STXBP2

Summary

STXBP2 (syntaxin binding protein 2, HGNC:11445) is a protein-coding gene on chromosome 19p13.2, encoding Syntaxin-binding protein 2 (Q15833). Involved in intracellular vesicle trafficking and vesicle fusion with membranes.

This gene encodes a member of the STXBP/unc-18/SEC1 family. The encoded protein is involved in intracellular trafficking, control of SNARE (soluble NSF attachment protein receptor) complex assembly, and the release of cytotoxic granules by natural killer cells. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.

Source: NCBI Gene 6813 — RefSeq curated summary.

At a glance

• Gene–disease (curated): familial hemophagocytic lymphohistiocytosis 5 (Definitive, ClinGen) — +2 more curated relationships
• Clinical variants (ClinVar): 1,254 total — 47 pathogenic, 45 likely-pathogenic
• Phenotypes (HPO): 54
• Dosage sensitivity (ClinGen): haploinsufficiency autosomal recessive, triplosensitivity unscored
• MANE Select transcript: NM_006949

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:11445
Approved symbol	STXBP2
Name	syntaxin binding protein 2
Location	19p13.2
Locus type	gene with protein product
Status	Approved
Aliases	UNC18B, Hunc18b, Unc18-2, MUNC18-2
Ensembl gene	ENSG00000076944
Ensembl biotype	protein_coding
OMIM	601717
Entrez	6813

Gene structure

Transcript identifiers

Ensembl transcripts: 23 — 12 retained_intron, 6 protein_coding, 4 nonsense_mediated_decay, 1 protein_coding_CDS_not_defined

ENST00000221283, ENST00000414284, ENST00000441779, ENST00000593854, ENST00000594221, ENST00000595181, ENST00000595800, ENST00000595861, ENST00000595950, ENST00000597068, ENST00000597467, ENST00000599278, ENST00000599400, ENST00000599558, ENST00000599648, ENST00000599737, ENST00000599905, ENST00000600702, ENST00000601061, ENST00000602355, ENST00000698369, ENST00000698370, ENST00000698371

RefSeq mRNA: 4 — MANE Select: NM_006949 NM_001127396, NM_001272034, NM_001414484, NM_006949

CCDS: CCDS12181, CCDS45948, CCDS62522

Canonical transcript exons

ENST00000221283 — 19 exons

Exon	Start	End
ENSE00003066829	7637110	7637186
ENSE00003473816	7639731	7639807
ENSE00003503528	7639019	7639100
ENSE00003515841	7647354	7647511
ENSE00003530679	7647725	7647873
ENSE00003635192	7638726	7638775
ENSE00003665793	7647162	7647247
ENSE00003674240	7646249	7646344
ENSE00003973444	7641705	7641853
ENSE00003973446	7642766	7642823
ENSE00003973447	7640731	7640809
ENSE00003973449	7644614	7644752
ENSE00003973452	7640900	7641003
ENSE00003973455	7642034	7642118
ENSE00003973456	7645197	7645306
ENSE00003973459	7642203	7642333
ENSE00003973462	7642983	7643048
ENSE00003973463	7643165	7643245
ENSE00003973465	7642429	7642536

Expression profiles

Bgee: expression breadth ubiquitous, 227 present calls, max score 99.28.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 37.1029 / max 1108.1439, expressed in 1597 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
173581	25.4420	1582
173583	11.3871	320
173585	0.1046	35
173582	0.0971	41
173584	0.0460	17
173586	0.0260	12

