SPATA32

Summary

SPATA32 (spermatogenesis associated 32, HGNC:26349) is a protein-coding gene on chromosome 17q21.31, encoding Spermatogenesis-associated protein 32 (Q96LK8).

Predicted to enable actin binding activity. Predicted to be involved in spermatogenesis. Predicted to be active in perinuclear region of cytoplasm.

Source: NCBI Gene 124783 — RefSeq curated summary.

At a glance

• GWAS associations: 13
• Clinical variants (ClinVar): 1 total
• MANE Select transcript: NM_152343

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:26349
Approved symbol	SPATA32
Name	spermatogenesis associated 32
Location	17q21.31
Locus type	gene with protein product
Status	Approved
Aliases	FLJ25414, AEP2, VAD1.2
Ensembl gene	ENSG00000184361
Ensembl biotype	protein_coding
Entrez	124783

Gene structure

Transcript identifiers

Ensembl transcripts: 3 — 2 nonsense_mediated_decay, 1 protein_coding

ENST00000331780, ENST00000586359, ENST00000588866

RefSeq mRNA: 1 — MANE Select: NM_152343 NM_152343

CCDS: CCDS32669

Canonical transcript exons

ENST00000331780 — 5 exons

Exon	Start	End
ENSE00003596316	45255115	45256073
ENSE00003611730	45257153	45257207
ENSE00003643586	45262004	45262094
ENSE00003657149	45254393	45254513
ENSE00003676387	45256376	45256415

Expression profiles

Bgee: expression breadth broad, 79 present calls, max score 94.65.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.1297 / max 109.1626, expressed in 12 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
166532	0.1211	12
166533	0.0086	3

Top tissues by expression

161 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
mucosa of paranasal sinus	UBERON:0005030	94.65	silver quality
left testis	UBERON:0004533	92.09	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	92.04	gold quality
cardia of stomach	UBERON:0001162	91.59	silver quality
right testis	UBERON:0004534	91.47	gold quality
substantia nigra pars compacta	UBERON:0001965	91.14	silver quality
substantia nigra pars reticulata	UBERON:0001966	91.06	silver quality
sperm	CL:0000019	90.91	gold quality
subthalamic nucleus	UBERON:0001906	90.07	silver quality
epithelium of nasopharynx	UBERON:0001951	89.96	gold quality
vena cava	UBERON:0004087	89.74	silver quality
testis	UBERON:0000473	89.36	gold quality
ventral tegmental area	UBERON:0002691	89.26	silver quality
dorsal plus ventral thalamus	UBERON:0001897	89.19	silver quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	88.16	gold quality
pharyngeal mucosa	UBERON:0000355	87.36	gold quality
pericardium	UBERON:0002407	87.12	silver quality
pons	UBERON:0000988	87.06	gold quality
saphenous vein	UBERON:0007318	86.85	gold quality
superficial temporal artery	UBERON:0001614	86.77	gold quality
trachea	UBERON:0003126	86.77	gold quality
renal medulla	UBERON:0000362	86.14	silver quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	86.00	silver quality
biceps brachii	UBERON:0001507	85.37	gold quality
deltoid	UBERON:0001476	85.25	silver quality
mammary duct	UBERON:0001765	85.11	gold quality
nipple	UBERON:0002030	85.07	gold quality
cerebellar vermis	UBERON:0004720	84.80	silver quality
thymus	UBERON:0002370	84.49	silver quality
synovial joint	UBERON:0002217	84.47	silver quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	1.71

Regulation

Is transcription factor: no

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Spata32	ENSMUSG00000044787
rattus_norvegicus	Spata32	ENSRNOG00000003275

Protein

Protein identifiers

Spermatogenesis-associated protein 32 — Q96LK8 (reviewed: Q96LK8)

Alternative names: Testis-expressed protein 34

All UniProt accessions (3): K7EPE1, K7EQM9, Q96LK8

UniProt curated annotations — full annotation on UniProt →

Subunit / interactions. Interacts with syntaxin-1 and ACTB.

Tissue specificity. Detected in testis, and on the acrosomal cap of spermatids.

