SOX17

Summary

SOX17 (SRY-box transcription factor 17, HGNC:18122) is a protein-coding gene on chromosome 8q11.23, encoding Transcription factor SOX-17 (Q9H6I2). Acts as a transcription regulator that binds target promoter DNA.

This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins.

Source: NCBI Gene 64321 — RefSeq curated summary.

At a glance

• Gene–disease (curated): pulmonary arterial hypertension (Definitive, ClinGen) — +2 more curated relationships
• GWAS associations: 28
• Clinical variants (ClinVar): 272 total — 6 pathogenic, 5 likely-pathogenic
• Phenotypes (HPO): 62
• Druggable target: yes
• Cancer driver (intOGen): activating (oncogene-like) across 1 cancer types
• Transcription factor: yes — 51 downstream targets (CollecTRI)
• MANE Select transcript: NM_022454

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:18122
Approved symbol	SOX17
Name	SRY-box transcription factor 17
Location	8q11.23
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000164736
Ensembl biotype	protein_coding
OMIM	610928
Entrez	64321

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000297316

RefSeq mRNA: 1 — MANE Select: NM_022454 NM_022454

CCDS: CCDS6159

Canonical transcript exons

ENST00000297316 — 2 exons

Exon	Start	End
ENSE00001087025	54457935	54458445
ENSE00001087027	54459058	54460892

Expression profiles

Bgee: expression breadth ubiquitous, 190 present calls, max score 91.20.

FANTOM5 (CAGE): breadth broad, TPM avg 10.6306 / max 256.4264, expressed in 587 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
88870	10.1345	584
88872	0.3144	171
88873	0.0912	59
88871	0.0906	56

Top tissues by expression

270 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
endothelial cell	CL:0000115	91.20	gold quality
omental fat pad	UBERON:0010414	90.57	gold quality
peritoneum	UBERON:0002358	90.56	gold quality
pericardium	UBERON:0002407	89.64	gold quality
endometrium	UBERON:0001295	89.17	gold quality
adipose tissue of abdominal region	UBERON:0007808	89.11	gold quality
right uterine tube	UBERON:0001302	87.76	gold quality
vena cava	UBERON:0004087	86.73	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	85.97	gold quality
left uterine tube	UBERON:0001303	85.46	gold quality
tibial nerve	UBERON:0001323	84.70	gold quality
subcutaneous adipose tissue	UBERON:0002190	83.33	gold quality
hindlimb stylopod muscle	UBERON:0004252	81.52	gold quality
uterus	UBERON:0000995	81.49	gold quality
endocervix	UBERON:0000458	81.31	gold quality
adipose tissue	UBERON:0001013	81.01	gold quality
mucosa of stomach	UBERON:0001199	80.91	gold quality
apex of heart	UBERON:0002098	80.69	gold quality
body of uterus	UBERON:0009853	80.50	gold quality
connective tissue	UBERON:0002384	79.82	gold quality
heart left ventricle	UBERON:0002084	79.23	gold quality
spleen	UBERON:0002106	79.00	gold quality
cardiac ventricle	UBERON:0002082	78.95	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	78.57	gold quality
gastrocnemius	UBERON:0001388	78.36	gold quality
left coronary artery	UBERON:0001626	78.08	gold quality
gall bladder	UBERON:0002110	78.08	gold quality
diaphragm	UBERON:0001103	78.02	gold quality
right lung	UBERON:0002167	77.64	gold quality
fallopian tube	UBERON:0003889	77.39	gold quality

Single-cell (SCXA)

Detected in 9 experiment(s), a significant marker in 6.

Experiment	Marker?	Max mean expression
E-MTAB-7008	yes	1238.31
E-GEOD-135922	yes	667.36
E-MTAB-10137	yes	578.14
E-MTAB-10287	yes	53.16
E-GEOD-109979	yes	44.65
E-MTAB-10283	no	637.18
E-MTAB-8271	no	448.95
E-MTAB-6524	no	46.38
E-ANND-3	no	0.00

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

51 targets.

Target	Regulation
ACAN	Activation
ACHE
ADAM2
ADRA1D
AXIN2
BCL2
CCND1	Unknown
CDKN1A	Repression
CDKN1C	Repression
CDKN2B
CEL
COL2A1	Activation
COMP
CRYAB
CSNK1A1	Repression
CTNNB1	Repression
CXCR4	Repression
CYP17A1
DMRT1
ESR1
FGF4
FN1	Repression
HNF4A	Activation
HP
HSPB2
IBSP
IER3	Repression
KDR
LAMA1	Unknown
LEF1	Unknown

Upstream regulators (CollecTRI, top): EZH2, GATA5, HOXA1, KLF5, NANOG, PITX2, POU5F1, SALL4, SOX17, SP1, SRY, TFAP2A

miRNA regulators (miRDB)

65 targeting SOX17, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-196A-1-3P	99.99	72.15	2772
HSA-MIR-548AN	99.97	70.91	2817
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345
HSA-MIR-141-3P	99.94	72.79	2421
HSA-MIR-200A-3P	99.94	72.68	2420
HSA-MIR-539-5P	99.93	70.30	2855
HSA-MIR-329-3P	99.91	66.56	1234
HSA-MIR-362-3P	99.91	66.38	1267
HSA-MIR-1297	99.91	73.41	3162
HSA-MIR-95-5P	99.89	72.17	3973
HSA-MIR-548D-3P	99.87	70.67	4362
HSA-MIR-548BB-3P	99.86	70.58	4354
HSA-MIR-548AC	99.84	70.77	4351
HSA-MIR-548H-3P	99.84	70.80	4349
HSA-MIR-548Z	99.84	70.80	4349
HSA-MIR-3180-5P	99.82	69.12	2422
HSA-MIR-3913-5P	99.78	67.26	968
HSA-MIR-26A-5P	99.78	73.52	2303
HSA-MIR-26B-5P	99.78	73.51	2305
HSA-MIR-548AG	99.77	69.25	1492
HSA-MIR-1255A	99.74	68.09	744
HSA-MIR-1255B-5P	99.74	68.16	741
HSA-MIR-4465	99.71	72.56	2096
HSA-MIR-33A-3P	99.70	70.27	3362
HSA-MIR-548AI	99.69	69.24	1494
HSA-MIR-548BA	99.69	69.14	1514
HSA-MIR-570-5P	99.69	69.24	1494
HSA-MIR-3122	99.50	66.33	821

