SPRR5

Summary

SPRR5 (small proline rich protein 5, HGNC:53428) is a protein-coding gene on chromosome 1q21.3, encoding Small proline-rich protein 5 (A0A1B0GTR4). Positively regulates keratinocyte differentiation by inducing genes associated with epidermal differentiation.

Involved in positive regulation of keratinocyte differentiation.

Source: NCBI Gene 110806278 — RefSeq curated summary.

At a glance

• MANE Select transcript: NM_001395435

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:53428
Approved symbol	SPRR5
Name	small proline rich protein 5
Location	1q21.3
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000283227
Ensembl biotype	protein_coding
OMIM	621317
Entrez	110806278

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000636302

RefSeq mRNA: 1 — MANE Select: NM_001395435 NM_001395435

CCDS: CCDS91056

Canonical transcript exons

ENST00000636302 — 2 exons

Exon	Start	End
ENSE00003978136	152948537	152949255
ENSE00003978137	152947206	152947248

Expression profiles

Bgee: expression breadth broad, 54 present calls, max score 92.57.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.3456 / max 189.9858, expressed in 18 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
5331	0.3456	18

Top tissues by expression

111 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
skin of leg	UBERON:0001511	92.57	gold quality
zone of skin	UBERON:0000014	90.50	gold quality
skin of abdomen	UBERON:0001416	88.01	gold quality
lower esophagus mucosa	UBERON:0035834	74.77	gold quality
esophagus mucosa	UBERON:0002469	70.54	gold quality
vagina	UBERON:0000996	56.49	gold quality
esophagus	UBERON:0001043	49.62	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	48.03	silver quality
tonsil	UBERON:0002372	40.51	silver quality
ectocervix	UBERON:0012249	40.40	gold quality
apex of heart	UBERON:0002098	38.63	silver quality
colonic epithelium	UBERON:0000397	37.20	gold quality
minor salivary gland	UBERON:0001830	36.98	gold quality
skeletal muscle tissue	UBERON:0001134	36.82	gold quality
ventricular zone	UBERON:0003053	36.48	gold quality
cortical plate	UBERON:0005343	36.47	gold quality
saliva-secreting gland	UBERON:0001044	36.28	gold quality
bone marrow cell	CL:0002092	36.16	gold quality
ganglionic eminence	UBERON:0004023	35.49	gold quality
uterine cervix	UBERON:0000002	35.46	gold quality
gastrocnemius	UBERON:0001388	34.80	gold quality
muscle of leg	UBERON:0001383	34.13	gold quality
muscle tissue	UBERON:0002385	33.59	gold quality
multicellular organism	UBERON:0000468	33.43	gold quality
bone marrow	UBERON:0002371	33.04	gold quality
hindlimb stylopod muscle	UBERON:0004252	32.15	gold quality
blood	UBERON:0000178	31.52	gold quality
sural nerve	UBERON:0015488	30.93	gold quality
right lung	UBERON:0002167	30.19	silver quality
heart left ventricle	UBERON:0002084	30.15	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	1.14

Regulation

Is transcription factor: no

Literature-anchored findings (GeneRIF, showing 1)

• LINC00941 represses SPRR5, a previously uncharacterized molecule, which functions as an essential positive regulator of keratinocyte differentiation. (PMID:30622217)

Cross-species orthologs

0 orthologs

Protein

Protein identifiers

Small proline-rich protein 5 — A0A1B0GTR4 (reviewed: A0A1B0GTR4)

All UniProt accessions (1): A0A1B0GTR4

UniProt curated annotations — full annotation on UniProt →

Function. Positively regulates keratinocyte differentiation by inducing genes associated with epidermal differentiation.