Top tissues by expression

273 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
granulocyte	CL:0000094	99.28	gold quality
monocyte	CL:0000576	99.27	gold quality
leukocyte	CL:0000738	98.92	gold quality
mononuclear cell	CL:0000842	98.92	gold quality
mucosa of transverse colon	UBERON:0004991	98.55	gold quality
body of pancreas	UBERON:0001150	98.48	gold quality
upper lobe of left lung	UBERON:0008952	98.40	gold quality
right lung	UBERON:0002167	98.32	gold quality
right uterine tube	UBERON:0001302	98.25	gold quality
left testis	UBERON:0004533	98.19	gold quality
metanephros cortex	UBERON:0010533	98.18	gold quality
right lobe of thyroid gland	UBERON:0001119	98.17	gold quality
right testis	UBERON:0004534	98.12	gold quality
lower esophagus mucosa	UBERON:0035834	98.11	gold quality
minor salivary gland	UBERON:0001830	97.94	gold quality
left lobe of thyroid gland	UBERON:0001120	97.91	gold quality
upper lobe of lung	UBERON:0008948	97.60	gold quality
spleen	UBERON:0002106	97.36	gold quality
skin of abdomen	UBERON:0001416	96.76	gold quality
thyroid gland	UBERON:0002046	96.64	gold quality
esophagus mucosa	UBERON:0002469	96.48	gold quality
saliva-secreting gland	UBERON:0001044	96.44	gold quality
blood	UBERON:0000178	96.41	gold quality
small intestine Peyer’s patch	UBERON:0003454	96.41	gold quality
skin of leg	UBERON:0001511	96.29	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	96.24	gold quality
right lobe of liver	UBERON:0001114	95.95	gold quality
gall bladder	UBERON:0002110	95.78	gold quality
rectum	UBERON:0001052	95.71	gold quality
testis	UBERON:0000473	95.52	gold quality

Single-cell (SCXA)

Detected in 12 experiment(s), a significant marker in 12.

Experiment	Marker?	Max mean expression
E-HCAD-4	yes	256.67
E-HCAD-1	yes	79.20
E-CURD-122	yes	78.72
E-HCAD-10	yes	36.44
E-MTAB-6701	yes	33.79
E-MTAB-9467	yes	33.24
E-CURD-112	yes	21.07
E-MTAB-9221	yes	18.40
E-CURD-88	yes	13.16
E-MTAB-10042	yes	12.77
E-MTAB-9067	yes	11.68
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): AR, SP1

Functional genomics

ClinGen dosage: haploinsufficiency 30 (autosomal recessive), triplosensitivity Not yet evaluated (unscored). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 30)