Literature-anchored findings (GeneRIF, showing 40)

• SOX17 silencing due to promoter hypermethylation is an early event during tumorigenesis and may contribute to aberrant activation of Wnt signaling in colorectal cancer. (PMID:18413743)
• SOX17-Chromatin immunoprecipitation identified zinc finger protein 202 (Zfp202) as a direct target of SOX17 during endoderm differentiation of F9 embryonal carcinoma cells. (PMID:18523156)
• stable endoderm progenitors can be established from human ES cells by constitutive expression of SOX17 producing definitive endoderm progenitors (PMID:18682240)
• stable expression induces a stable expandable definitive endoderm phenotype in hESCs (PMID:18940723)
• Sox17 may be a valuable biomarker for the study of breast cancer carcinogenesis and progression. (PMID:19301122)
• SOX2 and SOX17 expression patterns can distinguish between seminoma and embryonal carcinoma, and this distinction may be diagnostically useful. (PMID:19369635)
• Sox17 protects benign tumors from malignant progression at an early stage of tumorigenesis, and down-regulation of Sox17 contributes to malignant progression through promotion of Wnt activity. (PMID:19549530)
• Data reveal a molecular Oct4-, Sox2- and Sox17-mediated mechanism that disrupts the stem cell microenvironment favoring pluripotency to provide an endodermal environment in which cell lineage is determined and commits the cells to a cardiogenic fate. (PMID:19736317)
• SOX17 negatively regulates canonical WNT/beta-catenin signaling pathway and inhibits human HCC cells growth (PMID:20716954)
• These data indicate a role of SOX17 in human kidney and urinary tract development and implicate the SOX17-p.Y259N mutation as a causative factor in congenital anomalies of the kidney and the urinary tract . (PMID:20960469)
• Data show that down-regulated by Sox17 expressing HepG2 cells is a set of genes that are expressed in the developing liver, suggesting that one function of Sox17 is the repression of liver gene expression. (PMID:21305474)
• SOX17(+)-human embryonic stem cell progeny expressed endodermal markers. (PMID:21362573)
• Sox17 might be a key transcription factor controlling CD133 expression, and that it might also play a role in the control of gastric tumor progression. (PMID:21457403)
• Sox17 prominently contributes to gastric cancer progression through regulating proliferation and cell cycle, indicating a novel diagnosis and prognosis biomarker as well as a potential therapeutic target in gastric cancer (PMID:21514720)
• A stage-specific transduction of SOX17 in the primitive endoderm or mesendoderm promotes directive extraembryonic endoderm or definitive endoderm differentiation by SOX17 transduction, respectively. (PMID:21760905)
• Downstream targets of Sox17 define signaling pathways and molecular mechanisms in oligodendrocyte progenitor cells that are regulated by Sox17 during cell cycle exit and differentiation in oligodendrocyte development. (PMID:21957254)
• silencing of Sox17 occurs frequently in early gastric cancer (PMID:22161215)
• New sequence variations in SOX17 were identified but all correspond to nonpathogenic variants, suggesting that SOX17 is not involved in UHL phenotype (PMID:22348788)
• SOX17 acts as a Wnt signaling inhibitor. (PMID:22846201)
• SOX17 promoter region is frequently methylated in esophageal cancer and in a progression tendency during esophageal carcinogenesis. (PMID:22921431)
• provided further evidence to support the previously reported association of intracranial aneurysm with single nucleotide polymorphism in SOX17 (PMID:22961961)
• SOX17 was frequently methylated in human PTC. Loss of SOX17 expression was induced by promoter region hypermethylation. SOX17 inhibited thyroid cancer proliferation. Methylation of SOX17 activated the Wnt signaling pathway in human thyroid cancer. (PMID:23044318)
• after electrostatic interactions attract Sox17 to DNA, Asn73, Ser99, and Trp106 form hydrogen bonds with DNA, Arg70, Lys80, Arg83, His94, and Asn95 on Sox17 undergo conformational changes and form hydrogen bonds with DNA (PMID:23061670)
• SOX17 promoter is highly methylated in primary breast tumors, in CTCs isolated from patients with breast cancer, and in corresponding cfDNA samples (PMID:23136251)
• SOX17 plays a key role in priming hemogenic potential in endothelial cells, thereby regulating hematopoietic development from stem cells. (PMID:23169777)
• findings establish Sox17 as a key regulator of tumor angiogenesis and tumor progression. (PMID:23241958)
• Overall survival of patients with gastric cancer was found to be significantly associated with SOX17 promoter methylation. (PMID:23403728)
• recombinant Sox17 mediates modulation of the Wnt pathway through changes in beta-catenin, SFRP1 and Wnt/Frizzled expression. (PMID:23474492)
• Experimental confirmation of miRNA-mRNA interactions established a critical role of miR-200a in regulating both EMT and definitive endoderm formation, through direct repression of ZEB2 and SOX17, during early stage differentiation. (PMID:23813959)
• In multiple sclerosis tissue, Sox17 was primarily detected in actively demyelinating lesions and periplaque white matter. (PMID:23918253)
• Immunofluorescence analysis of human pancreatic tissue arrays revealed the presence of tuft cells in metaplasia and early-stage tumors, along with SOX17 expression, consistent with a biliary phenotype. (PMID:23999170)
• Low SOX17 expression is associated with esophageal cancer progression. (PMID:24407731)
• Possible association of SOX-17 and RBBP8 with brain arteriovenous malformations, genes involved in cell cycle progression, deserves further investigation (PMID:25053769)
• Low Sox17 expression is associated with hepatocellular carcinoma. (PMID:25106407)
• Hypermethylation of SOX17 promoter may be one of the early events in the development of myelodysplatic syndrome and predicts poor prognosis. (PMID:25291942)
• Decreased Sox17 expression is correlated with melanoma progression, an unfavorable survival of melanoma patients and is an independent molecular prognostic factor for melanoma. (PMID:25310020)
• SOX17 is the key regulator of human primordial germ cells-like cells specification, whereas BLIMP1 represses endodermal and other somatic genes during hPGCLC specification. (PMID:25543152)
• Human intracranial aneurysm samples showed reduced Sox17 expression and impaired endothelial integrity. (PMID:25596186)
• In this study, oligodendroglioma patients with 1p/19q LOH and Sox17 protein expression had a better prognosis. (PMID:25674225)
• promoter methylation may play an important role in breast cancer progression and could be used as a prognostic biomarker to identify patients at risk of developing metastasis or recurrence after mastectomy (PMID:25789956)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	sox17	ENSDARG00000101717
mus_musculus	Sox17	ENSMUSG00000025902
rattus_norvegicus	Sox17	ENSRNOG00000027357
drosophila_melanogaster	Sox14	FBGN0005612
drosophila_melanogaster	Sox21a	FBGN0036411