RefSeq proteins (1): NP_689556* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR029297	SPATA32	Family

Pfam: PF15310

UniProt features (19 total): sequence conflict 9, region of interest 4, compositionally biased region 2, modified residue 2, chain 1, sequence variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q96LK8-F1	42.23	0.00

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (2): 167, 170

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 23 (showing top): TGACCTY_ERR1_Q2, GOBP_MALE_GAMETE_GENERATION, ATF1_Q6, GATA1_01, LXR_Q3, GOMF_ACTIN_BINDING, GOBP_DEVELOPMENTAL_PROCESS_INVOLVED_IN_REPRODUCTION, GOMF_CYTOSKELETAL_PROTEIN_BINDING, MEISSNER_NPC_HCP_WITH_H3_UNMETHYLATED, MTF1_Q4, GSE13522_CTRL_VS_T_CRUZI_BRAZIL_STRAIN_INF_SKIN_UP, SETD7_TARGET_GENES, DR4_Q2, CARRILLOREIXACH_HEPATOBLASTOMA_VS_NORMAL_DN, GOBP_SEXUAL_REPRODUCTION

GO Biological Process (1): spermatogenesis (GO:0007283)

GO Molecular Function (2): actin binding (GO:0003779), protein binding (GO:0005515)

GO Cellular Component (1): perinuclear region of cytoplasm (GO:0048471)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
developmental process involved in reproduction	1
male gamete generation	1
cytoskeletal protein binding	1
binding	1
cytoplasm	1
cellular anatomical structure	1

Protein interactions and networks

STRING

653 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SPATA32	SPATA31A7	Q8IWB4	855
SPATA32	KRTAP24-1	Q3LI83	574
SPATA32	KIAA1328	Q86T90	567
SPATA32	TMEM126B	Q8IUX1	491
SPATA32	CATSPER1	Q8NEC5	469
SPATA32	TEX11	Q8IYF3	461
SPATA32	DCAKD	Q8WVC6	445
SPATA32	NDUFA10	O95299	435
SPATA32	PARP9	Q8IXQ6	422
SPATA32	PANX1	Q96RD7	419
SPATA32	REC8	O95072	418
SPATA32	PCNT	O95613	398
SPATA32	HLA-DPA1	P01905	393
SPATA32	ARHGAP27	Q6ZUM4	380
SPATA32	IL4R	P24394	369

IntAct

7 interactions, top by confidence:

A	B	Type	Score
PIK3R3	SPATA32	psi-mi:“MI:0915”(physical association)	0.560
NTAQ1	SPATA32	psi-mi:“MI:0915”(physical association)	0.560
NTAQ1	SPATA32	psi-mi:“MI:0915”(physical association)	0.000
PIK3R3	SPATA32	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (5): SPATA32 (Two-hybrid), SPATA32 (Two-hybrid), SPATA32 (Affinity Capture-MS), SPATA32 (Affinity Capture-MS), SPATA32 (Protein-peptide)

ESM2 similar proteins: A0A1L8I316, A0A1W2PR82, A0A286YDK6, A5PJD3, A6H7B4, A6NEV1, A6NGY1, A6NHS1, A6QP24, A8MUA0, A8MUI8, A8MV72, A8MX80, A8MYA2, D3ZAQ5, O60393, P0C1T1, P0DL12, P43359, Q0KK55, Q0VD86, Q1RN00, Q32LI3, Q3UN58, Q3ZCQ2, Q5M831, Q5M844, Q66H53, Q68US1, Q6AYA8, Q6DIA7, Q6K1E7, Q6PE65, Q6ZW13, Q80VY2, Q8BII1, Q8IY42, Q8N9G6, Q8NA77, Q8TDR4

Diamond homologs: Q66H17, Q8C5V0, Q96LK8

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

1 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

706 predictions. Top by Δscore:

Variant	Effect	Δscore
17:45255113:A:AC	donor_gain	1.0000
17:45255114:C:CC	donor_gain	1.0000
17:45255114:CT:C	donor_gain	1.0000
17:45255118:T:TA	donor_gain	1.0000
17:45254509:CTGAG:C	acceptor_gain	0.9900
17:45255114:CTCTT:C	donor_gain	0.9900
17:45255127:C:A	donor_gain	0.9900
17:45262033:T:A	donor_gain	0.9900
17:45262003:CCTG:C	donor_gain	0.9800
17:45262005:TGTC:T	donor_gain	0.9800
17:45262012:C:CA	donor_gain	0.9800
17:45255109:A:AC	donor_gain	0.9700
17:45255110:C:CC	donor_gain	0.9700
17:45255110:CTCA:C	donor_gain	0.9700
17:45255244:T:TA	donor_gain	0.9700
17:45256070:CCAG:C	acceptor_gain	0.9700
17:45256071:CAGC:C	acceptor_gain	0.9700
17:45256416:C:CC	acceptor_gain	0.9700
17:45262000:CCA:C	donor_loss	0.9600
17:45262001:CAC:C	donor_loss	0.9600
17:45262002:A:AC	donor_loss	0.9600
17:45262003:CCT:C	donor_loss	0.9600
17:45256377:T:TA	donor_gain	0.9500
17:45256072:A:T	acceptor_gain	0.9400
17:45256411:CATCT:C	acceptor_gain	0.9400
17:45257129:A:AC	donor_gain	0.9400
17:45257130:C:CC	donor_gain	0.9400
17:45262004:C:G	donor_loss	0.9400
17:45256074:C:CC	acceptor_gain	0.9300
17:45256414:CT:C	acceptor_gain	0.9300

