SNRNP25

Summary

SNRNP25 (small nuclear ribonucleoprotein U11/U12 subunit 25, HGNC:14161) is a protein-coding gene on chromosome 16p13.3, encoding U11/U12 small nuclear ribonucleoprotein 25 kDa protein (Q9BV90). It is a common-essential gene (DepMap: required in 99.7% of cancer cell lines).

Two types of spliceosomes catalyze splicing of pre-mRNAs. The major U2-type spliceosome is found in all eukaryotes and removes U2-type introns, which represent more than 99% of pre-mRNA introns. The minor U12-type spliceosome is found in some eukaryotes and removes U12-type introns, which are rare and have distinct splice consensus signals. The U12-type spliceosome consists of several small nuclear RNAs and associated proteins. This gene encodes a 25K protein that is a component of the U12-type spliceosome.

Source: NCBI Gene 79622 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 28 total — 2 pathogenic
• Cancer dependency (DepMap): dependent in 99.7% of screened cell lines (common-essential)
• MANE Select transcript: NM_024571

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:14161
Approved symbol	SNRNP25
Name	small nuclear ribonucleoprotein U11/U12 subunit 25
Location	16p13.3
Locus type	gene with protein product
Status	Approved
Aliases	U11/U12-25K
Ensembl gene	ENSG00000161981
Ensembl biotype	protein_coding
Entrez	79622

Gene structure

Transcript identifiers

Ensembl transcripts: 7 — 3 protein_coding, 2 retained_intron, 1 nonsense_mediated_decay, 1 protein_coding_CDS_not_defined

ENST00000293861, ENST00000397876, ENST00000417493, ENST00000466183, ENST00000481947, ENST00000493672, ENST00000710415

RefSeq mRNA: 1 — MANE Select: NM_024571 NM_024571

CCDS: CCDS10396

Canonical transcript exons

ENST00000293861 — 5 exons

Exon	Start	End
ENSE00001313052	53828	54058
ENSE00001530524	57086	57669
ENSE00003608268	55777	55882
ENSE00003675612	55459	55549
ENSE00003790095	56539	56613

Expression profiles

Bgee: expression breadth ubiquitous, 280 present calls, max score 98.04.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 22.3622 / max 156.6170, expressed in 1818 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
151846	22.3622	1818

Top tissues by expression

291 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
pons	UBERON:0000988	98.04	gold quality
apex of heart	UBERON:0002098	97.08	gold quality
prefrontal cortex	UBERON:0000451	96.92	gold quality
lateral nuclear group of thalamus	UBERON:0002736	96.86	gold quality
anterior cingulate cortex	UBERON:0009835	96.75	gold quality
triceps brachii	UBERON:0001509	96.72	gold quality
cingulate cortex	UBERON:0003027	96.68	gold quality
right frontal lobe	UBERON:0002810	96.55	gold quality
diaphragm	UBERON:0001103	96.52	gold quality
frontal cortex	UBERON:0001870	96.28	gold quality
gluteal muscle	UBERON:0002000	96.28	gold quality
amygdala	UBERON:0001876	96.21	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	96.14	gold quality
vastus lateralis	UBERON:0001379	96.10	gold quality
neocortex	UBERON:0001950	96.01	gold quality
gastrocnemius	UBERON:0001388	95.94	gold quality
quadriceps femoris	UBERON:0001377	95.90	gold quality
nucleus accumbens	UBERON:0001882	95.69	gold quality
heart left ventricle	UBERON:0002084	95.64	gold quality
biceps brachii	UBERON:0001507	95.63	gold quality
cardiac ventricle	UBERON:0002082	95.63	gold quality
muscle organ	UBERON:0001630	95.61	gold quality
hindlimb stylopod muscle	UBERON:0004252	95.61	gold quality
skeletal muscle organ	UBERON:0014892	95.61	gold quality
Brodmann (1909) area 9	UBERON:0013540	95.60	gold quality
muscle of leg	UBERON:0001383	95.57	gold quality
heart right ventricle	UBERON:0002080	95.53	gold quality
cerebral cortex	UBERON:0000956	95.42	gold quality
caudate nucleus	UBERON:0001873	95.33	gold quality
putamen	UBERON:0001874	95.33	gold quality

Single-cell (SCXA)

Detected in 6 experiment(s), a significant marker in 5.