Paralogs (20): SOX8 (ENSG00000005513), SOX30 (ENSG00000039600), SOX10 (ENSG00000100146), SOX6 (ENSG00000110693), SOX4 (ENSG00000124766), SOX21 (ENSG00000125285), SOX9 (ENSG00000125398), SOX15 (ENSG00000129194), SOX5 (ENSG00000134532), SOX3 (ENSG00000134595), SOX13 (ENSG00000143842), SOX14 (ENSG00000168875), SOX7 (ENSG00000171056), SOX11 (ENSG00000176887), SOX12 (ENSG00000177732), CFAP65 (ENSG00000181378), SOX2 (ENSG00000181449), SOX1 (ENSG00000182968), SRY (ENSG00000184895), SOX18 (ENSG00000203883)

Protein

Protein identifiers

Transcription factor SOX-17 — Q9H6I2 (reviewed: Q9H6I2)

All UniProt accessions (1): Q9H6I2

UniProt curated annotations — full annotation on UniProt →

Function. Acts as a transcription regulator that binds target promoter DNA. Binds to the sequences 5’-AACAAT-‘3 or 5’-AACAAAG-3’. Modulates transcriptional regulation via WNT3A. Inhibits Wnt signaling. Promotes degradation of activated CTNNB1. Plays a key role in the regulation of embryonic development. Required for normal development of the definitive gut endoderm. Required for normal looping of the embryonic heart tube. Plays an important role in embryonic and postnatal vascular development, including development of arteries. Plays an important role in postnatal angiogenesis, where it is functionally redundant with SOX18. Required for the generation and maintenance of fetal hematopoietic stem cells, and for fetal hematopoiesis. Probable transcriptional activator in the premeiotic germ cells.

Subunit / interactions. Interacts with CTNNB1, LEF1 and TCF4.

Subcellular location. Nucleus.

Tissue specificity. Expressed in adult heart, lung, spleen, testis, ovary, placenta, fetal lung, and kidney. In normal gastrointestinal tract, it is preferentially expressed in esophagus, stomach and small intestine than in colon and rectum.

Disease relevance. Vesicoureteral reflux 3 (VUR3) [MIM:613674] A disease belonging to the group of congenital anomalies of the kidney and urinary tract. It is characterized by the reflux of urine from the bladder into the ureters and sometimes into the kidneys, and is a risk factor for urinary tract infections. Primary disease results from a developmental defect of the ureterovesical junction. In combination with intrarenal reflux, the resulting inflammatory reaction may result in renal injury or scarring, also called reflux nephropathy. Extensive renal scarring impairs renal function and may predispose patients to hypertension, proteinuria, renal insufficiency and end-stage renal disease. The disease is caused by variants affecting the gene represented in this entry. Pulmonary hypertension, primary, 7 (PPH7) [MIM:621248] A form of primary pulmonary hypertension, a disease defined by plexiform lesions of proliferating endothelial cells in pulmonary arterioles. The lesions lead to elevated pulmonary arterial pression, right ventricular failure, and death. Primary pulmonary hypertension exhibits incomplete penetrance, sex bias and variable age of onset, both within and between families. PPH7 is an autosomal dominant form. The disease is caused by variants affecting the gene represented in this entry.

Domain organisation. The 9aaTAD motif is a transactivation domain present in a large number of yeast and animal transcription factors.

RefSeq proteins (1): NP_071899* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR009071	HMG_box_dom	Domain
IPR021934	Sox_C	Domain
IPR033392	Sox7/17/18_central	Domain
IPR036910	HMG_box_dom_sf	Homologous_superfamily
IPR050140	SRY-related_HMG-box_TF-like	Family

Pfam: PF00505, PF12067

UniProt features (41 total): sequence variant 28, region of interest 4, helix 3, compositionally biased region 2, chain 1, domain 1, DNA-binding region 1, short sequence motif 1

Structure

Experimental structures (PDB)

2 structures.

