ST3GAL4

Summary

ST3GAL4 (ST3 beta-galactoside alpha-2,3-sialyltransferase 4, HGNC:10864) is a protein-coding gene on chromosome 11q24.2, encoding CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,3-sialyltransferase 4 (Q11206). A beta-galactoside alpha2-3 sialyltransferase involved in terminal sialylation of glycoproteins and glycolipids.

This gene encodes a member of the glycosyltransferase 29 family, a group of enzymes involved in protein glycosylation. The encoded protein is targeted to Golgi membranes but may be proteolytically processed and secreted. The gene product may also be involved in the increased expression of sialyl Lewis X antigen seen in inflammatory responses. Multiple transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 6484 — RefSeq curated summary.

At a glance

• GWAS associations: 62
• Clinical variants (ClinVar): 62 total
• MANE Select transcript: NM_001254757

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:10864
Approved symbol	ST3GAL4
Name	ST3 beta-galactoside alpha-2,3-sialyltransferase 4
Location	11q24.2
Locus type	gene with protein product
Status	Approved
Aliases	STZ, SAT3, FLJ11867
Ensembl gene	ENSG00000110080
Ensembl biotype	protein_coding
OMIM	104240
Entrez	6484

Gene structure

Transcript identifiers

Ensembl transcripts: 103 — 94 protein_coding, 4 nonsense_mediated_decay, 3 protein_coding_CDS_not_defined, 2 retained_intron

ENST00000227495, ENST00000356132, ENST00000392669, ENST00000444328, ENST00000449406, ENST00000524834, ENST00000524860, ENST00000526311, ENST00000526727, ENST00000526756, ENST00000528605, ENST00000528858, ENST00000530591, ENST00000531217, ENST00000532243, ENST00000533826, ENST00000534083, ENST00000534452, ENST00000534457, ENST00000534733, ENST00000676545, ENST00000676831, ENST00000676867, ENST00000677503, ENST00000677721, ENST00000678865, ENST00000860622, ENST00000860623, ENST00000860624, ENST00000860625, ENST00000860626, ENST00000860627, ENST00000860628, ENST00000860629, ENST00000860630, ENST00000860631, ENST00000860632, ENST00000860633, ENST00000860634, ENST00000860635, ENST00000860636, ENST00000860637, ENST00000860638, ENST00000860639, ENST00000860640, ENST00000860641, ENST00000860642, ENST00000860643, ENST00000860644, ENST00000860645, ENST00000860646, ENST00000860647, ENST00000860648, ENST00000860649, ENST00000860650, ENST00000860651, ENST00000860652, ENST00000860653, ENST00000860654, ENST00000860655, ENST00000860656, ENST00000860657, ENST00000860658, ENST00000860659, ENST00000860660, ENST00000932512, ENST00000966086, ENST00000966087, ENST00000966088, ENST00000966089, ENST00000966090, ENST00000966091, ENST00000966092, ENST00000966093, ENST00000966094, ENST00000966095, ENST00000966096, ENST00000966097, ENST00000966098, ENST00000966099, ENST00000966100, ENST00000966101, ENST00000966102, ENST00000966103, ENST00000966104, ENST00000966105, ENST00000966106, ENST00000966107, ENST00000966108, ENST00000966109, ENST00000966110, ENST00000966111, ENST00000966112, ENST00000966113, ENST00000966114, ENST00000966115, ENST00000966116, ENST00000966117, ENST00000966118, ENST00000966119, ENST00000966120, ENST00000966121, ENST00000966122

RefSeq mRNA: 9 — MANE Select: NM_001254757 NM_001254757, NM_001254758, NM_001254759, NM_001348396, NM_001348397, NM_001348398, NM_001348399, NM_001348400, NM_006278

CCDS: CCDS58193, CCDS58194, CCDS8474, CCDS91621, CCDS91622

Canonical transcript exons

ENST00000444328 — 11 exons

Exon	Start	End
ENSE00001464917	126413961	126414638
ENSE00001464922	126355686	126355842
ENSE00003505960	126406096	126406171
ENSE00003524045	126407574	126407634
ENSE00003551176	126406473	126406557
ENSE00003574488	126408099	126408194
ENSE00003582171	126413505	126413648
ENSE00003631235	126406943	126407023
ENSE00003692501	126409268	126409411
ENSE00003788883	126407252	126407349
ENSE00003791180	126408307	126408496

Expression profiles

Bgee: expression breadth ubiquitous, 249 present calls, max score 98.36.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 22.7387 / max 407.9630, expressed in 1789 samples.

FANTOM5 promoters (11 alternative TSS)

Promoter ID	TPM avg	Samples expressed
117501	21.1143	1786
117508	0.5978	152
117502	0.4549	235
117506	0.3005	132
117507	0.1255	65
117509	0.0638	20
117505	0.0464	26
117510	0.0126	4
117511	0.0118	6
117513	0.0097	3