AlphaMissense

2516 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
17:45255708:G:C	F158L	0.985
17:45255708:G:T	F158L	0.985
17:45255710:A:G	F158L	0.985
17:45254460:A:G	F374S	0.982
17:45254466:A:G	I372T	0.980
17:45255709:A:G	F158S	0.979
17:45255460:A:G	L241P	0.972
17:45254466:A:C	I372S	0.965
17:45254459:A:C	F374L	0.964
17:45254459:A:T	F374L	0.964
17:45254461:A:G	F374L	0.964
17:45255448:G:T	A245E	0.959
17:45262013:C:G	G2R	0.957
17:45262013:C:T	G2R	0.957
17:45262013:C:A	G2W	0.955
17:45255709:A:C	F158C	0.952
17:45255439:A:G	L248P	0.950
17:45255672:G:C	S170R	0.948
17:45255672:G:T	S170R	0.948
17:45255674:T:G	S170R	0.948
17:45255712:A:G	L157P	0.948
17:45255176:C:A	G336W	0.944
17:45255704:C:G	A160P	0.941
17:45255683:A:G	S167P	0.938
17:45254466:A:T	I372N	0.936
17:45257190:A:G	C11R	0.935
17:45255176:C:G	G336R	0.933
17:45255176:C:T	G336R	0.933
17:45257188:G:C	C11W	0.926
17:45255451:A:G	F244S	0.924

dbSNP variants (sampled 300 via entrez): RS1000251424 (17:45262135 CCTGTGATGTCGCCGCCT>C,CCTGTGATGTCGCCGCCTCTGTGATGTCGCCGCCT), RS1000335712 (17:45263553 A>G), RS1000888056 (17:45259066 C>G), RS1000894770 (17:45255500 G>A,C,T), RS1000968958 (17:45261028 C>A,G), RS1001000272 (17:45261152 G>A), RS1001263320 (17:45255183 G>A), RS1001323360 (17:45258911 C>T), RS1001354952 (17:45258871 A>G), RS1002193172 (17:45260572 C>T), RS1002329179 (17:45263895 T>G), RS1002885821 (17:45261781 A>C,G), RS1002981396 (17:45263721 T>A,C,G), RS1003012080 (17:45264083 C>T), RS1004040013 (17:45254197 G>A)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

13 associations (top):

Study	Trait	p-value
GCST004412_12	Craniofacial microsomia	9.000000e-06
GCST005830_40	Hand grip strength	3.000000e-08
GCST006661_255	Male-pattern baldness	2.000000e-22
GCST006950_29	Feeling worry	3.000000e-11
GCST008916_39	Asthma	8.000000e-12
GCST009720_68	Asthma	2.000000e-11
GCST009798_36	Asthma	2.000000e-10
GCST010042_26	Asthma	9.000000e-14
GCST010043_35	Asthma	8.000000e-15
GCST010396_262	Gut microbiota (bacterial taxa, hurdle binary method)	3.000000e-07
GCST90002388_500	Lymphocyte count	2.000000e-09
GCST90002407_139	White blood cell count	4.000000e-10
GCST90014325_65	Asthma	2.000000e-10

EFO canonical traits (4, from GWAS)

EFO ID	Trait name
EFO:0006941	grip strength measurement
EFO:0009589	worry measurement
EFO:0007874	gut microbiome measurement
EFO:0004587	lymphocyte count

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

6 total (human), top 6 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
abrine	increases expression	1
jinfukang	increases expression, affects cotreatment	1
Cisplatin	affects cotreatment, increases expression	1
Smoke	decreases expression	1
Valproic Acid	increases methylation	1
Aflatoxin B1	increases methylation	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.