PDB	Method	Resolution (Å)
4A3N	X-RAY DIFFRACTION	2.4
2YUL	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9H6I2-F1	58.95	0.20

Function

Pathways and Gene Ontology

Reactome pathways

12 pathways

ID	Pathway
R-HSA-3769402	Deactivation of the beta-catenin transactivating complex
R-HSA-9823730	Formation of definitive endoderm
R-HSA-9827857	Specification of primordial germ cells
R-HSA-9937080	Developmental Lineage of Multipotent Pancreatic Progenitor Cells
R-HSA-1266738	Developmental Biology
R-HSA-1474165	Reproduction
R-HSA-162582	Signal Transduction
R-HSA-195721	Signaling by WNT
R-HSA-201681	TCF dependent signaling in response to WNT
R-HSA-9734767	Developmental Cell Lineages
R-HSA-9758941	Gastrulation
R-HSA-9925561	Developmental Lineage of Pancreatic Acinar Cells

MSigDB gene sets: 253 (showing top): GOBP_MORPHOGENESIS_OF_AN_EPITHELIUM, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, GOBP_HEPATICOBILIARY_SYSTEM_DEVELOPMENT, GOBP_EMBRYO_DEVELOPMENT_ENDING_IN_BIRTH_OR_EGG_HATCHING, GOBP_EPITHELIUM_DEVELOPMENT, GOBP_URETER_DEVELOPMENT, WALLACE_PROSTATE_CANCER_RACE_UP, BENPORATH_ES_WITH_H3K27ME3, GOBP_METANEPHROS_DEVELOPMENT, GOBP_RESPONSE_TO_PEPTIDE, GOBP_FORMATION_OF_PRIMARY_GERM_LAYER, GOBP_NEGATIVE_REGULATION_OF_CELL_GROWTH, GOBP_GROWTH, GOBP_POSITIVE_REGULATION_OF_PROTEIN_CATABOLIC_PROCESS, GOBP_MACROMOLECULE_CATABOLIC_PROCESS

GO Biological Process (56): angiogenesis (GO:0001525), vasculogenesis (GO:0001570), metanephros development (GO:0001656), endoderm formation (GO:0001706), endodermal cell fate specification (GO:0001714), inner cell mass cellular morphogenesis (GO:0001828), heart looping (GO:0001947), cardiogenic plate morphogenesis (GO:0003142), embryonic heart tube morphogenesis (GO:0003143), outflow tract morphogenesis (GO:0003151), regulation of DNA-templated transcription (GO:0006355), regulation of transcription by RNA polymerase II (GO:0006357), spermatogenesis (GO:0007283), endodermal cell fate determination (GO:0007493), heart development (GO:0007507), gene expression (GO:0010467), positive regulation of gene expression (GO:0010628), Wnt signaling pathway (GO:0016055), rostrocaudal neural tube patterning (GO:0021903), signal transduction involved in regulation of gene expression (GO:0023019), negative regulation of cell growth (GO:0030308), protein destabilization (GO:0031648), embryonic heart tube development (GO:0035050), cell migration involved in gastrulation (GO:0042074), response to alkaloid (GO:0043279), positive regulation of protein catabolic process (GO:0045732), positive regulation of DNA-templated transcription (GO:0045893), positive regulation of transcription by RNA polymerase II (GO:0045944), regulation of embryonic development (GO:0045995), embryonic foregut morphogenesis (GO:0048617), stem cell fate specification (GO:0048866), protein stabilization (GO:0050821), endocardium formation (GO:0060214), cardiac cell fate determination (GO:0060913), heart formation (GO:0060914), endocardial cell differentiation (GO:0060956), common bile duct development (GO:0061009), gallbladder development (GO:0061010), endodermal digestive tract morphogenesis (GO:0061031), regulation of stem cell proliferation (GO:0072091)

GO Molecular Function (11): transcription cis-regulatory region binding (GO:0000976), RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), DNA-binding transcription activator activity, RNA polymerase II-specific (GO:0001228), beta-catenin binding (GO:0008013), RNA polymerase II-specific DNA-binding transcription factor binding (GO:0061629), DNA binding (GO:0003677), DNA-binding transcription factor activity (GO:0003700), protein binding (GO:0005515), sequence-specific DNA binding (GO:0043565), sequence-specific double-stranded DNA binding (GO:1990837)

GO Cellular Component (4): chromatin (GO:0000785), nucleus (GO:0005634), nucleoplasm (GO:0005654), transcription regulator complex (GO:0005667)

Reactome top-level categories

Rollup of top-7 pathways:

Category	Pathways
Developmental Cell Lineages of the Exocrine Pancreas	2
Developmental Biology	2
TCF dependent signaling in response to WNT	1
Gastrulation	1
Reproduction	1
Signal Transduction	1
Signaling by WNT	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
heart morphogenesis	3
regulation of gene expression	3
RNA polymerase II transcription regulatory region sequence-specific DNA binding	3
blood vessel morphogenesis	2
endodermal cell fate commitment	2
embryonic morphogenesis	2
anatomical structure morphogenesis	2
regulation of DNA-templated transcription	2
cellular anatomical structure	2
anatomical structure formation involved in morphogenesis	1
cell differentiation	1
kidney development	1
formation of primary germ layer	1
endoderm development	1
cell fate specification	1
cell morphogenesis	1
inner cell mass cell differentiation	1
embryonic heart tube morphogenesis	1
determination of heart left/right asymmetry	1
embryonic heart tube development	1
embryonic organ morphogenesis	1
epithelial tube morphogenesis	1
DNA-templated transcription	1
regulation of RNA biosynthetic process	1
transcription by RNA polymerase II	1
developmental process involved in reproduction	1
male gamete generation	1
cell fate determination	1
animal organ development	1
circulatory system development	1
macromolecule biosynthetic process	1
gene expression	1
positive regulation of macromolecule biosynthetic process	1
cell surface receptor signaling pathway	1
anterior/posterior pattern specification	1
neural tube patterning	1
signal transduction	1
transcription regulatory region nucleic acid binding	1
sequence-specific double-stranded DNA binding	1
cis-regulatory region sequence-specific DNA binding	1