Top tissues by expression

283 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
lower esophagus mucosa	UBERON:0035834	98.36	gold quality
left adrenal gland cortex	UBERON:0035825	97.61	gold quality
left adrenal gland	UBERON:0001234	97.55	gold quality
left ovary	UBERON:0002119	97.34	gold quality
right adrenal gland cortex	UBERON:0035827	97.34	gold quality
right adrenal gland	UBERON:0001233	97.28	gold quality
right ovary	UBERON:0002118	97.02	gold quality
adrenal cortex	UBERON:0001235	96.61	gold quality
rectum	UBERON:0001052	96.29	gold quality
adrenal gland	UBERON:0002369	96.29	gold quality
adrenal tissue	UBERON:0018303	96.21	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	95.39	gold quality
right atrium auricular region	UBERON:0006631	95.12	gold quality
tibial nerve	UBERON:0001323	94.79	gold quality
esophagus mucosa	UBERON:0002469	93.66	gold quality
transverse colon	UBERON:0001157	93.62	gold quality
cardiac atrium	UBERON:0002081	93.53	gold quality
right testis	UBERON:0004534	93.53	gold quality
mucosa of transverse colon	UBERON:0004991	93.34	gold quality
minor salivary gland	UBERON:0001830	93.32	gold quality
apex of heart	UBERON:0002098	93.21	gold quality
left testis	UBERON:0004533	93.16	gold quality
spinal cord	UBERON:0002240	92.98	gold quality
heart left ventricle	UBERON:0002084	92.73	gold quality
cardiac ventricle	UBERON:0002082	92.21	gold quality
upper lobe of left lung	UBERON:0008952	92.13	gold quality
right coronary artery	UBERON:0001625	91.92	gold quality
esophagus	UBERON:0001043	91.84	gold quality
heart	UBERON:0000948	91.75	gold quality
mucosa of stomach	UBERON:0001199	91.75	gold quality

Single-cell (SCXA)

Detected in 7 experiment(s), a significant marker in 6.

Experiment	Marker?	Max mean expression
E-MTAB-6701	yes	41.93
E-GEOD-135922	yes	21.91
E-CURD-114	yes	20.32
E-MTAB-8142	yes	19.45
E-GEOD-125970	yes	16.57
E-ANND-3	yes	6.28
E-HCAD-38	no	229.93

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): MYC, TFAP2A

miRNA regulators (miRDB)

30 targeting ST3GAL4, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-627-3P	99.90	71.42	3316
HSA-MIR-6780A-5P	99.88	66.69	2776
HSA-MIR-4496	99.88	68.89	2236
HSA-MIR-6842-5P	99.80	67.54	1587
HSA-MIR-7110-5P	99.80	67.84	1712
HSA-MIR-1273H-5P	99.77	66.32	2471
HSA-MIR-30B-3P	99.70	65.76	2325
HSA-MIR-3689A-3P	99.70	65.73	2306
HSA-MIR-3689B-3P	99.70	65.71	2311
HSA-MIR-3689C	99.70	65.71	2311
HSA-MIR-6779-5P	99.70	65.76	2363
HSA-MIR-12124	99.68	69.17	2700
HSA-MIR-6752-5P	99.59	67.32	1243
HSA-MIR-4777-5P	99.33	67.53	1148
HSA-MIR-130A-5P	99.33	70.26	2623
HSA-MIR-6878-3P	99.24	64.23	920
HSA-MIR-3127-3P	98.94	67.34	1055
HSA-MIR-6756-3P	98.94	66.79	1104
HSA-MIR-193A-3P	98.59	66.36	769
HSA-MIR-193B-3P	98.59	66.62	748
HSA-MIR-518C-5P	98.53	69.20	1640
HSA-MIR-3620-3P	97.78	64.88	772
HSA-MIR-9851-5P	97.57	67.49	1067
HSA-MIR-3192-5P	96.98	65.76	1926
HSA-MIR-500B-3P	96.49	65.40	1087
HSA-MIR-3651	95.62	64.67	287
HSA-MIR-1468-5P	94.18	69.04	176

Literature-anchored findings (GeneRIF, showing 26)

