STIP1

Summary

STIP1 (stress induced phosphoprotein 1, HGNC:11387) is a protein-coding gene on chromosome 11q13.1, encoding Stress-induced-phosphoprotein 1 (P31948). Acts as a co-chaperone for HSP90AA1. It is a selective cancer dependency (DepMap: 10.5% of cell lines).

STIP1 is an adaptor protein that coordinates the functions of HSP70 (see HSPA1A; MIM 140550) and HSP90 (see HSP90AA1; MIM 140571) in protein folding. It is thought to assist in the transfer of proteins from HSP70 to HSP90 by binding both HSP90 and substrate-bound HSP70. STIP1 also stimulates the ATPase activity of HSP70 and inhibits the ATPase activity of HSP90, suggesting that it regulates both the conformations and ATPase cycles of these chaperones (Song and Masison, 2005 [PubMed 16100115]).

Source: NCBI Gene 10963 — RefSeq curated summary.

At a glance

• GWAS associations: 8
• Clinical variants (ClinVar): 66 total
• Druggable target: yes
• Cancer dependency (DepMap): dependent in 10.5% of screened cell lines
• MANE Select transcript: NM_006819

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:11387
Approved symbol	STIP1
Name	stress induced phosphoprotein 1
Location	11q13.1
Locus type	gene with protein product
Status	Approved
Aliases	HOP, STI1
Ensembl gene	ENSG00000168439
Ensembl biotype	protein_coding
OMIM	605063
Entrez	10963

Gene structure

Transcript identifiers

Ensembl transcripts: 24 — 17 protein_coding, 3 retained_intron, 3 protein_coding_CDS_not_defined, 1 nonsense_mediated_decay

ENST00000305218, ENST00000355603, ENST00000358794, ENST00000536973, ENST00000537479, ENST00000538497, ENST00000538945, ENST00000540501, ENST00000540736, ENST00000540887, ENST00000543847, ENST00000544739, ENST00000902521, ENST00000902522, ENST00000902523, ENST00000902524, ENST00000902525, ENST00000902526, ENST00000939707, ENST00000939708, ENST00000939709, ENST00000939710, ENST00000939711, ENST00000939712

RefSeq mRNA: 3 — MANE Select: NM_006819 NM_001282652, NM_001282653, NM_006819

CCDS: CCDS60827, CCDS60828, CCDS8058

Canonical transcript exons

ENST00000305218 — 14 exons

Exon	Start	End
ENSE00001169722	64203450	64203622
ENSE00001169731	64203125	64203228
ENSE00001169747	64202876	64202912
ENSE00001196227	64195645	64195813
ENSE00001303761	64186171	64186270
ENSE00001317889	64200169	64200293
ENSE00003497506	64194189	64194330
ENSE00003530378	64197854	64197974
ENSE00003543299	64197493	64197595
ENSE00003558482	64193078	64193287
ENSE00003617784	64199940	64200036
ENSE00003684816	64194479	64194620
ENSE00003686910	64197271	64197397
ENSE00003903436	64204054	64204543

Expression profiles

Bgee: expression breadth ubiquitous, 294 present calls, max score 98.60.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 117.6295 / max 1196.6290, expressed in 1827 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
114862	110.1720	1827
114863	6.8263	1678
206328	0.3268	133
114867	0.1996	66
114866	0.0917	48
114868	0.0131	4

Top tissues by expression

299 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
adrenal tissue	UBERON:0018303	98.60	gold quality
left testis	UBERON:0004533	98.58	gold quality
ganglionic eminence	UBERON:0004023	98.54	gold quality
ventricular zone	UBERON:0003053	98.53	gold quality
right testis	UBERON:0004534	98.52	gold quality
islet of Langerhans	UBERON:0000006	98.37	gold quality
right adrenal gland	UBERON:0001233	98.07	gold quality
cortical plate	UBERON:0005343	97.99	gold quality
embryo	UBERON:0000922	97.83	gold quality
left adrenal gland	UBERON:0001234	97.74	gold quality
right adrenal gland cortex	UBERON:0035827	97.73	gold quality
testis	UBERON:0000473	97.69	gold quality
left adrenal gland cortex	UBERON:0035825	97.68	gold quality
adrenal gland	UBERON:0002369	97.63	gold quality
stromal cell of endometrium	CL:0002255	97.57	gold quality
right uterine tube	UBERON:0001302	97.43	gold quality
adrenal cortex	UBERON:0001235	97.39	gold quality
right hemisphere of cerebellum	UBERON:0014890	97.27	gold quality
cerebellar hemisphere	UBERON:0002245	97.23	gold quality
cerebellar cortex	UBERON:0002129	97.20	gold quality
right frontal lobe	UBERON:0002810	97.07	gold quality
right atrium auricular region	UBERON:0006631	97.03	gold quality
hindlimb stylopod muscle	UBERON:0004252	96.99	gold quality
adenohypophysis	UBERON:0002196	96.97	gold quality
gastrocnemius	UBERON:0001388	96.89	gold quality
mucosa of transverse colon	UBERON:0004991	96.87	gold quality
lower esophagus mucosa	UBERON:0035834	96.78	gold quality
prefrontal cortex	UBERON:0000451	96.70	gold quality
smooth muscle tissue	UBERON:0001135	96.68	gold quality
muscle of leg	UBERON:0001383	96.61	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-GEOD-134144	yes	27.09
E-GEOD-76312	no	397.55
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): HSF1, TBP

miRNA regulators (miRDB)

