence:
SIGNOR signaling
0 interactions.
Disease & clinical
Clinical variants and AI predictions
ClinVar
0 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 0 |
| Likely pathogenic | 0 |
| Uncertain significance | 0 |
| Likely benign | 0 |
| Benign | 0 |
Top pathogenic / likely-pathogenic (0)
SpliceAI
0 predictions. Top by Δscore:
AlphaMissense
0 scored. Top likely-pathogenic:
dbSNP variants (sampled 233 via entrez): RS1008125837 (5:69538748 C>T), RS1014322793 (5:69539262 GACCAATTTGCAGAACTTTCATACATA>G), RS1019975765 (5:69538839 CTAAGT>C), RS1025494189 (5:69538730 A>T), RS1028995579 (5:69539042 A>G), RS1055474338 (5:69539750 C>A), RS111906095 (5:69539651 T>C), RS111963051 (5:69540631 G>A), RS1160516871 (5:69538703 T>C), RS1161962629 (5:69539681 C>T), RS1165866296 (5:69539065 G>A), RS1167791988 (5:69539281 C>G), RS1170957573 (5:69539116 A>G), RS1179247594 (5:69539556 C>CTTTTA), RS1179540027 (5:69538660 T>C)
Disease associations
OMIM: gene `` | disease phenotypes:
GenCC curated gene-disease
Mondo (0):
Orphanet (0):
HPO phenotypes
0 total (0 of 0 shown, HPO-id order):
GWAS associations
0 associations (top):
Drugs & pharmacology
Drug and pharmacology data
Is drug target: no
PharmGKB: 0 entries
Clinical trials (associated diseases)
0 trials via MONDO — disease-level, not drug-specific.
Related Atlas pages
No linked Atlas pages yet — the cross-entity mesh grows as the corpus expands.