• binds to syntaxins 1A, 2, and 3 and regulates vesicle transport to the apical plasma membrane (PMID:12198139)
• Munc18-2 acts as a regulator of primary granule exocytosis, while Munc18-3 may preferentially regulate the fusion of secondary granules (PMID:18588921)
• Familial hemophagocytic lymphohistiocytosis type 5 (FHL-5) is caused by mutations in Munc18-2 and impaired binding to syntaxin 11 (PMID:19804848)
• STXBP2 is required at a late step of the secretory pathway for the release of cytotoxic granules by binding syntaxin 11, another component of the intracellular membrane fusion machinery. (PMID:19884660)
• mutation analysis, clinical presentation, and functional analysis of NK cells in patients with mutations in STXBP2 encoding Munc18-2, recently associated with familial hemophagocytic lymphohistiocytosis type 5 (PMID:20558610)
• Munc18b is functionally coupled to the assembly of exocytic SNARE complexes and increases exocytosis by interacting with the N-peptide and closed-conformation C-terminus of Stx3, thereby neutralizing the secretion-inhibitory effect of this SNARE. (PMID:20695848)
• Biallelic STXBP2 mutations were identified in families with familial haemophagocytic lymphohistiocytosis. (PMID:20798128)
• Data show that all but one patient with atypical familial hemophagocytic lymphohistiocytosis carried at least one splice-site mutation in UNC13D or STXBP2. (PMID:20823128)
• Data show that 3 novel mutations of STXBP2 gene were confirmed. (PMID:21152410)
• Missense and splice-site sequence variants in PRF1, MUNC13-4, and STXBP2 were found in 25 (14%) of the adult patients. The A91V-PRF1 genotype was found in 12 of these patients (48%). (PMID:21881043)
• Novel mutation in STXBP2 prevents IL-2-induced natural killer cell cytotoxicity in familial hemophagocytic lymphohistiocytosis. (PMID:22336081)
• We report the largest cohort of patients with FHL5 so far, describe an extended disease spectrum, and demonstrate for the first time a clear genotype-phenotype correlation. (PMID:22451424)
• Mutations in STXBP2 do not only affect cytotoxic T lymphocytes but also cause changes in the intestinal and renal epithelium resulting in severe, osmotic diarrhea and renal proximal tubular dysfunction (PMID:23382066)
• Double knockdown of Munc18-1 and Munc18-2 in mast cells eliminates both IgE-dependent and ionomycin-induced degranulation and causes a significant reduction in syntaxin-11 without altering expressions of the other syntaxin isoforms examined. (PMID:23487749)
• We report that FHL-5 neutrophils have a profound defect in granule mobilization, resulting in inadequate bacterial killing, in particular, of gram-negative Escherichia coli, but not of Staphylococcus aureus. (PMID:23687090)
• Munc18-2 binds the N-terminal peptide of Stx11 with a ~20-fold higher affinity than Stx3, suggesting a potential role in selective binding. (PMID:24194549)
• Munc18-2(R65Q) and Munc18-2(R65W) retain the ability to interact with and stabilize STX11. However, presence of Munc18-2(R65Q/W) in patient-derived lymphocytes and forced expression in control CTLs and NK cells diminishes degranulation and cytotoxicity. (PMID:25564401)
• mutations result in severe chronic active Epstein-Barr virus disease (PMID:25947952)
• red blood cells express Munc18-2 and that erythroid cells from patients with FHL-5 exhibit intrinsic defects caused by STXBP2/Munc18-2 mutations. (PMID:26320718)
• two novel mutations of STXBP2: c.184A>G and c.577A>C. c.184A>G (p.Asn62Asp) was located within a highly conserved region of the STXBP2 protein and predicted to be deleterious. (PMID:26451869)
• STXBP2 Gene Polymorphism is associated with Hemophagocytic Lymphohistocytosis. (PMID:27513731)
• Mutation in STXBP2 gene is associated with hemophagocytic lymphohistiocytosis. (PMID:27781387)
• Data show that Munc18b overexpression increased fusion of not only newcomer secretory granule (SG), but also predocked SGs in type-2 diabetes (T2D) human and Goto-Kakizaki Rat Islets. (PMID:28163042)
• Among these nine polymorphisms, rs188212047 [G/T (L212F)] of STXBP2 was significantly (dominant model; P = 4.84 x 10-8; odds ratio, 2.94) associated with myocardial infarction. STXBP2 may thus be a novel susceptibility locus for myocardial infarction in Japanese. (PMID:28380445)
• Neonatal platelets exhibit low levels of the Stx11-Munc18b complex (essential component of the SNARE machinery) and of beta1-tubulin. These developmental deficiencies are associated with defects in platelet adhesion, spreading and secretion. (PMID:29044293)
• In the current study, we have made the unexpected observation that congenital deficiency of the STXBP2 protein may also affect the expression of STXBP1. Further analysis identified an unsuspected functional role for STXBP1 in secretory granule-mediated NK and T-cell cytotoxicity. (PMID:29599780)
• Loss of Munc18-2/Stxbp2 recapitulated the pathologic features observed in patients with MUNC18-2 deficiency. (PMID:30364784)
• Different Clinical Presentation of 3 Children With Familial Hemophagocytic Lymphohistiocytosis With 2 Novel Mutations. (PMID:31651726)
• STXBP2-R190C Variant in a Patient With Neonatal Hemophagocytic Lymphohistiocytosis (HLH) and G6PD Deficiency Reveals a Critical Role of STXBP2 Domain 2 on Granule Exocytosis. (PMID:33162974)
• Spectrum mutations of PRF1, UNC13D, STX11, and STXBP2 genes in Vietnamese patients with hemophagocytic lymphohistiocytosis. (PMID:34339548)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	stxbp2	ENSDARG00000007603
mus_musculus	Stxbp2	ENSMUSG00000004626
rattus_norvegicus	Stxbp2	ENSRNOG00000000994
caenorhabditis_elegans		WBGENE00020298

Paralogs (7): SCFD1 (ENSG00000092108), STXBP3 (ENSG00000116266), VPS45 (ENSG00000136631), STXBP1 (ENSG00000136854), VPS33A (ENSG00000139719), VPS33B (ENSG00000184056), SCFD2 (ENSG00000184178)