Experiment	Marker?	Max mean expression
E-HCAD-32	yes	334.86
E-HCAD-6	yes	32.97
E-GEOD-125970	yes	21.30
E-CURD-112	yes	11.37
E-HCAD-5	no	2.21
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

20 targeting SNRNP25, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-607	99.97	73.62	5593
HSA-MIR-5003-3P	99.85	69.29	2517
HSA-MIR-3150A-3P	99.76	64.44	1640
HSA-MIR-6763-5P	99.76	64.68	1767
HSA-MIR-4480	99.42	66.02	735
HSA-MIR-661	99.09	65.94	2062
HSA-MIR-628-5P	98.36	67.74	844
HSA-MIR-147A	98.33	66.40	795
HSA-MIR-4691-3P	98.11	66.83	1204
HSA-MIR-450A-2-3P	97.91	67.56	1459
HSA-MIR-6893-3P	97.79	64.91	1238
HSA-MIR-1972	97.67	67.38	1172
HSA-MIR-4640-5P	97.42	66.33	1543
HSA-MIR-4535	97.27	65.17	469
HSA-MIR-370-3P	97.09	64.92	1221
HSA-MIR-6750-3P	96.79	67.50	740
HSA-MIR-4264	96.35	64.76	1480
HSA-MIR-4761-3P	96.27	66.26	524
HSA-MIR-644A	96.02	66.52	786
HSA-MIR-4683	95.29	65.98	631

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 99.7% of screened cell lines, common-essential.

Literature-anchored findings (GeneRIF, showing 1)

• Two recurrent fusion genes associated with the 12q locus, LRP1-SNRNP25 and KCNMB4-CCND3, were by RT-PCR, Sanger sequencing and FISH, and were found to be osteosarcoma specific in a validation cohort of 240 other sarcomas. (PMID:25300797)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	snrnp25	ENSDARG00000020363
mus_musculus	Snrnp25	ENSMUSG00000040767
rattus_norvegicus	Snrnp25	ENSRNOG00000020626

Protein

Protein identifiers

U11/U12 small nuclear ribonucleoprotein 25 kDa protein — Q9BV90 (reviewed: Q9BV90)

Alternative names: Minus-99 protein

All UniProt accessions (4): A0AA34QW04, B8ZZ06, H7BYR9, Q4TT61

UniProt curated annotations — full annotation on UniProt →

Subunit / interactions. Component of the U11/U12 snRNPs that are part of the U12-type spliceosome.

Subcellular location. Nucleus.

RefSeq proteins (1): NP_078847* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000626	Ubiquitin-like_dom	Domain
IPR029071	Ubiquitin-like_domsf	Homologous_superfamily
IPR039690	SNRNP25	Family
IPR040610	SNRNP25_ubiquitin	Domain

Pfam: PF18036

UniProt features (16 total): strand 7, helix 5, chain 1, domain 1, turn 1, sequence conflict 1

Structure

Experimental structures (PDB)

5 structures.

PDB	Method	Resolution (Å)
9GCM	ELECTRON MICROSCOPY	3.1
8Y6O	ELECTRON MICROSCOPY	3.38
8R7N	ELECTRON MICROSCOPY	3.4
9GBZ	ELECTRON MICROSCOPY	3.4
9GBW	ELECTRON MICROSCOPY	3.5

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9BV90-F1	90.76	0.69

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-72165	mRNA Splicing - Minor Pathway