RefSeq proteins (1): NP_001382364* (*=MANE)

Domains & families (InterPro)

UniProt features (6 total): compositionally biased region 3, region of interest 2, chain 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-A0A1B0GTR4-F1	53.52	0.00

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 19 (showing top): GOBP_POSITIVE_REGULATION_OF_EPITHELIAL_CELL_DIFFERENTIATION, GOBP_EPITHELIUM_DEVELOPMENT, GOBP_POSITIVE_REGULATION_OF_KERATINOCYTE_DIFFERENTIATION, GOBP_REGULATION_OF_EPIDERMIS_DEVELOPMENT, GOBP_REGULATION_OF_EPITHELIAL_CELL_DIFFERENTIATION, GOBP_EPIDERMAL_CELL_DIFFERENTIATION, GOBP_POSITIVE_REGULATION_OF_CELL_DIFFERENTIATION, GOBP_POSITIVE_REGULATION_OF_EPIDERMIS_DEVELOPMENT, GOBP_EPIDERMIS_DEVELOPMENT, GOBP_REGULATION_OF_KERATINOCYTE_DIFFERENTIATION, GOBP_POSITIVE_REGULATION_OF_DEVELOPMENTAL_PROCESS, GOBP_SKIN_DEVELOPMENT, GOBP_POSITIVE_REGULATION_OF_MULTICELLULAR_ORGANISMAL_PROCESS, chr1q21, GOBP_KERATINOCYTE_DIFFERENTIATION

GO Biological Process (1): positive regulation of keratinocyte differentiation (GO:0045618)

GO Molecular Function (0):

GO Cellular Component (0):

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
keratinocyte differentiation	1
positive regulation of epidermal cell differentiation	1
regulation of keratinocyte differentiation	1
positive regulation of multicellular organismal process	1

Protein interactions and networks

STRING

0 interactions, top by confidence (×1000):

IntAct

0 interactions, top by confidence:

ESM2 similar proteins: A0A1B0GTR4, A6QNZ4, O14633, O70554, O70555, O70556, O70557, O70558, O70559, O70560, O70562, P15265, P22528, P22531, P22532, P35321, P35322, P35323, P35324, P35325, P35326, P49901, Q28658, Q32L04, Q4KL71, Q4R956, Q5T5B0, Q5T750, Q5T752, Q5T754, Q5T870, Q5T871, Q5TA76, Q5TA77, Q5TA78, Q5TA79, Q5TA81, Q5TA82, Q5TCM9, Q62266

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

0 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

0 predictions. Top by Δscore:

AlphaMissense

703 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:152948665:C:G	C37W	0.742
1:152948686:C:G	C44W	0.729
1:152948707:C:G	C51W	0.726
1:152948644:C:G	C30W	0.715
1:152948623:C:G	C23W	0.695
1:152948728:T:G	C58W	0.692
1:152948749:C:G	C65W	0.686
1:152948684:T:C	C44R	0.661
1:152948621:T:C	C23R	0.650
1:152948602:C:G	C16W	0.649
1:152948705:T:C	C51R	0.637
1:152948663:T:C	C37R	0.621
1:152948642:T:C	C30R	0.620
1:152948656:A:C	Q34H	0.603
1:152948656:A:T	Q34H	0.603
1:152948770:C:G	C72W	0.601
1:152948677:G:C	Q41H	0.591
1:152948677:G:T	Q41H	0.591
1:152948683:C:G	C43W	0.587
1:152948662:C:G	C36W	0.582
1:152948726:T:C	C58R	0.573
1:152948698:A:C	Q48H	0.570
1:152948698:A:T	Q48H	0.570

dbSNP variants (sampled 300 via entrez): RS1000218493 (1:152946487 T>A), RS1000249533 (1:152947422 G>A,T), RS1000773515 (1:152948114 A>G), RS1000842597 (1:152946872 C>G,T), RS1001441051 (1:152945366 G>A), RS1001975728 (1:152949342 C>T), RS1004617547 (1:152948382 G>GCA,GCACACA,GCACACACA,GCACACACACA,GCACACACACACA,GCACACACACACACA,GCACACACACACACACA,GCACACACACACACACACA,GCACACACACACACACACACA,GCACACACACACACACACACACA), RS1004689644 (1:152947245 C>A,T), RS1004997226 (1:152945453 C>T), RS1005073367 (1:152948597 T>C), RS1005214785 (1:152946657 C>T), RS1006730786 (1:152947658 T>A), RS1006784522 (1:152947347 G>A), RS1008080436 (1:152947579 A>C,G), RS1008456921 (1:152948385 C>T)

Disease associations

OMIM: gene MIM:621317 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

1 total (human), top 1 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Cadmium Chloride	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.