Protein

Protein identifiers

Syntaxin-binding protein 2 — Q15833 (reviewed: Q15833)

Alternative names: Protein unc-18 homolog 2, Protein unc-18 homolog B

All UniProt accessions (8): Q15833, A0A8V8TNF6, M0R0D4, M0R0M7, M0R118, M0R1A1, M0R376, R4GMY7

UniProt curated annotations — full annotation on UniProt →

Function. Involved in intracellular vesicle trafficking and vesicle fusion with membranes. Contributes to the granule exocytosis machinery through interaction with soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) proteins that regulate membrane fusion. Regulates cytotoxic granule exocytosis in natural killer (NK) cells.

Subunit / interactions. Interacts with STX1A, STX2 and STX3. Interacts with STX11.

Tissue specificity. Placenta, lung, liver, kidney and pancreas, as well as in peripheral blood lymphocytes.

Disease relevance. Hemophagocytic lymphohistiocytosis, familial, 5, with or without microvillus inclusion disease (FHL5) [MIM:613101] A rare, autosomal recessive disorder characterized by immune dysregulation with hypercytokinemia, defective function of natural killer cell, and massive infiltration of several organs by activated lymphocytes and macrophages. The clinical features of the disease include fever, hepatosplenomegaly, cytopenia, and less frequently neurological abnormalities ranging from irritability and hypotonia to seizures, cranial nerve deficits and ataxia. Some patients may present in early infancy with severe diarrhea, prior to the onset of typical FHL features, whereas others present later in childhood and have a more protracted course without diarrhea. The early-onset diarrhea is due to enteropathy reminiscent of microvillus inclusion disease. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the STXBP/unc-18/SEC1 family.

Isoforms (3)

UniProt ID	Names	Canonical?
Q15833-1	1	yes
Q15833-2	2
Q15833-3	3

RefSeq proteins (4): NP_001120868, NP_001258963, NP_001401413, NP_008880* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001619	Sec1-like	Family
IPR027482	Sec1-like_dom2	Homologous_superfamily
IPR036045	Sec1-like_sf	Homologous_superfamily
IPR043127	Sec-1-like_dom3a	Homologous_superfamily
IPR043154	Sec-1-like_dom1	Homologous_superfamily

Pfam: PF00995

UniProt features (62 total): helix 28, strand 15, sequence variant 7, turn 6, splice variant 2, chain 1, region of interest 1, sequence conflict 1, compositionally biased region 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
4CCA	X-RAY DIFFRACTION	2.6

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q15833-F1	90.41	0.79

Function

Pathways and Gene Ontology

Reactome pathways

8 pathways

ID	Pathway
R-HSA-114608	Platelet degranulation
R-HSA-449836	Other interleukin signaling
R-HSA-109582	Hemostasis
R-HSA-1280215	Cytokine Signaling in Immune system
R-HSA-168256	Immune System
R-HSA-449147	Signaling by Interleukins
R-HSA-76002	Platelet activation, signaling and aggregation
R-HSA-76005	Response to elevated platelet cytosolic Ca2+

MSigDB gene sets: 341 (showing top): GSE45365_NK_CELL_VS_CD8_TCELL_UP, GOBP_VESICLE_LOCALIZATION, GOBP_INTRACELLULAR_PROTEIN_TRANSPORT, REACTOME_CYTOKINE_SIGNALING_IN_IMMUNE_SYSTEM, GOBP_RESPONSE_TO_PEPTIDE, GOCC_SECRETORY_GRANULE, REACTOME_PLATELET_ACTIVATION_SIGNALING_AND_AGGREGATION, ENK_UV_RESPONSE_KERATINOCYTE_UP, GCANCTGNY_MYOD_Q6, GOBP_REGULATION_OF_EXOCYTOSIS, GOBP_LEUKOCYTE_MEDIATED_CYTOTOXICITY, GOBP_NEUROTRANSMITTER_TRANSPORT, GOBP_VESICLE_MEDIATED_TRANSPORT, RIZKI_TUMOR_INVASIVENESS_3D_DN, GOBP_LEUKOCYTE_MEDIATED_IMMUNITY