Protein interactions and networks

STRING

2682 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SOX17	POU5F1	P31359	984
SOX17	FOXA2	Q9Y261	940
SOX17	CTNNB1	P35222	914
SOX17	GATA4	P43694	875
SOX17	NANOG	Q9H9S0	858
SOX17	GATA6	P78327	846
SOX17	MIXL1	Q9H2W2	839
SOX17	PAX6	P26367	809
SOX17	MESP1	Q9BRJ9	802
SOX17	HNF4A	P41235	798
SOX17	CDX2	Q99626	794
SOX17	FOXA1	P55317	783
SOX17	ROBO2	Q9HCK4	764
SOX17	WNT3A	P56704	750
SOX17	EOMES	O95936	746

IntAct

9 interactions, top by confidence:

A	B	Type	Score
SOX17	CTNNB1	psi-mi:“MI:0914”(association)	0.500
CTNNB1	SOX17	psi-mi:“MI:0915”(physical association)	0.500
NFIA	SOX17	psi-mi:“MI:0915”(physical association)	0.470
NFIB	SOX17	psi-mi:“MI:0915”(physical association)	0.470
NFIC	SOX17	psi-mi:“MI:0915”(physical association)	0.400
APBA3	SOX17	psi-mi:“MI:0915”(physical association)	0.370
SOX17	EEFSEC	psi-mi:“MI:0914”(association)	0.350
SOX17	BCL9	psi-mi:“MI:2364”(proximity)	0.270

BioGRID (81): RPL38 (Affinity Capture-MS), HOMER3 (Affinity Capture-MS), EBNA1BP2 (Affinity Capture-MS), EEFSEC (Affinity Capture-MS), KDM6A (Proximity Label-MS), POU2F1 (Proximity Label-MS), HOXA5 (Proximity Label-MS), SMARCA2 (Proximity Label-MS), SALL1 (Proximity Label-MS), TRPS1 (Proximity Label-MS), BCL9 (Proximity Label-MS), NFIB (Proximity Label-MS), ARID1A (Proximity Label-MS), KMT2D (Proximity Label-MS), ZNF609 (Proximity Label-MS)

ESM2 similar proteins: A2A9A2, A4QNP7, A6QQ94, A6YP92, A7M7C7, A7MB54, B5RHS5, M0R6D8, O09029, O35085, P28360, P41225, P43694, P46153, P50548, P78414, P78415, P79772, P81067, P81068, P84550, P84551, Q08369, Q0Q0E4, Q14549, Q14774, Q2I327, Q2MJB4, Q2VL84, Q2VL87, Q2VL88, Q2VWA4, Q3SZJ5, Q4AE28, Q61169, Q61345, Q6YHU8, Q71T09, Q76L87, Q7TQ40

Diamond homologs: A0A0G2JTZ2, A2TED3, A5D8R3, B1H349, B3DLD3, B3DM43, F1M8W4, O42342, O42601, P0C1G9, P35710, P35711, P35712, P35713, P35716, P36389, P36390, P36393, P36394, P36396, P40645, P40646, P40647, P40649, P40650, P40656, P40657, P43680, P47792, P48433, P48435, Q03255, Q03257, Q04891, Q05738, Q06831, Q06945, Q20201, Q23045, Q27949

SIGNOR signaling

6 interactions.

A	Effect	B	Mechanism
POU5F1	“down-regulates quantity by repression”	SOX17	“transcriptional regulation”
NANOG	“down-regulates quantity by repression”	SOX17	“transcriptional regulation”
SOX17	down-regulates	CTNNB1	binding
SOX17	up-regulates	GLI2
SOX17	“down-regulates activity”	CTNNB1
SOX17	“form complex”	SOX17/POU5F1	binding

Disease & clinical

Cancer significance

From intOGen — cancer-driver classification: activating (oncogene-like) across 1 cancer types — UCEC.

Clinical variants and AI predictions

ClinVar

272 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	6
Likely pathogenic	5
Uncertain significance	176
Likely benign	54
Benign	16

Top pathogenic / likely-pathogenic (11)

Variant ID	HGVS	Classification
1527900	NM_022454.4(SOX17):c.314C>A (p.Ser105Ter)	Pathogenic
18415	SOX17, 6-BP INS, NT51	Pathogenic
3906893	SOX17, TYR137TER	Pathogenic
3906894	Q127*	Pathogenic
3906895	SOX17, 22-BP DEL, NT499	Pathogenic
817453	NM_022454.4(SOX17):c.499_520del (p.Leu167fs)	Pathogenic
1188434	NM_022454.4(SOX17):c.404A>G (p.Tyr135Cys)	Likely pathogenic
2584495	NM_022454.4(SOX17):c.208C>G (p.Arg70Gly)	Likely pathogenic
2683958	NM_022454.4(SOX17):c.245A>G (p.Glu82Gly)	Likely pathogenic
3900765	NM_022454.4(SOX17):c.209G>A (p.Arg70Gln)	Likely pathogenic
4530598	NM_022454.4(SOX17):c.413G>C (p.Arg138Pro)	Likely pathogenic

SpliceAI

174 predictions. Top by Δscore:

Variant	Effect	Δscore
8:54458443:TGGG:T	donor_loss	1.0000
8:54458444:GG:G	donor_gain	1.0000
8:54458445:GG:G	donor_gain	1.0000
8:54458446:G:GG	donor_gain	1.0000
8:54458446:GTGA:G	donor_loss	1.0000
8:54458447:T:A	donor_loss	1.0000
8:54459049:A:AG	acceptor_gain	1.0000
8:54459049:ACT:A	acceptor_gain	1.0000
8:54459050:C:G	acceptor_gain	1.0000
8:54459051:T:A	acceptor_gain	1.0000
8:54459053:T:TA	acceptor_gain	1.0000
8:54459055:CAGGC:C	acceptor_loss	1.0000
8:54459056:A:AG	acceptor_gain	1.0000
8:54459057:G:GG	acceptor_gain	1.0000
8:54459057:GGCAA:G	acceptor_gain	1.0000
8:54458430:T:G	donor_gain	0.9900
8:54458441:GCTGG:G	donor_gain	0.9900
8:54459049:ACTGT:A	acceptor_gain	0.9900
8:54459056:AG:A	acceptor_gain	0.9900
8:54459057:GG:G	acceptor_gain	0.9900
8:54459057:GGC:G	acceptor_gain	0.9900
8:54459057:GGCA:G	acceptor_gain	0.9900
8:54458443:TGG:T	donor_gain	0.9700
8:54458444:GGG:G	donor_gain	0.9700
8:54458442:CTGG:C	donor_gain	0.9600
8:54459055:CAGG:C	acceptor_gain	0.9500
8:54459056:AGGC:A	acceptor_gain	0.9500
8:54458450:G:C	donor_loss	0.9300
8:54459053:TGCA:T	acceptor_gain	0.9300
8:54459054:GCAG:G	acceptor_gain	0.9300