• down-regulation of ST3Gal IV mRNA may be one of the factors associated with the malignant progression of human renal cell carcinoma. (PMID:12375029)
• Transcriptional regulation of human Galbeta1,3GalNAc/Galbeta1, 4GlcNAc alpha2,3-sialyltransferase (hST3Gal IV) gene in testis and ovary cell lines. (PMID:12565846)
• IL-1 beta-induced sLeX expression on HuH-7 cells was suppressed by transfection of gene-specific small interference RNAs against FUT VI and ST3Gal IV but not against FUT IV and ST3Gal III. (PMID:17054948)
• Thrombocytopenia in mice deficient in the St3gal4 sialyltransferase gene (St3Gal-IV(-/-) mice) is caused by the recognition of terminal galactose residues exposed on the platelet surface in the absence of sialylation. (PMID:19520807)
• Expression of ST3Gal IV in several gastrointestinal cell lines is correlated with the expression of sialyl Lewis x at the cell surface. (PMID:19781661)
• These data suggest that the ST3GAL4 gene is responsible for biosynthesis of the viral receptor and may play a crucial role in infection of H5N1 avian influenza virus in humans. (PMID:20383541)
• These results indicated that gastric cancer tissues expressed high levels of alpha 2,3-linked sialic acid residues, ST3Gal IV, and ST6Gal I. (PMID:21140242)
• TNF increases the expression of alpha2,3-sialyltransferase gene ST3GAL4 (PMID:22691873)
• the role of ST3Gal IV in the acquisition of adhesive, migratory and metastatic capabilities and, secondly, in analyzing the expression of ST3Gal III and ST3Gal IV in pancreatic adenocarcinoma tissues, was investigated. (PMID:23726834)
• The expression of ST3GAL4 leads to SLe(x) antigen expression in gastric cancer cells which in turn induces an increased invasive phenotype through the activation of c-Met (PMID:23799130)
• The polymorphism analysis showed that at SNP rs10893506, genotypes CC and CT of the ST3GAL4 B3 promoter were associated with the presence of premalignant lesions and cervical cancer. (PMID:24606438)
• There may be a racial/ethnic-specific association, and/or sex-specific association between the ST3GAL4 rs11220462 SNP and serum lipid parameters in some ethnic groups. (PMID:25086711)
• ST3Gal-4 is the primary sialyltransferase regulating the synthesis of E-, P-, and L-selectin ligands on human myeloid leukocytes (PMID:25498912)
• Expression levels of sialyltransferases ST3GAL1 and ST3GAL4 were upregulated in the HRMECs after high-glucose stimulation. (PMID:26258617)
• study illustrates the power of next-generation sequencing in the discovery of new genetic variants and a significant ethnic diversity in the ST3GAL4 gene (PMID:27584569)
• TNF-responsive element in an intronic region of the ST3GAL4 gene, whose TNF-dependent activity is repressed by ERK/p38 and MSK1/2 inhibitors. This TNF-responsive element contains potential binding sites for ETS1 and ATF2 transcription factors related to TNF signaling. (PMID:27821620)
• ST3GAL IV affects apoptotic signal, cell proliferation and the effectiveness of imatinib treatment in chronic myeloid leukemia cells. (PMID:28512058)
• MiR-193a-3p and miR-224 promoted the cell proliferation and decreased apoptosis by targeting alpha-2,3-sialyltransferase IV in renal cell carcinoma. (PMID:29667779)
• The V1 transcript of the ST3GAL4 demonstrated significant decreased expression in premalignant and malignant cervical tissues. (PMID:29749491)
• a cross-restoration of each of the three genes in ST3GAL6 KO cells showed that overexpression of ST3GAL6 sufficiently rescued the total alpha2,3-sialylation levels, cell morphology, and alpha2,3-sialylation of EGFR, whereas the alpha2,3-sialylation levels of beta1 were greatly enhanced by an overexpression of ST3GAL4 (PMID:31914669)
• Identification and characterization of the V3 promoter of the ST3GAL4 gene. (PMID:32295993)
• MiR-193b modulates osteoarthritis progression through targeting ST3GAL4 via sialylation of CD44 and NF-small ka, CyrillicB pathway. (PMID:33080315)
• Rab11-mediated post-Golgi transport of the sialyltransferase ST3GAL4 suggests a new mechanism for regulating glycosylation. (PMID:33524390)
• Role of a Disease-associated ST3Gal-4 in Non-small Cell Lung Cancer. (PMID:36083411)
• ST3GalIV drives SLeX biosynthesis in gastrointestinal cancer cells and associates with cancer cell motility. (PMID:37074623)
• ST3GAL4 promotes tumorigenesis in breast cancer by enhancing aerobic glycolysis. (PMID:39422756)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	st3gal4	ENSDARG00000041006
mus_musculus	St3gal4	ENSMUSG00000032038
rattus_norvegicus	Dcps	ENSRNOG00000009850

Paralogs (14): ST3GAL1 (ENSG00000008513), ST3GAL6 (ENSG00000064225), ST6GALNAC1 (ENSG00000070526), ST6GALNAC2 (ENSG00000070731), ST6GAL1 (ENSG00000073849), ST3GAL5 (ENSG00000115525), ST6GALNAC5 (ENSG00000117069), C20orf173 (ENSG00000125975), ST3GAL3 (ENSG00000126091), ST6GALNAC4 (ENSG00000136840), ST6GAL2 (ENSG00000144057), ST3GAL2 (ENSG00000157350), ST6GALNAC6 (ENSG00000160408), ST6GALNAC3 (ENSG00000184005)

Protein

Protein identifiers

CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,3-sialyltransferase 4 — Q11206 (reviewed: Q11206)

Alternative names: Alpha 2,3-sialyltransferase IV, Gal-NAc6S, Gal-beta-1,3-GalNAc-alpha-2,3-sialyltransferase, Gal-beta-1,4-GlcNAc-alpha-2,3-sialyltransferase, N-acetyllactosaminide alpha-2,3-sialyltransferase, SAT-3, ST-4, ST3Gal IV, ST3GalA.2, STZ, Sialyltransferase 4C

All UniProt accessions (14): Q11206, A0A7I2V2H5, A0A7I2V4F4, A0A7I2V4R4, A0A7I2V4V4, A0A7I2V5F3, A0A7P0RGI5, E9PKJ2, E9PMC7, E9PN64, E9PNJ9, E9PPJ6, E9PQZ2, Q6IBE6

UniProt curated annotations — full annotation on UniProt →

Function. A beta-galactoside alpha2-3 sialyltransferase involved in terminal sialylation of glycoproteins and glycolipids. Catalyzes the transfer of sialic acid (N-acetyl-neuraminic acid; Neu5Ac) from the nucleotide sugar donor CMP-Neu5Ac onto acceptor Galbeta-(1->3)-GalNAc- and Galbeta-(1->4)-GlcNAc-terminated glycoconjugates through an alpha2-3 linkage. Plays a major role in hemostasis. Responsible for sialylation of plasma VWF/von Willebrand factor, preventing its recognition by asialoglycoprotein receptors (ASGPR) and subsequent clearance. Regulates ASGPR-mediated clearance of platelets. Participates in the biosynthesis of the sialyl Lewis X epitopes, both on O- and N-glycans, which are recognized by SELE/E-selectin, SELP/P-selectin and SELL/L-selectin. Essential for selectin-mediated rolling and adhesion of leukocytes during extravasation. Contributes to adhesion and transendothelial migration of neutrophils likely through terminal sialylation of CXCR2. In glycosphingolipid biosynthesis, sialylates GM1 and GA1 gangliosides to form GD1a and GM1b, respectively. Metabolizes brain c-series ganglioside GT1c forming GQ1c. Synthesizes ganglioside LM1 (IV3Neu5Ac-nLc4Cer), a major structural component of peripheral nerve myelin.