24 targeting STIP1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3924	100.00	72.09	2394
HSA-MIR-4531	99.99	69.70	3181
HSA-MIR-568	99.98	69.86	2084
HSA-MIR-548D-3P	99.87	70.67	4362
HSA-MIR-548BB-3P	99.86	70.58	4354
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-548AC	99.84	70.77	4351
HSA-MIR-548H-3P	99.84	70.80	4349
HSA-MIR-548Z	99.84	70.80	4349
HSA-MIR-4524A-3P	99.72	66.85	2406
HSA-MIR-6887-3P	99.66	67.83	1778
HSA-MIR-3191-3P	99.45	63.94	356
HSA-MIR-4758-3P	99.12	63.96	869
HSA-MIR-6887-5P	98.56	68.49	1295
HSA-MIR-6795-5P	98.52	68.51	1277
HSA-MIR-3179	98.22	65.90	1445
HSA-MIR-892B	98.00	67.11	821
HSA-MIR-3189-5P	97.55	66.71	655
HSA-MIR-5699-5P	97.36	67.03	1014
HSA-MIR-1913	97.07	66.20	1417
HSA-MIR-3616-3P	96.96	65.45	983
HSA-MIR-3649	96.85	64.10	340
HSA-MIR-3976	96.67	67.79	1187
HSA-MIR-5587-3P	82.90	60.79	138

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 10.5% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 40)

• TPR1 and TPR2A domains of the Hsp70/Hsp90 adapter protein p60/Hop specifically bind to short peptides corresponding to the C-terminal tails of Hsp70 and Hsp90 (PMID:11877417)
• Hsp70/Hsp90 organizing protein (Hop) coordinates Hsp70 and Hsp90 interactions during assembly of steroid receptor complexes. (PMID:15632128)
• STI1 is secreted by and induces proliferation in glioma cells, an effect that is modulated by the Erk and PI3K pathways. STI1 does not induce proliferation of normal glia, in contrast to glioma cells. (PMID:17886292)
• It is likely that Hop binds to both monomers of Hsp90 in the form of a clamp, interacting with residues in the middle domain of Hsp90, preventing ATP hydrolysis, possibly by the preventing binding of N-terminal and middle domains in Hsp90 monomers. (PMID:18485364)
• STIP1 genetic variations might play a role in regulating corticosteroid response in asthmatic subjects with reduced lung function. (PMID:19254810)
• Sedimentation equilibrium AUC clearly shows that HOP is a monomer, with no indication of higher MW species. An in vivo coexpression assay that also supports the conclusion that HOP is a monomer. (PMID:19866486)
• Presented: Hop-D456G, a Hop mutant within the TPR2B-domain, that is a mixture of monomeric and dimeric species, suggesting the TPR2B-domain may also play a role in dimerization. (PMID:19961430)
• show that stress-induced phosphoprotein 1 (STIP1) was secreted by ovarian cancer tissues into the peripheral blood of patients, resulting in a significant increase of serum levels of STIP1 in cancer patients compared with those in normal controls (PMID:20501939)
• This study has revealed that Rho GDP-dissociation inhibitor 2, Y-box binding protein 1, and the HSP70/90 organizing protein have a critical role to play in resistance to cyclin-depedent kinases inhibitor. (PMID:21067243)
• High STIP1 is associated with pancreatic Cancer. (PMID:21470770)
• We found no genome-wide statistically significant associations but identified several plausible candidate genes among findings at p < 5E-05: STIP1, TMEM132D, LRRC7, SEMA3A, and ALK. (PMID:21784300)
• STIP-1 is an antigenic target in cultured hippocampal neurons in sera and/or cerebrospinal fluids of patients with neuro-Behcet’s disease. (PMID:21875754)
• A protein encoded by this locus was found to be differentially expressed in postmortem brains from patients with atypical frontotemporal lobar degeneration. (PMID:22360420)
• HOP as a novel regulator of angiogenesis that functions through promoting vascular endothelial cell polarization and migration (PMID:22558459)
• results show phosphorylation of the C-terminal region of Hsp70 and Hsp90 is critical for the decision between folding or degradation of client proteins by altering the binding of CHIP and HOP; also show increased phosphorylation in cancer cells with increased levels of the co-chaperone HOP (PMID:22824801)
• Luminal iron levels govern intestinal tumorigenesis after Apc loss in vivo. (PMID:22884369)
• stress-inducible protein-1 has a role in recruitment of bone marrow derived cells into the ischemic brains (PMID:23836498)
• STIP1 histoscores may be useful in detecting invasive human ovarian cancer in patients with low serum CA125 levels. (PMID:23915849)
• our findings provide evidences that positive expression of STIP1 in papillary thyroid carcinoma may be important in the acquisition of an aggressive phenotype (PMID:24163084)
• Increased STIP1 expression is associated with poor survival outcome in epithelial ovarian cancer (EOC), and STIP1 may represent a useful therapeutic target in EOC patients. (PMID:24488757)
• These results indicate that HOP is a unique co-chaperone that undergoes an ATP-dependent conformational change. (PMID:24535459)
• STIP1 and moesin may be novel and differential sero-diagnostic markers for psoriasis vulgaris and psoriatic arthritis (PMID:25010044)
• Data confirmed the significant up-regulation of STIP1 in tumorous cholangiocytes relative to normal hepatocytes and non-tumorous cells and show prooved it as a reliable diagnostic biomarker when using immunohistochemistry. (PMID:25034945)
• Stip1 has a role in the male reproductive system and is expressed during the stress response (PMID:25311551)
• STIP1 modulates the function of the HSP90-JAK2-STAT3 complex (PMID:27409672)
• Hsp70/Hsp90-organizing protein promoter activity was highest in Hs578T which expressed mutant or inactive p53. HRAS activation of the Hsp70/Hsp90-organizing protein promoter was inhibited by p53 overexpression. (PMID:27987076)
• Results indicte the great potential of STIP1 (stress-induced phosphoprotein 1) as a biomarker and therapeutic target in renal cell carcinoma (RCC) bone metastasis. (PMID:28199984)
• Data suggest that three dimers of S100A1 (S100 calcium binding protein A1) associate with one molecule of STIP1 (stress-inducible phosphoprotein 1) in a calcium-dependent manner; individual STIP1 TPR (tetratricopeptide repeat) domains, TPR1, TPR2A and TPR2B, bind a single S100A1 dimer with significantly different affinities; TPR2B domain possesses highest affinity for S100A1. (PMID:28408431)
• the modulation of HOP-PrP(C) engagement or the decrease of PrP(C) and HOP expression may represent a potential therapeutic intervention in glioblastoma. (PMID:28412969)
• Data suggest that calcium signaling plays important role in prevention of protein misfolding; complexes of S100A1 and STIP1 are key players in this pathway; the stoichiometry of S100A1/STIP1 interaction appears to be three S100A1 dimers plus one STIP1 monomer; each S100A1-STIP1-binding interaction is entropically driven. (S100A1 = S100 calcium binding protein A1; STIP1 = stress-induced-phosphoprotein 1) [REVIEW] (PMID:28819010)
• In conclusion, STIP1 is upregulated in HCC and associated with poor clinical prognosis. Blocking STIP1 activity suppresses HCC cell growth, providing the rationale for STIP1 as a potential therapeutic target in HCC. (PMID:28887036)
• In vitro experiments revealed that STIP1 was capable of binding to the MMP-9 promoter and enhanced its transcriptional expression (PMID:29304094)
• Our findings indicate that elevated expression of STIP1 exhibited a metastasis-promoting effect in GC cells through activation of Wnt/beta-catenin signaling pathway. (PMID:29335007)
• STIP1 is positively associated with sublethal heat-induced cancer cell metastasis through mediating the mesenchymal gene transcription. (PMID:29559743)
• Functional studies showed that STIP1 promoted the growth, colony formation and migration of cancer cells. However, knocking down the expression of STIP1 inhibited the growth, colony formation and migration of cancer cells. (PMID:29596884)
• The G/G allele of stress induced phosphoprotein 1(STIP1) single nucleotide polymorphism rs4980524 is associated with the increased expression of STIP1 in endometriosis (PMID:29673672)
• Significant genetic association was identified at the rs2236647 (T/C) SNP in STIP1 and risk of asthma (p < 0.001). The C allele and CC genotype of this SNP were significantly higher in asthmatics compared with controls. (PMID:29749828)
• STIP1 acts as an oncogene in colorectal carcinoma and can therefore serve as a biomarker for the prognosis of patients with CRC. (PMID:29879402)
• High STIP1 expression was significantly associated with shorter overall survival, earlier lymph node metastasis and more advanced clinical stage compared with low STIP1 expression in cancer. Therefore, STIP1 expression might be used as a prognostic biomarker for cancer treatment. (PMID:30076803)
• Hop stabilises emerin and that loss of Hop alters nuclear structure via emerin degradation. (PMID:30449594)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	stip1	ENSDARG00000004906
mus_musculus	Stip1	ENSMUSG00000024966
rattus_norvegicus	Stip1	ENSRNOG00000021164