MSigDB gene sets: 188 (showing top): GSE18804_SPLEEN_MACROPHAGE_VS_BRAIN_TUMORAL_MACROPHAGE_DN, BUYTAERT_PHOTODYNAMIC_THERAPY_STRESS_DN, MODULE_255, ACEVEDO_NORMAL_TISSUE_ADJACENT_TO_LIVER_TUMOR_DN, MODULE_317, REACTOME_PROCESSING_OF_CAPPED_INTRON_CONTAINING_PRE_MRNA, GOBP_PROTEIN_RNA_COMPLEX_ORGANIZATION, GOBP_RNA_SPLICING, REACTOME_MRNA_SPLICING, TIEN_INTESTINE_PROBIOTICS_24HR_UP, FISCHER_DREAM_TARGETS, GOBP_RIBONUCLEOPROTEIN_COMPLEX_BIOGENESIS, REACTOME_METABOLISM_OF_RNA, GOCC_PRECATALYTIC_SPLICEOSOME, MARSON_BOUND_BY_FOXP3_STIMULATED

GO Biological Process (3): mRNA splicing, via spliceosome (GO:0000398), RNA splicing (GO:0008380), mRNA processing (GO:0006397)

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (6): nucleus (GO:0005634), nucleoplasm (GO:0005654), U12-type spliceosomal complex (GO:0005689), cytosol (GO:0005829), intercellular bridge (GO:0045171), spliceosomal complex (GO:0005681)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
mRNA Splicing	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
RNA processing	2
RNA splicing, via transesterification reactions with bulged adenosine as nucleophile	1
mRNA processing	1
mRNA metabolic process	1
binding	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
spliceosomal complex	1
cytoplasm	1
nuclear protein-containing complex	1
ribonucleoprotein complex	1

Protein interactions and networks

STRING

894 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SNRNP25	SNRNP48	Q6IEG0	809
SNRNP25	ZMAT5	Q9UDW3	778
SNRNP25	SNRNP35	Q16560	756
SNRNP25	ZCRB1	Q8TBF4	644
SNRNP25	NPRL3	Q12980	641
SNRNP25	RNPC3	Q96LT9	627
SNRNP25	RHBDF1	Q96CC6	626
SNRNP25	PDCD7	Q8N8D1	619
SNRNP25	MPG	P29372	513
SNRNP25	KCNMB4	Q86W47	479
SNRNP25	POLR3K	Q9Y2Y1	457
SNRNP25	HBQ1	P09105	410
SNRNP25	SNRPC	P09234	399
SNRNP25	SCN11A	Q9UI33	392
SNRNP25	ZFC3H1	O60293	381

IntAct

76 interactions, top by confidence:

A	B	Type	Score
EFHC2	SNRNP25	psi-mi:“MI:0915”(physical association)	0.720
SNRNP25	LHX4	psi-mi:“MI:0915”(physical association)	0.720
LHX4	SNRNP25	psi-mi:“MI:0915”(physical association)	0.720
SNRPD2	GEMIN2	psi-mi:“MI:0914”(association)	0.710
SF3B1	SAP18	psi-mi:“MI:0914”(association)	0.640
REL	SNRNP25	psi-mi:“MI:0915”(physical association)	0.560
SNRNP25	TRAF2	psi-mi:“MI:0915”(physical association)	0.560
KRT31	SNRNP25	psi-mi:“MI:0915”(physical association)	0.560
NKAPD1	SNRNP25	psi-mi:“MI:0915”(physical association)	0.560
CPSF7	SNRNP25	psi-mi:“MI:0915”(physical association)	0.560
SNRNP25	LNX1	psi-mi:“MI:0915”(physical association)	0.560
TRAF2	SNRNP25	psi-mi:“MI:0915”(physical association)	0.560
LNX1	SNRNP25	psi-mi:“MI:0915”(physical association)	0.560
SNRNP25	REL	psi-mi:“MI:0915”(physical association)	0.560
SNRNP25	NKAPD1	psi-mi:“MI:0915”(physical association)	0.560
SNRNP25	LHX3	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (39): SNRNP25 (Two-hybrid), SNRNP25 (Two-hybrid), SNRNP25 (Two-hybrid), SNRNP25 (Two-hybrid), CPSF7 (Two-hybrid), EFHC2 (Two-hybrid), LNX1 (Two-hybrid), LHX4 (Two-hybrid), SNRNP25 (Affinity Capture-RNA), SNRNP25 (Affinity Capture-RNA), SNRNP25 (Affinity Capture-RNA), SNRNP25 (Affinity Capture-MS), SNRNP25 (Affinity Capture-RNA), SNRNP25 (Affinity Capture-MS), SNRNP25 (Two-hybrid)