GO Biological Process (11): leukocyte mediated cytotoxicity (GO:0001909), intracellular protein transport (GO:0006886), obsolete vesicle docking involved in exocytosis (GO:0006904), regulation of mast cell degranulation (GO:0043304), neutrophil degranulation (GO:0043312), cellular response to type II interferon (GO:0071346), presynaptic dense core vesicle exocytosis (GO:0099525), exocytosis (GO:0006887), protein transport (GO:0015031), vesicle-mediated transport (GO:0016192), regulated exocytosis (GO:0045055)

GO Molecular Function (4): syntaxin-1 binding (GO:0017075), syntaxin-3 binding (GO:0030348), protein binding (GO:0005515), syntaxin binding (GO:0019905)

GO Cellular Component (13): extracellular region (GO:0005576), cytosol (GO:0005829), plasma membrane (GO:0005886), apical plasma membrane (GO:0016324), secretory granule (GO:0030141), specific granule (GO:0042581), azurophil granule (GO:0042582), zymogen granule membrane (GO:0042589), cytolytic granule (GO:0044194), phagocytic vesicle (GO:0045335), extracellular exosome (GO:0070062), tertiary granule (GO:0070820), presynapse (GO:0098793)

Reactome top-level categories

Rollup of top-6 pathways:

Category	Pathways
Response to elevated platelet cytosolic Ca2+	1
Signaling by Interleukins	1
Immune System	1
Cytokine Signaling in Immune system	1
Hemostasis	1
Platelet activation, signaling and aggregation	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
secretory granule	3
intracellular protein localization	2
transport	2
syntaxin binding	2
cell killing	1
leukocyte mediated immunity	1
protein transport	1
intracellular transport	1
regulation of myeloid leukocyte mediated immunity	1
regulation of leukocyte degranulation	1
mast cell degranulation	1
neutrophil activation involved in immune response	1
neutrophil mediated immunity	1
leukocyte degranulation	1
response to type II interferon	1
cellular response to cytokine stimulus	1
calcium ion-regulated exocytosis of neurotransmitter	1
neuronal dense core vesicle exocytosis	1
vesicle-mediated transport	1
secretion by cell	1
vesicle fusion to plasma membrane	1
establishment of protein localization	1
cellular process	1
exocytosis	1
binding	1
SNARE binding	1
cytoplasm	1
membrane	1
cell periphery	1
apical part of cell	1
plasma membrane region	1
endomembrane system	1
secretory vesicle	1
primary lysosome	1
secretory granule membrane	1
zymogen granule	1
lysosome	1
endocytic vesicle	1
extracellular vesicle	1

Protein interactions and networks

STRING

1380 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
STXBP2	STX11	O75558	996
STXBP2	UNC13D	Q70J99	967
STXBP2	STX19	Q8N4C7	931
STXBP2	FHL2	Q14192	884
STXBP2	LYST	Q99698	793
STXBP2	STX3	Q13277	787
STXBP2	STX2	P32856	776
STXBP2	RAB27A	P51159	774
STXBP2	SH2D1A	O60880	764
STXBP2	VAMP8	Q9BV40	739
STXBP2	AP3B1	O00203	720
STXBP2	VAMP2	P19065	695
STXBP2	PRF1	P14222	663
STXBP2	SYTL3	Q4VX76	656
STXBP2	SYTL4	Q96C24	650

IntAct

68 interactions, top by confidence:

A	B	Type	Score
STX11	SNAP23	psi-mi:“MI:0914”(association)	0.900
STX19	STXBP1	psi-mi:“MI:0914”(association)	0.850
SOD1	CCS	psi-mi:“MI:0914”(association)	0.830
STXBP2	STX11	psi-mi:“MI:0915”(physical association)	0.770
STXBP2	STX11	psi-mi:“MI:0403”(colocalization)	0.770
TUSC3	RPN2	psi-mi:“MI:0914”(association)	0.730
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
STX3	SNAP23	psi-mi:“MI:0914”(association)	0.660
TRDN	TMEM223	psi-mi:“MI:0914”(association)	0.640
STX3	NBAS	psi-mi:“MI:0914”(association)	0.530
STX11	EXOC5	psi-mi:“MI:0914”(association)	0.530
BAG2	HGS	psi-mi:“MI:0914”(association)	0.530
STX3	YKT6	psi-mi:“MI:0914”(association)	0.530
SPATA24	GGPS1	psi-mi:“MI:0914”(association)	0.530
FAM174A	BLTP3B	psi-mi:“MI:0914”(association)	0.530
SPATA24	CDR2	psi-mi:“MI:0914”(association)	0.530
CERS6	ATP5F1B	psi-mi:“MI:0914”(association)	0.530
GPRC5B	STXBP3	psi-mi:“MI:0914”(association)	0.530
BAG2	DNAJB6	psi-mi:“MI:0914”(association)	0.530
STXBP2	HSP90B1	psi-mi:“MI:0915”(physical association)	0.400
Tubg1	BDP1	psi-mi:“MI:0914”(association)	0.350
Smad3		psi-mi:“MI:0914”(association)	0.350

BioGRID (108): STXBP2 (Affinity Capture-MS), STXBP2 (Affinity Capture-MS), STXBP2 (Affinity Capture-MS), STXBP2 (Affinity Capture-MS), STXBP2 (Affinity Capture-MS), APRT (Co-fractionation), STXBP2 (Affinity Capture-MS), STXBP2 (Affinity Capture-MS), STXBP2 (Affinity Capture-MS), STXBP2 (Affinity Capture-MS), STXBP2 (Affinity Capture-MS), STXBP2 (Affinity Capture-Western), STXBP2 (Affinity Capture-MS), STXBP2 (Affinity Capture-MS), STXBP2 (Affinity Capture-MS)

ESM2 similar proteins: A6QNM2, B0W010, B4JSI3, B4NAU8, F4I562, O42857, O94669, P05165, P15112, P43621, P47795, P53676, P53677, P53678, P78963, Q09236, Q09718, Q0J0S6, Q15833, Q24K11, Q28288, Q54QC8, Q55EZ6, Q5BJP6, Q5R478, Q5R600, Q5ZMP7, Q62753, Q64324, Q750L8, Q7Q3I6, Q7ZXP8, Q84K16, Q84WU9, Q8LPK4, Q8LPL6, Q8R2Q4, Q8R2R9, Q90705, Q969S9

Diamond homologs: O00186, O08599, P34815, P61763, P61764, P61765, Q07327, Q15833, Q28288, Q29268, Q54QC8, Q5R6D2, Q60770, Q62753, Q64324, Q6R748, Q9SZ77, O94590, Q9C5X3, Q5VNU3, O74534, P22213, Q62991, Q7XWP3, Q8BRF7, Q8WVM8, Q9C5P7, Q9SL48

SIGNOR signaling

3 interactions.

A	Effect	B	Mechanism
CDK5	down-regulates	STXBP2	phosphorylation
STXBP2	“up-regulates activity”	STX11	binding
STXBP2	“form complex”	“STX11-VAMP8 SNARE complex”	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 80 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

GO biological processes:

GO term	Partners	Fold	FDR
exocytosis	8	17.6×	9e-06
intracellular protein transport	7	6.6×	8e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

1254 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	47
Likely pathogenic	45
Uncertain significance	404
Likely benign	600
Benign	53