Paralogs (18): RPAP3 (ENSG00000005175), TOMM34 (ENSG00000025772), ST13 (ENSG00000100380), STUB1 (ENSG00000103266), SPAG1 (ENSG00000104450), SGTA (ENSG00000104969), TTC1 (ENSG00000113312), TTC31 (ENSG00000115282), UNC45A (ENSG00000140553), UNC45B (ENSG00000141161), SPATA16 (ENSG00000144962), TTC12 (ENSG00000149292), TOMM70 (ENSG00000154174), SUGT1 (ENSG00000165416), TTC32 (ENSG00000183891), SGTB (ENSG00000197860), TTC4 (ENSG00000243725), DNAAF4 (ENSG00000256061)

Protein

Protein identifiers

Stress-induced-phosphoprotein 1 — P31948 (reviewed: P31948)

Alternative names: Hsc70/Hsp90-organizing protein, Renal carcinoma antigen NY-REN-11, Transformation-sensitive protein IEF SSP 3521

All UniProt accessions (5): P31948, F5GXD8, F5H783, H0YGI8, V9HW72

UniProt curated annotations — full annotation on UniProt →

Function. Acts as a co-chaperone for HSP90AA1. Mediates the association of the molecular chaperones HSPA8/HSC70 and HSP90.

Subunit / interactions. Probably forms a complex composed of chaperones HSP90 and HSP70, co-chaperones STIP1/HOP, CDC37, PPP5C, PTGES3/p23, TSC1 and client protein TSC2. Forms a complex with HSPA8/HSC70, HSPCA/HSP-86 and HSPCB/HSP-84. Interacts with PACRG. Interacts with EEF1AKMT3. Interacts with HSP90/HSP90AA1; the interaction dissociates the PPP5C:HSP90AA1 interaction. Interacts with FLCN, FNIP1 and FNIP2. Interacts with HSPA8/HSC70. Interacts with HSP90AB1; upon SMYD2-dependent HSP90AB1 methylation.