Subcellular location. Golgi apparatus. Golgi stack membrane. Secreted.

Tissue specificity. Highly expressed in adult placenta, heart and kidney.

Post-translational modifications. The soluble form derives from the membrane form by proteolytic processing.

Pathway. Protein modification; protein glycosylation. Glycolipid biosynthesis.

Similarity. Belongs to the glycosyltransferase 29 family.

Isoforms (7)

UniProt ID	Names	Canonical?
Q11206-1	1, B1	yes
Q11206-2	2, A1
Q11206-3	3, A2
Q11206-4	4, C
Q11206-5	5
Q11206-6	6
Q11206-7	7

RefSeq proteins (9): NP_001241686, NP_001241687, NP_001241688, NP_001335325, NP_001335326, NP_001335327, NP_001335328, NP_001335329, NP_006269 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001675	Glyco_trans_29	Family
IPR012163	Sialyl_trans	Family
IPR038578	GT29-like_sf	Homologous_superfamily
IPR051142	Glycosyltransferase_29	Family

Pfam: PF00777

Enzyme classification (BRENDA):

• EC 2.4.99.2 — beta-D-galactosyl-(1->3)-N-acetyl-beta-D-galactosaminide alpha-2,3-sialyltransferase (BRENDA: 0 organisms, 0 substrates, 0 inhibitors, 0 Km, 0 kcat entries)
• EC 2.4.99.6 — N-acetyllactosaminide alpha-2,3-sialyltransferase (BRENDA: 0 organisms, 0 substrates, 0 inhibitors, 0 Km, 0 kcat entries)

Catalyzed reactions (Rhea), 12 shown:

• a ganglioside GM1 (d18:1(4E)) + CMP-N-acetyl-beta-neuraminate = a ganglioside GD1a (d18:1(4E)) + CMP + H(+) (RHEA:18021)
• a neolactoside nLc4Cer(d18:1(4E)) + CMP-N-acetyl-beta-neuraminate = a neolactoside IV(3)-alpha-NeuAc-nLc4Cer(d18:1(4E)) + CMP + H(+) (RHEA:18913)
• a beta-D-galactosyl-(1->3)-N-acetyl-alpha-D-galactosaminyl derivative + CMP-N-acetyl-beta-neuraminate = an N-acetyl-alpha-neuraminyl-(2->3)-beta-D-galactosyl-(1->3)-N-acetyl-alpha-D-galactosaminyl derivative + CMP + H(+) (RHEA:21616)
• a ganglioside GA1 (d18:1(4E)) + CMP-N-acetyl-beta-neuraminate = a ganglioside GM1b (d18:1(4E)) + CMP + H(+) (RHEA:47560)
• a ganglioside GT1c (d18:1(4E)) + CMP-N-acetyl-beta-neuraminate = a ganglioside GQ1c (d18:1(4E)) + CMP + H(+) (RHEA:47588)
• a beta-D-galactosyl-(1->4)-N-acetyl-beta-D-glucosaminyl derivative + CMP-N-acetyl-beta-neuraminate = an N-acetyl-alpha-neuraminyl-(2->3)-beta-D-galactosyl-(1->4)-N-acetyl-beta-D-glucosaminyl derivative + CMP + H(+) (RHEA:52316)
• a beta-D-galactosyl-(1->3)-N-acetyl-beta-D-galactosaminyl derivative + CMP-N-acetyl-beta-neuraminate = an N-acetyl-alpha-neuraminyl-(2->3)-beta-D-galactosyl-(1->3)-N-acetyl-beta-D-galactosaminyl derivative + CMP + H(+) (RHEA:52380)
• a neolactoside nLc4Cer + CMP-N-acetyl-beta-neuraminate = a neolactoside IV(3)-alpha-NeuAc-nLc4Cer + CMP + H(+) (RHEA:65432)
• an N(4)-{beta-D-Gal-(1->4)-beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->3)-[alpha-Neu5Ac-(2->6)-beta-D-Gal-(1->4)-beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->6)]-beta-D-Man-(1->4)-beta-D-GlcNAc-(1->4)-[alpha-L-Fuc-(1->6)]-beta-D-GlcNAc}-L-asparaginyl-[protein] + CMP-N-acetyl-beta-neuraminate = an N(4)-{alpha-Neu5Ac-(2->3)-beta-D-Gal-(1->4)-beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->3)-[alpha-Neu5Ac-(2->6)-beta-D-Gal-(1->4)-beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->6)]-beta-D-Man-(1->4)-beta-D-GlcNAc-(1->4)-[alpha-L-Fuc-(1->6)]-beta-D-GlcNAc}-L-asparaginyl-[protein] + CMP + H(+) (RHEA:85263)
• an N(4)-{beta-D-Gal-(1->4)-beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->3)-[beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->6)]-beta-D-Man-(1->4)-beta-D-GlcNAc-(1->4)-[alpha-L-Fuc-(1->6)]-beta-D-GlcNAc}-L-asparaginyl-[protein] + CMP-N-acetyl-beta-neuraminate = an N(4)-{alpha-Neu5Ac-(2->3)-beta-D-Gal-(1->4)-beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->3)-[beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->6)]-beta-D-Man-(1->4)-beta-D-GlcNAc-(1->4)-[alpha-L-Fuc-(1->6)]-beta-D-GlcNAc}-L-asparaginyl-[protein] + CMP + H(+) (RHEA:85267)
• an N(4)-{beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->3)-[beta-D-Gal-(1->4)-beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->6)]-beta-D-Man-(1->4)-beta-D-GlcNAc-(1->4)-[alpha-L-Fuc-(1->6)]-beta-D-GlcNAc}-L-asparaginyl-[protein] + CMP-N-acetyl-beta-neuraminate = an N(4)-{beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->3)-[alpha-Neu5Ac-(2->3)-beta-D-Gal-(1->4)-beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->6)]-beta-D-Man-(1->4)-beta-D-GlcNAc-(1->4)-[alpha-L-Fuc-(1->6)]-beta-D-GlcNAc}-L-asparaginyl-[protein] + CMP + H(+) (RHEA:85287)
• an N(4)-{alpha-Neu5Ac-(2->6)-beta-D-Gal-(1->4)-beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->3)-[beta-D-Gal-(1->4)-beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->6)]-beta-D-Man-(1->4)-beta-D-GlcNAc-(1->4)-[alpha-L-Fuc-(1->6)]-beta-D-GlcNAc}-L-asparaginyl-[protein] + CMP-N-acetyl-beta-neuraminate = an N(4)-{alpha-Neu5Ac-(2->6)-beta-D-Gal-(1->4)-beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->3)-[alpha-Neu5Ac-(2->3)-beta-D-Gal-(1->4)-beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->6)]-beta-D-Man-(1->4)-beta-D-GlcNAc-(1->4)-[alpha-L-Fuc-(1->6)]-beta-D-GlcNAc}-L-asparaginyl-[protein] + CMP + H(+) (RHEA:85295)