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1029119	NM_006949.4(STXBP2):c.607del (p.His203fs)	Pathogenic
1184439	NM_006949.4(STXBP2):c.1146del (p.Lys383fs)	Pathogenic
125441	NM_001171155.2(PET100):c.3G>C (p.Met1Ile)	Pathogenic
1385750	NM_006949.4(STXBP2):c.982C>T (p.Gln328Ter)	Pathogenic
1410439	NM_006949.4(STXBP2):c.539_540delinsAA (p.Cys180Ter)	Pathogenic
1451101	NC_000019.9:g.(?7709480)(7712696_?)del	Pathogenic
1454871	NM_006949.4(STXBP2):c.1213C>T (p.Arg405Trp)	Pathogenic
1458975	NM_006949.4(STXBP2):c.284del (p.Pro95fs)	Pathogenic
1988382	NM_006949.4(STXBP2):c.864G>A (p.Trp288Ter)	Pathogenic
2034454	NM_006949.4(STXBP2):c.71_72del (p.Lys24fs)	Pathogenic
2088755	NM_006949.4(STXBP2):c.420C>A (p.Tyr140Ter)	Pathogenic
2120770	NM_006949.4(STXBP2):c.859_883del (p.Leu287fs)	Pathogenic
2185136	NM_006949.4(STXBP2):c.1009C>T (p.Gln337Ter)	Pathogenic
2679076	NM_006949.4(STXBP2):c.430-1G>A	Pathogenic
2736769	NM_006949.4(STXBP2):c.1254_1257del (p.Ser418fs)	Pathogenic
2736770	NM_006949.4(STXBP2):c.1294C>T (p.Gln432Ter)	Pathogenic
2742940	NM_006949.4(STXBP2):c.1116dup (p.Met373fs)	Pathogenic
2743139	NM_006949.4(STXBP2):c.708_794delinsCTGGAACGTGAGCTCATGCA (p.Ala237fs)	Pathogenic
2743350	NM_006949.4(STXBP2):c.1207_1208del (p.Lys403fs)	Pathogenic
2744752	NM_006949.4(STXBP2):c.1008C>G (p.Tyr336Ter)	Pathogenic
2746710	NM_006949.4(STXBP2):c.297C>G (p.Tyr99Ter)	Pathogenic
2752778	NM_006949.4(STXBP2):c.661G>T (p.Glu221Ter)	Pathogenic
2780424	NM_006949.4(STXBP2):c.1003C>T (p.Gln335Ter)	Pathogenic
2793176	NM_006949.4(STXBP2):c.1382del (p.Glu461fs)	Pathogenic
2835756	NM_006949.4(STXBP2):c.1342_1346dup (p.Asn450fs)	Pathogenic
2840748	NM_006949.4(STXBP2):c.34dup (p.Glu12fs)	Pathogenic
2846930	NM_006949.4(STXBP2):c.1364_1377del (p.Gly455fs)	Pathogenic
2980233	NM_006949.4(STXBP2):c.132C>A (p.Cys44Ter)	Pathogenic
3069062	NM_006949.4(STXBP2):c.224_227del (p.Tyr75fs)	Pathogenic
330555	NM_006949.4(STXBP2):c.1247-1G>C	Pathogenic

SpliceAI

2935 predictions. Top by Δscore:

Variant	Effect	Δscore
19:7637184:A:T	donor_gain	1.0000
19:7637187:G:GG	donor_gain	1.0000
19:7639729:A:AG	acceptor_gain	1.0000
19:7639730:G:GA	acceptor_gain	1.0000
19:7639730:GTT:G	acceptor_gain	1.0000
19:7639820:G:GG	donor_gain	1.0000
19:7639824:GCGT:G	donor_gain	1.0000
19:7640806:GACA:G	donor_gain	1.0000
19:7640810:GTGA:G	donor_gain	1.0000
19:7640814:G:GG	donor_gain	1.0000
19:7640820:A:T	donor_gain	1.0000
19:7640898:A:AG	acceptor_gain	1.0000
19:7640899:G:GG	acceptor_gain	1.0000
19:7641001:CAGG:C	donor_loss	1.0000
19:7641002:AGG:A	donor_loss	1.0000
19:7641003:GGT:G	donor_loss	1.0000
19:7641004:GTA:G	donor_loss	1.0000
19:7641005:T:G	donor_loss	1.0000
19:7641827:GGA:G	donor_gain	1.0000
19:7641828:GAG:G	donor_gain	1.0000
19:7641854:G:GG	donor_gain	1.0000
19:7642117:AGGTG:A	donor_loss	1.0000
19:7642119:GTG:G	donor_loss	1.0000
19:7642120:T:A	donor_loss	1.0000
19:7642323:G:GT	donor_gain	1.0000
19:7642329:TACAG:T	donor_loss	1.0000
19:7642330:ACAG:A	donor_loss	1.0000
19:7642331:CAGG:C	donor_loss	1.0000
19:7642332:AGGTC:A	donor_loss	1.0000
19:7642333:GG:G	donor_loss	1.0000