Subcellular location. Cytoplasm. Nucleus. Dynein axonemal particle.

Domain organisation. The TPR 1 repeat interacts with the C-terminal of HSC70. The TPR 4, 5 and 6 repeats (also called TPR2A domain) and TPR 7, 8 and 9 repeats (also called TPR2B domain) interact with HSP90.

Isoforms (3)

UniProt ID	Names	Canonical?
P31948-1	1	yes
P31948-2	2
P31948-3	3

RefSeq proteins (3): NP_001269581, NP_001269582, NP_006810* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR006636	STI1_HS-bd	Domain
IPR011990	TPR-like_helical_dom_sf	Homologous_superfamily
IPR013105	TPR_2	Repeat
IPR019734	TPR_rpt	Repeat
IPR041243	STI1/HOP_DP	Domain

Pfam: PF07719, PF13181, PF13414, PF13424, PF17830

UniProt features (59 total): helix 22, modified residue 12, repeat 9, cross-link 4, sequence conflict 3, domain 2, splice variant 2, chain 1, region of interest 1, short sequence motif 1, compositionally biased region 1, turn 1

Structure

Experimental structures (PDB)

8 structures.

PDB	Method	Resolution (Å)
1ELW	X-RAY DIFFRACTION	1.6
1ELR	X-RAY DIFFRACTION	1.9
3ESK	X-RAY DIFFRACTION	2.05
9QQU	X-RAY DIFFRACTION	2.13
3FWV	X-RAY DIFFRACTION	2.2
7KW7	ELECTRON MICROSCOPY	3.57
2LNI	SOLUTION NMR
2NC9	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P31948-F1	89.85	0.73

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (16): 1, 8, 16, 198, 301, 312, 325, 332, 344, 354, 446, 481, 123, 123, 210, 210

Function

Pathways and Gene Ontology

Reactome pathways

8 pathways

ID	Pathway
R-HSA-3371497	HSP90 chaperone cycle for steroid hormone receptors (SHR) in the presence of ligand
R-HSA-9696273	RND1 GTPase cycle
R-HSA-162582	Signal Transduction
R-HSA-194315	Signaling by Rho GTPases
R-HSA-2262752	Cellular responses to stress
R-HSA-8953897	Cellular responses to stimuli
R-HSA-9012999	RHO GTPase cycle
R-HSA-9716542	Signaling by Rho GTPases, Miro GTPases and RHOBTB3

MSigDB gene sets: 230 (showing top): RNGTGGGC_UNKNOWN, ELVIDGE_HYPOXIA_DN, SHEPARD_BMYB_MORPHOLINO_UP, BORCZUK_MALIGNANT_MESOTHELIOMA_UP, RODRIGUES_THYROID_CARCINOMA_ANAPLASTIC_UP, GOBP_RESPONSE_TO_PEPTIDE, STARK_PREFRONTAL_CORTEX_22Q11_DELETION_DN, CHIANG_LIVER_CANCER_SUBCLASS_UNANNOTATED_DN, ASTON_MAJOR_DEPRESSIVE_DISORDER_DN, BROWNE_HCMV_INFECTION_12HR_UP, chr11q13, GARGALOVIC_RESPONSE_TO_OXIDIZED_PHOSPHOLIPIDS_BLUE_UP, NFKB_Q6, WEI_MYCN_TARGETS_WITH_E_BOX, MUELLER_PLURINET

GO Biological Process (1): cellular response to interleukin-7 (GO:0098761)

GO Molecular Function (3): RNA binding (GO:0003723), Hsp90 protein binding (GO:0051879), protein binding (GO:0005515)

GO Cellular Component (7): nucleus (GO:0005634), Golgi apparatus (GO:0005794), cytosol (GO:0005829), protein-containing complex (GO:0032991), protein folding chaperone complex (GO:0101031), dynein axonemal particle (GO:0120293), cytoplasm (GO:0005737)

Reactome top-level categories

Rollup of top-6 pathways:

Category	Pathways
Cellular responses to stress	1
RHO GTPase cycle	1
Signaling by Rho GTPases, Miro GTPases and RHOBTB3	1
Cellular responses to stimuli	1
Signaling by Rho GTPases	1
Signal Transduction	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cytoplasm	3
intracellular membrane-bounded organelle	2
cellular anatomical structure	2
cellular response to cytokine stimulus	1
response to interleukin-7	1
nucleic acid binding	1
heat shock protein binding	1
binding	1
endomembrane system	1
cellular_component	1
intracellular protein-containing complex	1
intracellular membraneless organelle	1
intracellular anatomical structure	1

Protein interactions and networks

STRING

3536 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
STIP1	HSP90AA1	P07900	999
STIP1	HSPA4	P34932	998
STIP1	HSP90AB1	P08238	997
STIP1	DNAJB1	P25685	986
STIP1	AHSA1	O95433	968
STIP1	PRNP	P04156	962
STIP1	HSPA8	P11142	942
STIP1	FKBP4	Q02790	891
STIP1	CDC37	Q16543	881
STIP1	PPID	Q08752	870
STIP1	PTGES3	Q15185	863
STIP1	UBQLN2	Q9UHD9	796
STIP1	HSPBP1	Q9NZL4	782
STIP1	CDC37L1	Q7L3B6	781
STIP1	BAG1	Q99933	764

IntAct

366 interactions, top by confidence:

A	B	Type	Score
FKBP5	HSP90AB1	psi-mi:“MI:0915”(physical association)	0.890
PPP5C	HSP90AA1	psi-mi:“MI:0914”(association)	0.870
AIP	HSP90AB1	psi-mi:“MI:0915”(physical association)	0.830
FKBP4	HSP90AB1	psi-mi:“MI:0915”(physical association)	0.790
HSP90AB1	STIP1	psi-mi:“MI:0407”(direct interaction)	0.760
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
CFTR	ESYT2	psi-mi:“MI:0914”(association)	0.710
PTK2	TGFB1I1	psi-mi:“MI:0914”(association)	0.680
TP53	STIP1	psi-mi:“MI:0915”(physical association)	0.670
EGFR	STIP1	psi-mi:“MI:0915”(physical association)	0.630
STIP1	EGFR	psi-mi:“MI:0915”(physical association)	0.630
PPP5C	STIP1	psi-mi:“MI:0915”(physical association)	0.620
CAPN5	STIP1	psi-mi:“MI:0915”(physical association)	0.590
ERBB2	STIP1	psi-mi:“MI:0915”(physical association)	0.570
EML1	STIP1	psi-mi:“MI:0915”(physical association)	0.560
GABPB1	STIP1	psi-mi:“MI:0915”(physical association)	0.560
STIP1	MYC	psi-mi:“MI:0915”(physical association)	0.560
RBBP4	STIP1	psi-mi:“MI:0915”(physical association)	0.560
TERF1	STIP1	psi-mi:“MI:0915”(physical association)	0.560
TRAF5	STIP1	psi-mi:“MI:0915”(physical association)	0.560
STIP1	CDS2	psi-mi:“MI:0915”(physical association)	0.560
STIP1	POLA2	psi-mi:“MI:0915”(physical association)	0.560
STIP1	C3orf36	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (1341): STIP1 (Affinity Capture-Western), STIP1 (Affinity Capture-MS), STIP1 (Affinity Capture-MS), HSP90AA1 (Reconstituted Complex), HSPA4 (Reconstituted Complex), STIP1 (Affinity Capture-MS), STIP1 (Affinity Capture-MS), STIP1 (Affinity Capture-MS), AKR1B1 (Co-fractionation), AKR1B15 (Co-fractionation), DNAJA2 (Co-fractionation), DUT (Co-fractionation), ENO2 (Co-fractionation), ENO3 (Co-fractionation), FABP5 (Co-fractionation)

ESM2 similar proteins: B0BNG0, F8RP11, J9VSG5, O35814, O54981, O89079, P31948, P50502, P50503, P54920, P54921, P81125, P85969, Q0JL44, Q15006, Q2UF96, Q3ZBZ8, Q43468, Q4IBU4, Q4QR29, Q4R8N7, Q4WTC0, Q4X0I8, Q5E993, Q5R882, Q5RF31, Q5XEP2, Q5ZIK9, Q5ZLF0, Q60445, Q60864, Q62018, Q6DEU9, Q6INS3, Q6PD62, Q6TGY8, Q7S8M1, Q7ZWU1, Q8AVU9, Q8IZP2

Diamond homologs: A4K2V0, A6HD62, A6ZRW3, D7REX8, F1RBN2, F4IRM4, F4JTI1, F4K487, F4KCL7, O13754, O14217, O16259, O35814, O48802, O54981, O94826, O95801, P07213, P23231, P25638, P31948, P33313, P38825, P53041, P53042, Q07617, Q12118, Q13451, Q15785, Q32PZ3, Q3KRD5, Q3ZBR5, Q43207, Q4R8N7, Q5EA11, Q5PPS5, Q5R8D8, Q5RAP0, Q5U2X2, Q5VJS5

SIGNOR signaling

5 interactions.

A	Effect	B	Mechanism
STIP1	“down-regulates activity”	HSP90AA1	binding
STIP1	“down-regulates activity”	HSP90AB1	binding
CDK1	“down-regulates activity”	STIP1	phosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 203 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Microtubule-dependent trafficking of connexons from Golgi to the plasma membrane	5	20.4×	2e-04
Transport of connexons to the plasma membrane	5	20.4×	2e-04
HSP90 chaperone cycle for steroid hormone receptors (SHR) in the presence of ligand	14	20.4×	3e-12
Activation of AMPK downstream of NMDARs	7	20.0×	2e-05
Attenuation phase	6	18.4×	1e-04
Gap junction trafficking and regulation	5	17.9×	3e-04
Gap junction trafficking	5	17.9×	3e-04
Post-chaperonin tubulin folding pathway	5	17.9×	3e-04

GO biological processes:

GO term	Partners	Fold	FDR
telomere maintenance via telomerase	5	20.6×	2e-03
protein refolding	5	17.5×	3e-03
positive regulation of telomere maintenance	5	14.3×	3e-03
response to unfolded protein	6	10.1×	4e-03
autophagosome assembly	7	8.8×	3e-03
protein folding	14	8.1×	3e-06
microtubule cytoskeleton organization	11	7.5×	2e-04
mitotic cell cycle	8	6.0×	7e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

66 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	48
Likely benign	2
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

1972 predictions. Top by Δscore:

Variant	Effect	Δscore
11:64193072:CCTCA:C	acceptor_loss	1.0000
11:64193073:CTCAG:C	acceptor_loss	1.0000
11:64193074:TCAG:T	acceptor_loss	1.0000
11:64193075:CAGGT:C	acceptor_loss	1.0000
11:64193076:A:AG	acceptor_gain	1.0000
11:64193077:G:GG	acceptor_gain	1.0000
11:64193077:G:T	acceptor_loss	1.0000
11:64193077:GGTC:G	acceptor_gain	1.0000
11:64193077:GGTCA:G	acceptor_gain	1.0000
11:64193237:GCT:G	donor_gain	1.0000
11:64193246:G:GT	donor_gain	1.0000
11:64193284:C:T	donor_gain	1.0000
11:64193284:CAAG:C	donor_loss	1.0000
11:64193285:AAGGT:A	donor_loss	1.0000
11:64193286:AGGTC:A	donor_loss	1.0000
11:64193287:GG:G	donor_loss	1.0000
11:64194177:T:TA	acceptor_gain	1.0000
11:64194178:G:A	acceptor_gain	1.0000
11:64194180:T:TA	acceptor_gain	1.0000
11:64194186:AAG:A	acceptor_gain	1.0000
11:64194186:AAGG:A	acceptor_gain	1.0000
11:64194187:A:G	acceptor_gain	1.0000
11:64194187:AG:A	acceptor_gain	1.0000
11:64194188:G:GG	acceptor_gain	1.0000
11:64194188:GG:G	acceptor_gain	1.0000
11:64194330:GG:G	donor_loss	1.0000
11:64194469:A:AG	acceptor_gain	1.0000
11:64194469:ATTT:A	acceptor_gain	1.0000
11:64194469:ATTTG:A	acceptor_gain	1.0000
11:64194470:T:G	acceptor_gain	1.0000

AlphaMissense

3614 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
11:64193199:G:C	R44P	1.000
11:64193279:T:A	W71R	1.000
11:64193279:T:C	W71R	1.000
11:64197292:G:T	G232W	1.000
11:64197293:G:A	G232E	1.000
11:64197493:C:A	A267E	1.000
11:64197592:C:A	A300D	1.000
11:64197871:G:A	G307D	1.000
11:64200015:G:C	G367R	1.000
11:64200016:G:A	G367D	1.000
11:64200027:T:C	F371L	1.000
11:64200029:T:A	F371L	1.000
11:64200029:T:G	F371L	1.000
11:64200204:G:C	A386P	1.000
11:64200214:G:C	R389T	1.000
11:64200215:G:C	R389S	1.000
11:64200215:G:T	R389S	1.000
11:64200240:A:C	S398R	1.000
11:64200242:C:A	S398R	1.000
11:64200242:C:G	S398R	1.000
11:64200243:A:G	N399D	1.000
11:64200245:T:A	N399K	1.000
11:64200245:T:G	N399K	1.000
11:64200247:G:C	R400P	1.000
11:64200249:G:C	A401P	1.000
11:64200250:C:A	A401D	1.000
11:64200253:C:A	A402D	1.000
11:64200256:G:A	C403Y	1.000
11:64200257:C:G	C403W	1.000
11:64200264:A:G	K406E	1.000

dbSNP variants (sampled 300 via entrez): RS1000011255 (11:64191635 TC>T), RS1000025707 (11:64195353 T>C), RS1000071954 (11:64186662 G>A,T), RS1000223597 (11:64184206 G>A), RS1000448855 (11:64187996 C>G,T), RS1000487518 (11:64186517 C>G,T), RS1000680142 (11:64183928 A>C), RS1000860760 (11:64186587 CTGCGGGCCATGTTGGGGAGGG>C), RS1000916375 (11:64186625 C>G,T), RS1001156271 (11:64202761 C>A,T), RS1001227185 (11:64204685 A>G), RS1001306366 (11:64191554 C>G), RS1001415777 (11:64196382 C>T), RS1001735341 (11:64184417 G>A), RS1001832646 (11:64188732 A>G)

Disease associations

OMIM: gene MIM:605063 | disease phenotypes:

GenCC curated gene-disease

Mondo (1): neuromuscular disease (MONDO:0019056)

Orphanet (1): Neuromuscular disease (Orphanet:68381)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

8 associations (top):

Study	Trait	p-value
GCST001154_2	Attention deficit hyperactivity disorder	4.000000e-06
GCST004132_98	Crohn’s disease	5.000000e-06
GCST010136_47	Fruit consumption	9.000000e-10
GCST90002393_431	Monocyte count	8.000000e-12
GCST90020024_389	A body shape index	3.000000e-14
GCST90020025_1870	Waist-to-hip ratio adjusted for BMI	2.000000e-25
GCST90020027_1472	Waist-hip index	5.000000e-25
GCST90020029_320	Waist circumference adjusted for body mass index	4.000000e-15

EFO canonical traits (4, from GWAS)

EFO ID	Trait name
EFO:0008111	diet measurement
EFO:0005091	monocyte count
EFO:0007789	BMI-adjusted waist circumference
EFO:0007788	BMI-adjusted waist-hip ratio

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D009468	Neuromuscular Diseases	C10.668

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (2): CHEMBL4523216 (SINGLE PROTEIN), CHEMBL4523664 (PROTEIN-PROTEIN INTERACTION)

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB variants

10 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs3751123	STIP1		0.00	0
rs3751122	STIP1		0.00	0
rs2701528	STIP1		0.00	0
rs4980524	STIP1		0.00	0
rs6591838	STIP1		0.00	0
rs2282490	STIP1		0.00	0
rs11607165	STIP1		0.00	0
rs2236647	STIP1		0.00	0
rs2236648	STIP1		0.00	0
rs2070232	STIP1		0.00	0