AlphaMissense

2685 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
8:54458341:T:A	I68N	1.000
8:54458341:T:C	I68T	1.000
8:54458341:T:G	I68S	1.000
8:54458346:C:G	R70G	1.000
8:54458346:C:T	R70W	1.000
8:54458347:G:A	R70Q	1.000
8:54458349:C:A	P71T	1.000
8:54458349:C:G	P71A	1.000
8:54458349:C:T	P71S	1.000
8:54458350:C:A	P71Q	1.000
8:54458350:C:G	P71R	1.000
8:54458350:C:T	P71L	1.000
8:54458353:T:C	M72T	1.000
8:54458354:G:A	M72I	1.000
8:54458354:G:C	M72I	1.000
8:54458354:G:T	M72I	1.000
8:54458355:A:C	N73H	1.000
8:54458355:A:G	N73D	1.000
8:54458355:A:T	N73Y	1.000
8:54458356:A:C	N73T	1.000
8:54458356:A:G	N73S	1.000
8:54458356:A:T	N73I	1.000
8:54458357:C:A	N73K	1.000
8:54458357:C:G	N73K	1.000
8:54458359:C:A	A74D	1.000
8:54458359:C:T	A74V	1.000
8:54458361:T:A	F75I	1.000
8:54458361:T:C	F75L	1.000
8:54458361:T:G	F75V	1.000
8:54458362:T:C	F75S	1.000

dbSNP variants (sampled 300 via entrez): RS1000269730 (8:54456993 T>C), RS1001499056 (8:54456824 A>G), RS1002224545 (8:54456953 A>G), RS1002655500 (8:54458225 C>A,T), RS1002681757 (8:54457182 G>A), RS1004560711 (8:54456091 G>T), RS1004630574 (8:54457513 A>C), RS1005009675 (8:54457437 T>C), RS1005224778 (8:54458669 C>T), RS1005389905 (8:54457668 CAGCCCTCCCAGACGGCTTTTCGAGTCTCCCT>C), RS1005828003 (8:54459934 T>A,C,G), RS1006180345 (8:54457219 T>C,G), RS1006254586 (8:54458456 G>C), RS1006579680 (8:54458792 T>C), RS1007459047 (8:54458001 C>A,G)

Disease associations

OMIM: gene MIM:610928 | disease phenotypes: MIM:613674, MIM:621248

GenCC curated gene-disease

Disease	Classification	Inheritance
vesicoureteral reflux 3	Definitive	Autosomal dominant
pulmonary arterial hypertension	Strong	Autosomal dominant
familial vesicoureteral reflux	Supportive	Autosomal dominant

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
pulmonary arterial hypertension	Definitive	AD

Mondo (6): vesicoureteral reflux 3 (MONDO:0013356), pulmonary arterial hypertension (MONDO:0015924), pulmonary hypertension, primary, 7 (MONDO:0979237), vesicoureteral reflux (MONDO:0006007), chronic kidney disease (MONDO:0005300), familial vesicoureteral reflux (MONDO:0017329)

Orphanet (3): Familial vesicoureteral reflux (Orphanet:289365), Pulmonary arterial hypertension (Orphanet:182090), Idiopathic/heritable pulmonary arterial hypertension (Orphanet:422)

HPO phenotypes

62 total (30 of 62 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000010	Recurrent urinary tract infections
HP:0000072	Hydroureter
HP:0000074	Ureteropelvic junction obstruction
HP:0000126	Hydronephrosis
HP:0000421	Epistaxis
HP:0000717	Autism
HP:0000821	Hypothyroidism
HP:0000961	Cyanosis
HP:0001297	Stroke
HP:0001508	Failure to thrive
HP:0001561	Polyhydramnios
HP:0001629	Ventricular septal defect
HP:0001631	Atrial septal defect
HP:0001635	Congestive heart failure
HP:0001642	Pulmonic stenosis
HP:0001643	Patent ductus arteriosus
HP:0001655	Patent foramen ovale
HP:0001667	Right ventricular hypertrophy
HP:0001695	Cardiac arrest
HP:0001909	Leukemia
HP:0002092	Pulmonary arterial hypertension
HP:0002105	Hemoptysis
HP:0002870	Obstructive sleep apnea
HP:0002875	Exertional dyspnea
HP:0003493	Antinuclear antibody positivity
HP:0003593	Infantile onset
HP:0003596	Middle age onset
HP:0003621	Juvenile onset
HP:0003623	Neonatal onset

GWAS associations

28 associations (top):