UniProt features (16 total): splice variant 4, glycosylation site 4, sequence conflict 3, topological domain 2, chain 1, transmembrane region 1, disulfide bond 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q11206-F1	89.46	0.72

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Disulfide bonds (1): 120–273

Glycosylation sites (4): 61, 131, 310, 329

Function

Pathways and Gene Ontology

Reactome pathways

35 pathways

ID	Pathway
R-HSA-1912420	Pre-NOTCH Processing in Golgi
R-HSA-2022854	Keratan sulfate biosynthesis
R-HSA-4085001	Sialic acid metabolism
R-HSA-9037629	Lewis blood group biosynthesis
R-HSA-9683673	Maturation of protein 3a
R-HSA-9694548	Maturation of spike protein
R-HSA-9694719	Maturation of protein 3a
R-HSA-975577	N-Glycan antennae elongation
R-HSA-977068	Termination of O-glycan biosynthesis
R-HSA-1430728	Metabolism
R-HSA-157118	Signaling by NOTCH
R-HSA-162582	Signal Transduction
R-HSA-1630316	Glycosaminoglycan metabolism
R-HSA-1638074	Keratan sulfate/keratin metabolism
R-HSA-1643685	Disease
R-HSA-1912422	Pre-NOTCH Expression and Processing
R-HSA-392499	Metabolism of proteins
R-HSA-446193	Biosynthesis of the N-glycan precursor (dolichol lipid-linked oligosaccharide, LLO) and transfer to a nascent protein
R-HSA-446203	Asparagine N-linked glycosylation
R-HSA-446219	Synthesis of substrates in N-glycan biosythesis
R-HSA-5173105	O-linked glycosylation
R-HSA-5663205	Infectious disease
R-HSA-597592	Post-translational protein modification
R-HSA-71387	Metabolism of carbohydrates and carbohydrate derivatives
R-HSA-9033658	Blood group systems biosynthesis
R-HSA-913709	O-linked glycosylation of mucins
R-HSA-948021	Transport to the Golgi and subsequent modification
R-HSA-9678108	SARS-CoV-1 Infection
R-HSA-9679506	SARS-CoV Infections
R-HSA-9683701	Translation of Structural Proteins

MSigDB gene sets: 291 (showing top): GSE18804_SPLEEN_MACROPHAGE_VS_COLON_TUMORAL_MACROPHAGE_UP, GOBP_OLIGOSACCHARIDE_METABOLIC_PROCESS, REACTOME_SIGNALING_BY_NOTCH, MULLIGHAN_NPM1_SIGNATURE_3_UP, BUYTAERT_PHOTODYNAMIC_THERAPY_STRESS_DN, GOBP_COGNITION, GOBP_REGULATION_OF_WOUND_HEALING, GOBP_REGULATION_OF_COAGULATION, GOBP_GLYCOLIPID_BIOSYNTHETIC_PROCESS, GOBP_PROTEIN_N_LINKED_GLYCOSYLATION, GRAESSMANN_APOPTOSIS_BY_SERUM_DEPRIVATION_UP, GOBP_POSITIVE_REGULATION_OF_COAGULATION, MODULE_16, GOBP_REGULATION_OF_LEUKOCYTE_MIGRATION, GOBP_CARBOHYDRATE_DERIVATIVE_METABOLIC_PROCESS