ChEMBL bioactivities

7 potent at pChembl≥5 of 7 total, top 7 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.24	Kd	57.67	nM	CHEMBL5653589
7.24	ED50	57.67	nM	CHEMBL5653589
5.42	Kd	3829	nM	CHEMBL3752910
5.42	ED50	3829	nM	CHEMBL3752910
5.30	IC50	5000	nM	CHEMBL5558644
5.00	IC50	1e+04	nM	CHEMBL5558181
5.00	IC50	1e+04	nM	CHEMBL5561795

PubChem BioAssay actives

5 with measured affinity, of 44 total; 5 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2149506: Binding affinity to human STIP1 incubated for 45 mins by Kinobead based pull down assay	kd	0.0577	uM
4-methyl-3-[(1-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2149506: Binding affinity to human STIP1 incubated for 45 mins by Kinobead based pull down assay	kd	3.8293	uM
methyl 2-[[2-[[5,6-bis(furan-2-yl)-1,2,4-triazin-3-yl]sulfanyl]acetyl]amino]-4,5-dimethylthiophene-3-carboxylate	2084026: Inhibition of GST-tagged human HOP expressed in Escherichia coli BL21 (DE3) using NH2-EDASRMEEVD-COOH peptide as substrate preincubated for 15 mins followed by substrate addition measured after 15 mins by Alpha Screen assay	ic50	5.0000	uM
N,N’-bis(3-carbamoyl-4,5-dimethylthiophen-2-yl)pentanediamide	2084026: Inhibition of GST-tagged human HOP expressed in Escherichia coli BL21 (DE3) using NH2-EDASRMEEVD-COOH peptide as substrate preincubated for 15 mins followed by substrate addition measured after 15 mins by Alpha Screen assay	ic50	10.0000	uM
N,N’-bis(3-carbamoyl-6-ethyl-4,5,6,7-tetrahydro-1-benzothiophen-2-yl)pentanediamide	2084026: Inhibition of GST-tagged human HOP expressed in Escherichia coli BL21 (DE3) using NH2-EDASRMEEVD-COOH peptide as substrate preincubated for 15 mins followed by substrate addition measured after 15 mins by Alpha Screen assay	ic50	10.0000	uM

CTD chemical–gene interactions

98 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Tobacco Smoke Pollution	affects expression, increases expression	4
sodium arsenite	affects cotreatment, increases abundance, increases expression	3
cadmium sulfate	increases expression	2
Bortezomib	decreases expression, increases expression	2
Resveratrol	affects cotreatment, increases expression, decreases expression	2
Air Pollutants	increases abundance, increases expression	2
Doxorubicin	affects expression, decreases response to substance	2
Nickel	decreases expression, increases expression	2
Silicon Dioxide	increases expression	2
Smoke	decreases expression, increases abundance, increases expression	2
Zinc	affects cotreatment, increases expression, decreases expression	2
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression, increases expression	2
Metribolone	affects localization, increases expression	2
Cyclosporine	affects cotreatment, increases expression	2
FR900359	increases phosphorylation	1
bisphenol F	decreases expression, affects cotreatment	1
TAK-243	affects sumoylation	1
pirinixic acid	affects binding, decreases expression, increases activity	1
pyrogallol 1,3-dimethyl ether	affects cotreatment, affects localization, decreases expression	1
beta-lapachone	decreases expression	1
butyraldehyde	increases expression	1
perfluorooctanoic acid	decreases expression	1
doxifluridine	decreases response to substance	1
manganese chloride	increases expression, affects cotreatment, increases abundance	1
coumarin	decreases phosphorylation	1
4-aminophenylarsenoxide	affects binding, decreases reaction	1
celastrol	increases expression	1
bicalutamide	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	affects binding, increases reaction	1

ChEMBL screening assays

13 unique, capped per target: 13 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4372104	Binding	Inhibition of (2S,8S,11S,14S)-2-(4-aminobutyl)-14-(3-guanidinopropyl)-8-(4-hydroxybenzyl)-11-(hydroxymethyl)-4,7,10,13,16,32-hexaoxo-36-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)-19,22,25,28-tetraoxa-3,6,9,12,15,31-hexaazah	Designing de Novo Small Molecules That Control Heat Shock Protein 70 (Hsp70) and Heat Shock Organizing Protein (HOP) within the Chaperone Protein-Folding Machinery. — J Med Chem

Cellosaurus cell lines

5 cell lines: 5 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_D1Z8	Abcam A-549 STIP1 KO	Cancer cell line	Male
CVCL_D2DA	Abcam HCT 116 STIP1 KO	Cancer cell line	Male
CVCL_D2PA	Abcam THP-1 STIP1 KO	Cancer cell line	Male
CVCL_TQ68	HAP1 STIP1 (-) 1	Cancer cell line	Male
CVCL_XT97	HAP1 STIP1 (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