ESM2 similar proteins: A2VE61, A5PJM7, B5FWC0, D4ABL6, E9PV86, F1QH17, O35972, O95782, P0C2C0, P0C7P0, P13984, P17426, P52848, Q01750, Q02353, Q08200, Q16540, Q2T9L9, Q3SZB3, Q3SZX5, Q3UHN9, Q3UMR5, Q3ZCQ8, Q4V8I4, Q5R7B1, Q5RAH3, Q5RAJ8, Q5U4X8, Q63750, Q6IQS9, Q6P6G7, Q6P6Q9, Q6TH22, Q7ZYA7, Q86TD4, Q8BU88, Q8CIW5, Q8NE86, Q8R0A0, Q8TF64

Diamond homologs: Q3ZBQ4, Q84WS8, Q8VIK1, Q9BV90

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 34 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
mRNA Splicing - Minor Pathway	8	61.8×	4e-11
mRNA Splicing	8	30.3×	5e-09
mRNA Polyadenylation	9	27.3×	1e-09
CHD1 and CHD2 subfamily	7	26.2×	1e-07
Processing of Capped Intron-Containing Pre-mRNA	8	22.7×	3e-08
mRNA Splicing - Major Pathway	9	17.0×	3e-08
Metabolism of RNA	9	12.9×	3e-07
Dengue Virus-Host Interactions	8	12.6×	2e-06

GO biological processes:

GO term	Partners	Fold	FDR
U2-type prespliceosome assembly	8	161.1×	2e-14
mRNA splicing, via spliceosome	10	29.5×	6e-11
RNA splicing	9	25.6×	3e-09

Disease & clinical

Clinical variants and AI predictions

ClinVar

28 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	2
Likely pathogenic	0
Uncertain significance	20
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (2)

Variant ID	HGVS	Classification
1459499	NC_000016.9:g.(?97132)(163851_?)del	Pathogenic
443120	GRCh37/hg19 16p13.3-q24.3(chr16:85881-90155062)	Pathogenic

SpliceAI

503 predictions. Top by Δscore:

Variant	Effect	Δscore
16:54005:G:GT	donor_gain	1.0000
16:54057:AGG:A	donor_loss	1.0000
16:54058:GG:G	donor_loss	1.0000
16:55454:TGTAG:T	acceptor_loss	1.0000
16:55455:GTA:G	acceptor_loss	1.0000
16:55456:TAGG:T	acceptor_loss	1.0000
16:55548:GC:G	donor_gain	1.0000
16:55550:G:GG	donor_gain	1.0000
16:55758:T:G	acceptor_gain	1.0000
16:55760:T:A	acceptor_gain	1.0000
16:55762:T:TA	acceptor_gain	1.0000
16:55766:C:CA	acceptor_gain	1.0000
16:55768:T:TA	acceptor_gain	1.0000
16:55769:G:A	acceptor_gain	1.0000
16:55772:TGCAG:T	acceptor_loss	1.0000
16:55774:CA:C	acceptor_loss	1.0000
16:55775:A:AG	acceptor_gain	1.0000
16:55775:AGCC:A	acceptor_gain	1.0000
16:55776:G:GT	acceptor_gain	1.0000
16:55776:GC:G	acceptor_gain	1.0000
16:55776:GCC:G	acceptor_gain	1.0000
16:55776:GCCG:G	acceptor_gain	1.0000
16:55776:GCCGT:G	acceptor_gain	1.0000
16:55879:GCTG:G	donor_gain	1.0000
16:55880:CTG:C	donor_gain	1.0000
16:55880:CTGGT:C	donor_loss	1.0000
16:55881:TGGTA:T	donor_loss	1.0000
16:55883:G:C	donor_loss	1.0000
16:55883:G:GG	donor_gain	1.0000
16:55884:T:G	donor_loss	1.0000