GO Biological Process (14): protein N-linked glycosylation (GO:0006487), glycoprotein biosynthetic process (GO:0009101), glycolipid biosynthetic process (GO:0009247), oligosaccharide biosynthetic process (GO:0009312), protein O-linked glycosylation via N-acetylgalactosamine (GO:0016266), keratan sulfate proteoglycan biosynthetic process (GO:0018146), viral protein processing (GO:0019082), positive regulation of blood coagulation (GO:0030194), cognition (GO:0050890), sialylation (GO:0097503), positive regulation of leukocyte tethering or rolling (GO:1903238), obsolete protein glycosylation (GO:0006486), lipid metabolic process (GO:0006629), obsolete lipid glycosylation (GO:0030259)

GO Molecular Function (6): beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836), N-acetyllactosaminide alpha-2,3-sialyltransferase activity (GO:0008118), sialyltransferase activity (GO:0008373), beta-D-galactosyl-(1->3)-N-acetyl-beta-D-galactosaminide alpha-2,3- sialyltransferase activity (GO:0047288), transferase activity (GO:0016740), glycosyltransferase activity (GO:0016757)

GO Cellular Component (5): Golgi membrane (GO:0000139), extracellular region (GO:0005576), membrane (GO:0016020), Golgi cisterna membrane (GO:0032580), Golgi apparatus (GO:0005794)

Reactome top-level categories

Rollup of top-15 pathways:

Category	Pathways
Translation of Structural Proteins	2
Pre-NOTCH Expression and Processing	1
Keratan sulfate/keratin metabolism	1
Synthesis of substrates in N-glycan biosythesis	1
Blood group systems biosynthesis	1
Translation of Structural Proteins	1
N-glycan antennae elongation in the medial/trans-Golgi	1
O-linked glycosylation of mucins	1
Signal Transduction	1
Metabolism of carbohydrates and carbohydrate derivatives	1
Glycosaminoglycan metabolism	1
Signaling by NOTCH	1
Asparagine N-linked glycosylation	1
Post-translational protein modification	1
Biosynthesis of the N-glycan precursor (dolichol lipid-linked oligosaccharide, LLO) and transfer to a nascent protein	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
sialyltransferase activity	3
carbohydrate derivative biosynthetic process	2
cellular anatomical structure	2
glycoprotein biosynthetic process	1
macromolecule biosynthetic process	1
glycoprotein metabolic process	1
glycolipid metabolic process	1
lipid biosynthetic process	1
oligosaccharide metabolic process	1
carbohydrate biosynthetic process	1
protein O-linked glycosylation	1
proteoglycan biosynthetic process	1
keratan sulfate proteoglycan metabolic process	1
viral process	1
viral gene expression	1
blood coagulation	1
regulation of blood coagulation	1
positive regulation of coagulation	1
positive regulation of wound healing	1
positive regulation of hemostasis	1
nervous system process	1
macromolecule modification	1
leukocyte tethering or rolling	1
regulation of leukocyte tethering or rolling	1
positive regulation of leukocyte adhesion to vascular endothelial cell	1
primary metabolic process	1
glycosyltransferase activity	1
catalytic activity	1
transferase activity	1
Golgi apparatus	1
bounding membrane of organelle	1
organelle membrane	1
Golgi cisterna	1
cytoplasm	1
endomembrane system	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

862 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ST3GAL4	ASGR2	P07307	929
ST3GAL4	ASGR1	P07306	898
ST3GAL4	VWF	P04275	759
ST3GAL4	GCNT1	Q02742	728
ST3GAL4	FUT7	Q11130	683
ST3GAL4	FUT8	Q9BYC5	659
ST3GAL4	MGAT5	Q09328	625
ST3GAL4	FUT6	P51993	601
ST3GAL4	SLC35A1	P78382	600
ST3GAL4	B4GALT1	P15291	591
ST3GAL4	CMAS	Q8NFW8	567
ST3GAL4	FUT9	Q9Y231	565
ST3GAL4	FUT3	P21217	548
ST3GAL4	GCNT4	Q9P109	544
ST3GAL4	MGAT4B	Q9UQ53	534
ST3GAL4	FUT5	Q11128	534

IntAct

30 interactions, top by confidence:

A	B	Type	Score
SLC31A1	C2orf72	psi-mi:“MI:0914”(association)	0.530
CRP	QSOX1	psi-mi:“MI:0914”(association)	0.530
DEFA1	MANBA	psi-mi:“MI:0914”(association)	0.530
IL27RA	B4GALT5	psi-mi:“MI:0914”(association)	0.530
PLAUR	XRCC3	psi-mi:“MI:0914”(association)	0.530
AVP	ATE1	psi-mi:“MI:0914”(association)	0.530
CHRNA4	TMEM223	psi-mi:“MI:0914”(association)	0.350
PDGFRA	GXYLT2	psi-mi:“MI:0914”(association)	0.350
NAAA	POTEF	psi-mi:“MI:0914”(association)	0.350
SCGB2A1	RAP1BL	psi-mi:“MI:0914”(association)	0.350
PSCA	METTL15	psi-mi:“MI:0914”(association)	0.350
SCGB2A2	RTL8C	psi-mi:“MI:0914”(association)	0.350
TAS1R2	UPK3BL1	psi-mi:“MI:0914”(association)	0.350
GPIHBP1	SAC3D1	psi-mi:“MI:0914”(association)	0.350
C1orf54	AGRN	psi-mi:“MI:0914”(association)	0.350
ST3GAL4	NDUFA4	psi-mi:“MI:0914”(association)	0.350
CHRNE	PODXL	psi-mi:“MI:0914”(association)	0.350
TMEM25	NME4	psi-mi:“MI:0914”(association)	0.350
EDDM3B	PLXNB2	psi-mi:“MI:0914”(association)	0.350
PTCH1	PLXNB2	psi-mi:“MI:0914”(association)	0.350
KLRD1	PRORP	psi-mi:“MI:0914”(association)	0.350
SCGB1C1	LAMA5	psi-mi:“MI:0914”(association)	0.350
LCN6	COCH	psi-mi:“MI:0914”(association)	0.350
IDS	COCH	psi-mi:“MI:0914”(association)	0.350
MSMB	ADAM11	psi-mi:“MI:0914”(association)	0.350
LCN9	C1QL1	psi-mi:“MI:0914”(association)	0.350
IL5RA	C4A	psi-mi:“MI:0914”(association)	0.350
ST3GAL4	LRP5	psi-mi:“MI:0914”(association)	0.350

BioGRID (82): ST3GAL4 (Affinity Capture-MS), ST3GAL4 (Affinity Capture-MS), FAM3C (Affinity Capture-MS), IMPAD1 (Affinity Capture-MS), MANEAL (Affinity Capture-MS), TBC1D15 (Affinity Capture-MS), C1GALT1C1 (Affinity Capture-MS), CSGALNACT2 (Affinity Capture-MS), RMND1 (Affinity Capture-MS), DHFRL1 (Affinity Capture-MS), FAM213A (Affinity Capture-MS), OAF (Affinity Capture-MS), PCSK1N (Affinity Capture-MS), BTN2A2 (Affinity Capture-MS), LRFN3 (Affinity Capture-MS)

ESM2 similar proteins: A7RX69, O15466, O35696, O43173, P38566, P48794, P54751, P61130, P61131, P61643, P61644, P61645, P61646, P61647, P61648, P70126, P70277, Q02745, Q07977, Q08E15, Q11200, Q11201, Q11204, Q11205, Q11206, Q16842, Q4V8F8, Q64686, Q64689, Q64690, Q64692, Q68G12, Q6KB55, Q6KB58, Q6KB59, Q6ZXC8, Q6ZXC9, Q70D51, Q812F3, Q8K4T1

Diamond homologs: A2WX64, A2XVC2, A2ZI41, A5D7T4, O35696, O43173, P13721, P15907, P61130, P61131, P61643, P61644, P61645, P61943, P70277, Q02745, Q07977, Q08E15, Q11200, Q11201, Q11204, Q11205, Q11206, Q16842, Q2QXM3, Q2R2B1, Q5K027, Q5QQ37, Q5RE85, Q64685, Q64689, Q64690, Q6H8M7, Q6KB54, Q6KB58, Q6KB59, Q6ZH45, Q6ZXC9, Q701R0, Q701R1

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
MYC	“up-regulates quantity by expression”	ST3GAL4	“transcriptional regulation”

Disease & clinical

Clinical variants and AI predictions

ClinVar

62 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	40
Likely benign	3
Benign	3

Top pathogenic / likely-pathogenic (0)

SpliceAI

3848 predictions. Top by Δscore:

Variant	Effect	Δscore
11:126355839:GAGG:G	donor_gain	1.0000
11:126355840:AGGGT:A	donor_loss	1.0000
11:126355841:GG:G	donor_gain	1.0000
11:126355842:GG:G	donor_gain	1.0000
11:126355843:G:A	donor_loss	1.0000
11:126355843:G:GG	donor_gain	1.0000
11:126406167:GTCCC:G	donor_gain	1.0000
11:126406172:G:GG	donor_gain	1.0000
11:126406234:G:GT	donor_gain	1.0000
11:126406471:A:AG	acceptor_gain	1.0000
11:126406471:AG:A	acceptor_gain	1.0000
11:126406471:AGGCT:A	acceptor_gain	1.0000
11:126406472:G:GG	acceptor_gain	1.0000
11:126406472:GG:G	acceptor_gain	1.0000
11:126406472:GGC:G	acceptor_gain	1.0000
11:126406472:GGCT:G	acceptor_gain	1.0000
11:126406472:GGCTG:G	acceptor_gain	1.0000
11:126406553:GAGCT:G	donor_gain	1.0000
11:126406555:GCT:G	donor_gain	1.0000
11:126406558:G:GG	donor_gain	1.0000
11:126406941:A:AG	acceptor_gain	1.0000
11:126406942:G:GG	acceptor_gain	1.0000
11:126406942:GTTT:G	acceptor_gain	1.0000
11:126407024:G:GG	donor_gain	1.0000
11:126407229:A:AG	acceptor_gain	1.0000
11:126407229:ACCC:A	acceptor_gain	1.0000
11:126407229:ACCCG:A	acceptor_gain	1.0000
11:126407230:C:G	acceptor_gain	1.0000
11:126407232:C:A	acceptor_gain	1.0000
11:126407233:G:A	acceptor_gain	1.0000