198 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00331656	PHASE4	UNKNOWN	Comparative Study of Non-Invasive Mask Ventilation vs Cuirass Ventilation in Patients With Acute Respiratory Failure.
NCT00994552	PHASE4	UNKNOWN	Comparison of Pressure Support and Pressure Control Ventilation in Chronic Respiratory Failure
NCT00839033	PHASE3	TERMINATED	Evaluation of a Mechanical Device During Acute Respiratory Failure in Patients With Neuromuscular Disorders
NCT00942227	PHASE3	COMPLETED	The Value of Traction in Treatment of Lumbar Radiculopathy
NCT00979108	PHASE3	COMPLETED	The Value of Traction in the Treatment of Cervical Radiculopathy
NCT01826487	PHASE3	COMPLETED	Phase 3 Study of Ataluren in Participants With Nonsense Mutation Duchenne Muscular Dystrophy (nmDMD)
NCT02090959	PHASE3	TERMINATED	An Extension Study of Ataluren (PTC124) in Participants With Nonsense Mutation Dystrophinopathy
NCT02436096	PHASE3	COMPLETED	A Study to Evaluate eFFIcacy and Safety of Sublingual TNX-102 SL Tablet Taken at Bedtime in Patients With fibRoMyalgia
NCT02829814	PHASE3	TERMINATED	Repeat of: A Study to Evaluate Efficacy and Safety of Sublingual TNX-102 SL Tablet Taken at Bedtime in Patients With Fibromyalgia
NCT03179631	PHASE3	COMPLETED	Long-Term Outcomes of Ataluren in Duchenne Muscular Dystrophy
NCT05126758	PHASE3	ACTIVE_NOT_RECRUITING	A Study of Deramiocel (CAP-1002) in Ambulatory and Non-Ambulatory Patients With Duchenne Muscular Dystrophy
NCT05156320	PHASE3	COMPLETED	Efficacy and Safety of Apitegromab in Patients With Later-Onset Spinal Muscular Atrophy Treated With Nusinersen or Risdiplam
NCT05337553	PHASE3	ACTIVE_NOT_RECRUITING	A Study to Evaluate the Efficacy and Safety of Taldefgrobep Alfa in Participants With Spinal Muscular Atrophy
NCT05626855	PHASE3	ACTIVE_NOT_RECRUITING	Long-Term Safety & Efficacy of Apitegromab in Patients With SMA Who Completed Previous Trials of Apitegromab
NCT06672237	PHASE3	RECRUITING	A Phase 3 Study of NTLA-2001 in ATTRv-PN
NCT01074359	PHASE2	TERMINATED	Safety and Efficacy Study of A0001 in Patients With the A3243G Mitochondrial DNA Point Mutation
NCT01371149	PHASE2	COMPLETED	Patient -Ventilator Interaction in Chronic Respiratory Failure
NCT02022072	PHASE2	TERMINATED	Evaluation of Vital Capacity
NCT03127514	PHASE2	COMPLETED	AMX0035 in Patients With Amyotrophic Lateral Sclerosis (ALS)
NCT03406780	PHASE2	COMPLETED	A Study of CAP-1002 in Ambulatory and Non-Ambulatory Patients With Duchenne Muscular Dystrophy
NCT03921528	PHASE2	COMPLETED	An Active Treatment Study of SRK-015 in Patients With Type 2 or Type 3 Spinal Muscular Atrophy
NCT05479981	PHASE2	COMPLETED	Extension of AOC 1001-CS1 (MARINA) Study in Adult Myotonic Dystrophy Type 1 (DM1) Patients
NCT06339580	PHASE2	RECRUITING	Assessment of Volume-targeted Ventilation in Patients With Neuromuscular Disease
NCT07071935	PHASE2	NOT_YET_RECRUITING	A Clinical Trial of Early Ventilation in Amyotrophic Lateral Sclerosis (EVENT ALS)
NCT07287189	PHASE2	RECRUITING	Phase 2 Study of SAT-3247 in Pediatric Ambulatory Patients
NCT00252252	PHASE1	COMPLETED	AutoVPAP Versus VPAP; Assessment of Sleep and Ventilation
NCT01560741	PHASE1	UNKNOWN	Telemedicine and Ventilator Titration in Chronic Respiratory Patients Initiating Non-invasive Ventilation
NCT01621984	PHASE1	COMPLETED	Therapeutic Riding and Neuromuscular Disease
NCT01758510	PHASE1	COMPLETED	Safety Study of HLA-haplo Matched Allogenic Bone Marrow Derived Stem Cell Treatment in Amyotrophic Lateral Sclerosis
NCT03440034	PHASE1	COMPLETED	Study of Pioglitazone in Sporadic Inclusion Body Myositis
NCT05730842	PHASE1	COMPLETED	Absorption, Metabolism, Excretion and Absolute Bioavailability of EDG-5506 in Healthy Volunteers
NCT03272802	PHASE2/PHASE3	UNKNOWN	Treatment Effect of Edaravone in Patients With Amyotrophic Lateral Sclerosis (ALS)
NCT00860951	PHASE1/PHASE2	COMPLETED	P300 Brain Computer Interface Keyboard to Operate Assistive Technology
NCT02362425	PHASE1/PHASE2	COMPLETED	Antioxidant Therapy in RYR1-Related Congenital Myopathy
NCT00001201	Not specified	COMPLETED	Evaluation of Neuromuscular Disease
NCT00002044	Not specified	COMPLETED	A Pilot Study To Evaluate the Effect of Retrovir (Zidovudine: AZT) in the Treatment of Human Immunodeficiency Virus (HIV) Associated Dementia and Neuromuscular Diseases
NCT00004553	Not specified	COMPLETED	Electromyography to Diagnose Neuromuscular Disorders
NCT00015470	Not specified	COMPLETED	Diagnostic Evaluation of Patients With Neuromuscular Disease
NCT00017745	Not specified	COMPLETED	Phenotype/Genotype Correlations in Neuromuscular Disorders
NCT00695591	Not specified	COMPLETED	Home Sleep Testing in Neuromuscular Disease Patients