Study	Trait	p-value
GCST000262_2	Intracranial aneurysm	1.000000e-10
GCST000262_4	Intracranial aneurysm	2.000000e-09
GCST000646_2	Intracranial aneurysm	5.000000e-07
GCST000646_3	Intracranial aneurysm	1.000000e-12
GCST002221_37	Cholesterol, total	5.000000e-11
GCST002222_9	LDL cholesterol	4.000000e-11
GCST004233_16	LDL cholesterol levels	8.000000e-11
GCST004235_41	Total cholesterol levels	7.000000e-10
GCST004748_134	Lung cancer	2.000000e-06
GCST004749_24	Lung cancer in ever smokers	9.000000e-07
GCST007228_2	Pulmonary arterial hypertension	2.000000e-12
GCST007228_3	Pulmonary arterial hypertension	5.000000e-15
GCST007445_3	Factor VIII levels	2.000000e-07
GCST007445_32	Factor VIII levels	2.000000e-09
GCST008077_14	LDL cholesterol levels	6.000000e-11
GCST008077_72	LDL cholesterol levels	1.000000e-08
GCST008078_6	LDL cholesterol levels x alcohol consumption (regular vs non-regular drinkers) interaction (2df)	1.000000e-18
GCST008078_73	LDL cholesterol levels x alcohol consumption (regular vs non-regular drinkers) interaction (2df)	1.000000e-17
GCST008079_12	LDL cholesterol levels x alcohol consumption (drinkers vs non-drinkers) interaction (2df)	3.000000e-20
GCST008079_143	LDL cholesterol levels x alcohol consumption (drinkers vs non-drinkers) interaction (2df)	8.000000e-20
GCST008086_53	LDL cholesterol levels in current drinkers	4.000000e-13
GCST008086_86	LDL cholesterol levels in current drinkers	2.000000e-13
GCST010243_14	Apolipoprotein B levels	1.000000e-13
GCST010245_113	LDL cholesterol levels	3.000000e-13
GCST011020_3	Intracranial aneurysm	1.000000e-14
GCST011021_4	Intracranial aneurysm	3.000000e-14
GCST011741_56	LDL cholesterol levels in HIV infection	7.000000e-06
GCST90013407_79	Liver enzyme levels (gamma-glutamyl transferase)	4.000000e-51

EFO canonical traits (6, from GWAS)

EFO ID	Trait name
EFO:0004574	total cholesterol measurement
EFO:0004611	low density lipoprotein cholesterol measurement
EFO:0004630	factor VIII measurement
EFO:0004329	alcohol drinking
EFO:0004615	apolipoprotein B measurement
EFO:0004532	serum gamma-glutamyl transferase measurement

MeSH disease descriptors (3)

Descriptor	Name	Tree numbers
D007676	Kidney Failure, Chronic	C12.050.351.968.419.780.750.500; C12.200.777.419.780.750.500; C12.950.419.780.750.500; C23.550.291.500.906.500
D000081029	Pulmonary Arterial Hypertension	C08.381.423.847
D014718	Vesico-Ureteral Reflux	C12.050.351.968.829.920; C12.200.777.829.920; C12.950.829.920

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL4523455 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

53 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases reaction, increases expression, decreases localization	3
Tretinoin	affects expression, decreases localization, affects cotreatment, decreases reaction, increases expression	3
Valproic Acid	affects expression, decreases expression, decreases localization	3
dorsomorphin	decreases localization, affects cotreatment, increases expression	2
Diethylstilbestrol	decreases localization, increases expression	2
Fluorouracil	decreases localization, decreases expression	2
Aflatoxin B1	decreases expression, decreases methylation	2
chlorophacinone	decreases localization	1
bisphenol A	increases expression	1
arsenite	increases methylation	1
butyraldehyde	increases expression	1
dinoseb	decreases localization	1
maleic acid	increases expression	1
diniconazole	decreases localization	1
columbamine	decreases expression	1
flusilazole	decreases localization	1
fluazinam	decreases localization	1
ziprasidone	decreases localization	1
CGP 52608	affects binding, increases reaction	1
hexaconazole	decreases localization	1
vandetanib	decreases localization	1
Chir 99021	decreases reaction, increases expression, affects cotreatment	1
abrine	increases expression	1
licochalcone B	increases expression	1
Imatinib Mesylate	decreases localization	1
Dasatinib	decreases localization	1
Gefitinib	decreases localization	1
Sorafenib	decreases localization	1
Resveratrol	decreases expression	1
Decitabine	decreases methylation, increases expression	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4421281	Binding	Inhibition of SOX17 (unknown origin) expressed in African green monkey COS7 cells assessed as reduction in SOX17 transcriptional activity at	Inhibitors of sox18 protein activity for treating angiogenesis- and/or lymphangiogenesis-related diseases

Cellosaurus cell lines

11 cell lines: 7 embryonic stem cell, 4 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_A6M3	SEES3-1V human SOX17, clone1	Embryonic stem cell	Male
CVCL_A6M4	SEES3-1V human SOX17, clone2	Embryonic stem cell	Male
CVCL_A6M5	SEES3-1V human SOX17, clone3	Embryonic stem cell	Male
CVCL_B2H2	Abcam HeLa SOX17 KO	Cancer cell line	Female
CVCL_B8PY	Abcam HCT 116 SOX17 KO	Cancer cell line	Male
CVCL_B9SE	Abcam A-549 SOX17 KO	Cancer cell line	Male
CVCL_C3L6	MSHRIe002-A-SOX17 control 1	Embryonic stem cell	Male
CVCL_C3L7	MSHRIe002-A-SOX17 control 2	Embryonic stem cell	Male
CVCL_C3L8	MSHRIe002-A-SOX17 overexpressing 1	Embryonic stem cell	Male
CVCL_C3L9	MSHRIe002-A-SOX17 overexpressing 2	Embryonic stem cell	Male