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000073307 (11:126391943 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTA>G), RS1000131536 (11:126365084 C>T), RS1000178578 (11:126408492 A>C), RS1000200569 (11:126370167 C>T), RS1000214728 (11:126375502 A>G), RS1000223776 (11:126401138 A>G), RS1000230920 (11:126408729 G>A,C), RS1000245003 (11:126359562 G>A,C), RS1000247973 (11:126414744 A>G), RS1000306384 (11:126371238 C>A,T), RS1000308256 (11:126375306 G>A), RS1000411786 (11:126381645 C>T), RS1000454360 (11:126412923 A>G), RS1000458340 (11:126403332 C>A,T), RS1000563062 (11:126379850 A>G)

Disease associations

OMIM: gene MIM:104240 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

62 associations (top):

Study	Trait	p-value
GCST000759_35	LDL cholesterol	1.000000e-15
GCST000760_41	Cholesterol, total	2.000000e-11
GCST001276_9	Liver enzyme levels (alkaline phosphatase)	2.000000e-09
GCST002221_39	Cholesterol, total	6.000000e-15
GCST002222_50	LDL cholesterol	7.000000e-21
GCST002896_27	Cholesterol, total	3.000000e-09
GCST002898_26	LDL cholesterol	3.000000e-12
GCST003678_1	C-reactive protein levels or total cholesterol levels (pleiotropy)	7.000000e-13
GCST003679_12	C-reactive protein levels or LDL-cholesterol levels (pleiotropy)	6.000000e-17
GCST004233_45	LDL cholesterol levels	2.000000e-22
GCST004235_65	Total cholesterol levels	2.000000e-15
GCST004236_7	LDL cholesterol levels	5.000000e-08
GCST004599_104	Mean platelet volume	3.000000e-30
GCST004603_70	Platelet count	2.000000e-18
GCST004616_88	Platelet distribution width	4.000000e-13
GCST005003_35	Mumps	1.000000e-08
GCST005194_238	Coronary artery disease	1.000000e-06
GCST005196_59	Coronary artery disease	4.000000e-07
GCST006016_36	Serum alkaline phosphatase levels	6.000000e-41
GCST006612_17	LDL cholesterol	1.000000e-20
GCST006614_82	Total cholesterol levels	3.000000e-18
GCST007445_30	Factor VIII levels	3.000000e-08
GCST007446_35	vWF levels	6.000000e-12
GCST007446_87	vWF levels	3.000000e-12
GCST007931_42	Medication use (HMG CoA reductase inhibitors)	2.000000e-10
GCST008075_90	HDL cholesterol levels x alcohol consumption (regular vs non-regular drinkers) interaction (2df)	2.000000e-06
GCST008077_16	LDL cholesterol levels	5.000000e-10
GCST008077_65	LDL cholesterol levels	2.000000e-09
GCST008078_2	LDL cholesterol levels x alcohol consumption (regular vs non-regular drinkers) interaction (2df)	7.000000e-25
GCST008078_66	LDL cholesterol levels x alcohol consumption (regular vs non-regular drinkers) interaction (2df)	3.000000e-22

EFO canonical traits (18, from GWAS)

EFO ID	Trait name
EFO:0004611	low density lipoprotein cholesterol measurement
EFO:0004574	total cholesterol measurement
EFO:0004533	alkaline phosphatase measurement
EFO:0004458	C-reactive protein measurement
EFO:0004309	platelet count
EFO:0007984	platelet component distribution width
EFO:0008404	susceptibility to mumps measurement
EFO:0004630	factor VIII measurement
EFO:0009932	HMG CoA reductase inhibitor use measurement
EFO:0004612	high density lipoprotein cholesterol measurement
EFO:0004329	alcohol drinking
EFO:0004999	N-glycan measurement
EFO:0004614	apolipoprotein A 1 measurement
EFO:0004615	apolipoprotein B measurement
EFO:0007986	reticulocyte count
EFO:0005091	monocyte count
EFO:0007985	platelet crit
EFO:0004736	aspartate aminotransferase measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

34 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, increases abundance, increases expression	2
Benzo(a)pyrene	affects methylation, increases methylation	2
Tobacco Smoke Pollution	decreases expression, increases expression	2
Aflatoxin B1	increases methylation	2
triphenyl phosphate	affects expression	1
bisphenol A	affects cotreatment, increases expression	1
arsenite	decreases methylation	1
mono-(2-ethylhexyl)phthalate	increases expression	1
benzo(e)pyrene	increases methylation	1
aflatoxin B2	increases methylation	1
cupric chloride	decreases expression	1
nickel sulfate	increases expression	1
soyasaponin I	decreases expression	1
jinfukang	affects cotreatment, increases expression	1
Sunitinib	increases expression	1
Arsenic	increases abundance, increases expression	1
Vehicle Emissions	decreases expression, increases abundance	1
Benzoates	affects expression	1
Calcitriol	decreases expression	1
Cisplatin	affects cotreatment, increases expression	1
Dexamethasone	affects cotreatment, increases expression	1
Diazinon	increases methylation	1
Doxorubicin	decreases expression	1
Estradiol	affects cotreatment, increases expression	1
Indomethacin	affects cotreatment, increases expression	1
Lead	affects expression	1
Lithocholic Acid	increases phosphorylation	1
Methapyrilene	increases methylation	1
Thiram	decreases expression	1
Tretinoin	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.