AlphaMissense

794 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
16:55517:T:A	V43D	0.999
16:55813:T:C	L66P	0.999
16:55881:T:A	W89R	0.997
16:55881:T:C	W89R	0.997
16:55502:G:A	G38D	0.996
16:55502:G:T	G38V	0.996
16:55817:G:C	K67N	0.996
16:55817:G:T	K67N	0.996
16:56607:T:A	L112H	0.995
16:54048:T:C	L20P	0.994
16:55493:T:C	L35P	0.994
16:55507:G:C	A40P	0.994
16:55821:G:C	A69P	0.994
16:56549:T:A	W93R	0.994
16:56549:T:C	W93R	0.994
16:57118:T:C	F125S	0.993
16:55480:T:C	S31P	0.992
16:55489:G:C	A34P	0.992
16:55783:T:A	V56D	0.991
16:55804:T:A	V63D	0.991
16:56565:T:A	L98Q	0.991
16:57125:A:C	K127N	0.991
16:57125:A:T	K127N	0.991
16:55471:G:A	E28K	0.990
16:55475:T:A	V29D	0.990
16:55508:C:A	A40E	0.990
16:55813:T:A	L66Q	0.990
16:55825:T:A	I70N	0.990
16:55855:G:C	R80P	0.990
16:55523:T:A	V45E	0.989

dbSNP variants (sampled 300 via entrez): RS1000268642 (16:54809 C>G,T), RS1001032004 (16:54278 A>G), RS1001400177 (16:55006 A>C,G,T), RS1001463169 (16:54071 G>A,C,T), RS1001860029 (16:51879 G>A), RS1002108361 (16:54354 G>T), RS1002465878 (16:56001 AAGTGATGAGCTCCCTGTCACAAG>A,AAGTGATGAGCTCCCTGTCACAAGAGTGATGAGCTCCCTGTCACAAG), RS1002565896 (16:54202 C>T), RS1002662794 (16:58116 G>A), RS1003039371 (16:56416 C>T), RS1003163172 (16:53175 C>T), RS1003572117 (16:52945 GGTGGC>G), RS1003614129 (16:57076 T>C), RS1003666343 (16:56863 G>A), RS1004306590 (16:52825 T>A,C)

Disease associations

OMIM: gene `` | disease phenotypes: MIM:617118

GenCC curated gene-disease

Mondo (1): epilepsy, familial focal, with variable foci 3 (MONDO:0014925)

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST005951_12	Body mass index	5.000000e-11

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0004340	body mass index

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

37 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, increases abundance, increases expression	4
Cyclosporine	decreases expression	3
Particulate Matter	decreases expression, increases abundance, affects cotreatment	3
bisphenol A	affects expression, decreases expression	2
Air Pollutants	decreases expression, increases abundance	2
Cisplatin	affects cotreatment, increases expression	2
Doxorubicin	decreases expression, affects response to substance	2
triphenyl phosphate	affects expression	1
salinomycin	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
cobaltous chloride	decreases expression	1
2,3-bis(3’-hydroxybenzyl)butyrolactone	affects cotreatment, increases expression	1
isobutyl alcohol	decreases expression, increases abundance, affects cotreatment	1
K 7174	decreases expression	1
erucylphospho-N,N,N-trimethylpropylammonium	decreases expression	1
jinfukang	affects cotreatment, increases expression	1
NSC 689534	affects binding, decreases expression	1
Resveratrol	affects cotreatment, increases expression	1
Temozolomide	increases expression	1
Arsenic	decreases expression, increases abundance	1
Atrazine	decreases expression	1
Copper	affects binding, decreases expression	1
Coumestrol	affects cotreatment, increases expression	1
Gasoline	decreases expression, increases abundance, affects cotreatment	1
Phthalic Acids	increases methylation	1
Polycyclic Aromatic Hydrocarbons	decreases expression, increases abundance, affects cotreatment	1
Thiram	decreases expression	1
Tunicamycin	decreases expression	1
Urethane	decreases expression	1
Valproic Acid	increases methylation	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.