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00058929	PHASE4	COMPLETED	A Transition Study From Flolan® to Remodulin® in Patients With Pulmonary Arterial Hypertension
NCT00303459	PHASE4	COMPLETED	Effects of the Combination of Bosentan and Sildenafil Versus Sildenafil Monotherapy on Pulmonary Arterial Hypertension (PAH)
NCT00323297	PHASE4	COMPLETED	Assess the Efficacy and Safety of Sildenafil When Added to Bosentan in the Treatment of Pulmonary Arterial Hypertension
NCT00367770	PHASE4	COMPLETED	BREATHE 5-OL: Tracleer (Bosentan) in Patients With Pulmonary Arterial Hypertension Related to Eisenmenger Physiology
NCT00403650	PHASE4	COMPLETED	Inhaled Iloprost for Sarcoidosis-associated Pulmonary Hypertension
NCT00430716	PHASE4	TERMINATED	To Assess The Efficacy and Safety Of Oral Sildenafil in the Treatment of Pulmonary Arterial Hypertension.
NCT00433329	PHASE4	COMPLETED	Combination Therapy in Pulmonary Arterial Hypertension
NCT00439946	PHASE4	TERMINATED	Safety, Efficacy, and Treatment Satisfaction Switching From Flolan to Remodulin Using the Crono Five Ambulatory Pump in Patients With PAH
NCT00483626	PHASE4	UNKNOWN	Hemodynamic Response After Six Months of Sildenafil
NCT00494533	PHASE4	TERMINATED	Study of Intravenous Remodulin in Patients in India With Pulmonary Arterial Hypertension
NCT00617305	PHASE4	COMPLETED	Study of Add-on Ambrisentan Therapy to Background Phosphodiesterase Type-5 Inhibitor (PDE5i) Therapy in Pulmonary Arterial Hypertension (ATHENA-1)
NCT00625079	PHASE4	WITHDRAWN	Pulmonary Hypertension Secondary to Idiopathic Pulmonary Fibrosis And Treatment With Sildenafil
NCT00625469	PHASE4	WITHDRAWN	Pulmonary Arterial Hypertension Secondary to Idiopathic Pulmonary Fibrosis and Treatment With Bosentan
NCT00705588	PHASE4	UNKNOWN	Long Acting Phosphodiesterase 5 Inhibitors as Add-on Therapy for Patients With Pulmonary Hypertension Treated With Prostanoids.
NCT00741819	PHASE4	COMPLETED	Safety Evaluation of Inhaled Treprostinil Administration Following Transition From Inhaled Ventavis in Pulmonary Arterial Hypertension (PAH) Subjects
NCT01042158	PHASE4	COMPLETED	A Clinical Trial of Ambrisentan and Tadalafil in Pulmonary Arterial Hypertension Associated With Systemic Sclerosis
NCT01105091	PHASE4	COMPLETED	Epoprostenol for Injection in Pulmonary Arterial Hypertension
NCT01105117	PHASE4	COMPLETED	Epoprostenol for Injection in Pulmonary Arterial Hypertension - Extension of AC-066A401
NCT01268553	PHASE4	COMPLETED	Transition From Injectable Prostacyclin Medication to Inhaled Prostacyclin Medication
NCT01302444	PHASE4	TERMINATED	Treprostinil Combined With Tadalafil for Pulmonary Hypertension
NCT01330108	PHASE4	COMPLETED	Safely Change From Bosentan to Ambrisentan in Pulmonary Hypertension
NCT01433328	PHASE4	TERMINATED	Lidocaine Subcutaneous Infusion for Control of Treprostinil Related Site Pain
NCT01508780	PHASE4	WITHDRAWN	Combined Use of Angiography, Optical Coherence Tomography and Intravascular Ultrasound in Evaluation of Pulmonary Vascular Structure and Function in Patients With Pulmonary Arterial Hypertension Treated With Oral Bosentan
NCT01615627	PHASE4	WITHDRAWN	Hypotonic Treprostinil Subcutaneous Infusion for Control of Treprostinil Related Site Pain
NCT01642407	PHASE4	COMPLETED	Safety And Efficacy Of Sildenafil In Children With Pulmonary Arterial Hypertension
NCT01649739	PHASE4	UNKNOWN	Vardenafil as add-on Therapy for Patients With Pulmonary Hypertension Treated With Inhaled Iloprost
NCT02060487	PHASE4	TERMINATED	Effects of Oral Sildenafil on Mortality in Adults With PAH
NCT02253394	PHASE4	TERMINATED	The Combination Ambrisentan Plus Spironolactone in Pulmonary Arterial Hypertension Study
NCT02284737	PHASE4	TERMINATED	A Study to Investigate the Efficacy of PADN to Improved Functional Capacity and Hemodynamics in Patients With PAH
NCT02310672	PHASE4	COMPLETED	REPAIR: Right vEntricular Remodeling in Pulmonary ArterIal hypeRtension
NCT02847260	PHASE4	COMPLETED	Safety and Tolerability of Rapid Dose Titration of Subcutaneous Remodulin® Therapy in PAH Subjects (RAPID)
NCT02882126	PHASE4	WITHDRAWN	An Open Label Extension Study to Evaluate the Safety of Continued Therapy of Subcutanous Remodulin® in Pulmonary Arterial Hypertension
NCT02885012	PHASE4	TERMINATED	Crossover Study From Macitentan or Bosentan Over to Ambrisentan
NCT02891850	PHASE4	COMPLETED	Riociguat rEplacing PDE-5i Therapy evaLuated Against Continued PDE-5i thErapy
NCT02893995	PHASE4	WITHDRAWN	Safety, Tolerability, Pharmacokinetics and Efficacy of Two Different Rates of Subcutanous Remodulin® Dose Titration in Pulmonary Arterial Hypertension
NCT02968901	PHASE4	TERMINATED	Clinical Study Evaluating the Effects of First-line Oral cOmbination theraPy of maciTentan and tadalafIl in Patients With Newly Diagnosed pulMonary Arterial Hypertension (OPTIMA)
NCT03055221	PHASE4	COMPLETED	TRUST-2: Safety and Efficacy of Intravenous Remodulin® in Patients in India With Pulmonary Arterial Hypertension (PAH)
NCT03078907	PHASE4	COMPLETED	Effect of Selexipag on Daily Life Physical Activity of Patients With Pulmonary Arterial Hypertension.
NCT03236818	PHASE4	UNKNOWN	Goal Oriented Strategy to Preserve Ejection Fraction Trial
NCT03344159	PHASE4	COMPLETED	Spironolactone Therapy in Chronic Stable Right HF Trial