AlphaMissense

3876 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
19:7639734:T:A	V58D	1.000
19:7642496:T:A	W288R	1.000
19:7642496:T:C	W288R	1.000
19:7639023:T:C	L31P	0.999
19:7639784:T:G	Y75D	0.999
19:7642329:T:G	Y264D	0.999
19:7642498:G:C	W288C	0.999
19:7642498:G:T	W288C	0.999
19:7642509:G:C	R292P	0.999
19:7642999:T:C	L326P	0.999
19:7643041:T:C	L340P	0.999
19:7643178:T:C	L347P	0.999
19:7643184:T:C	L349P	0.999
19:7643197:T:G	C353W	0.999
19:7638770:T:A	W28R	0.998
19:7638770:T:C	W28R	0.998
19:7639023:T:A	L31H	0.998
19:7640744:T:C	L87P	0.998
19:7640779:T:G	Y99D	0.998
19:7640789:C:A	A102D	0.998
19:7640990:C:A	P139H	0.998
19:7641813:T:C	C180R	0.998
19:7642069:T:A	V205D	0.998
19:7642081:T:C	L209P	0.998
19:7642272:C:G	H245D	0.998
19:7642508:C:A	R292S	0.998
19:7642517:C:G	H295D	0.998
19:7642519:T:A	H295Q	0.998
19:7642519:T:G	H295Q	0.998
19:7642521:T:A	I296N	0.998

dbSNP variants (sampled 300 via entrez): RS1000021651 (19:7645938 C>T), RS1000070855 (19:7645589 G>A), RS10001 (19:7646335 T>A,C), RS1000100197 (19:7640860 G>T), RS1000135223 (19:7646105 GTCTCTCGCTC>G,GTCTCTCGCTCTCTCTCGCTC), RS1000235521 (19:7641078 A>G), RS1000363066 (19:7640629 A>G,T), RS1000395037 (19:7637121 G>A), RS1000400477 (19:7645997 G>A,T), RS1000662251 (19:7637012 G>C), RS1000815194 (19:7637729 G>A), RS1000845390 (19:7644917 G>A,T), RS1000859301 (19:7637435 C>A,T), RS1000969969 (19:7641611 C>T), RS1001024686 (19:7647018 A>G)

Disease associations

OMIM: gene MIM:601717 | disease phenotypes: MIM:613101, MIM:267700, MIM:619055, MIM:220110

GenCC curated gene-disease

Disease	Classification	Inheritance
familial hemophagocytic lymphohistiocytosis 5	Definitive	Autosomal recessive
hereditary hemophagocytic lymphohistiocytosis	Supportive	Autosomal recessive
microvillus inclusion disease	Limited	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
familial hemophagocytic lymphohistiocytosis 5	Definitive	AR

Mondo (7): familial hemophagocytic lymphohistiocytosis 5 (MONDO:0013135), autoinflammatory syndrome (MONDO:0019751), hereditary hemophagocytic lymphohistiocytosis (MONDO:0015541), mitochondrial complex IV deficiency, nuclear type 12 (MONDO:0033646), mitochondrial complex IV deficiency, nuclear type 1 (MONDO:0700250), thrombocytopenia (MONDO:0002049), microvillus inclusion disease (MONDO:0009635)

Orphanet (3): Familial hemophagocytic lymphohistiocytosis (Orphanet:540), Autoinflammatory syndrome (Orphanet:93665), Primary hemophagocytic lymphohistiocytosis (Orphanet:158038)

HPO phenotypes

54 total (30 of 54 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000407	Sensorineural hearing impairment
HP:0000707	Abnormality of the nervous system
HP:0000952	Jaundice
HP:0000967	Petechiae
HP:0000978	Bruising susceptibility
HP:0000979	Purpura
HP:0000988	Skin rash
HP:0001019	Erythroderma
HP:0001250	Seizure
HP:0001259	Coma
HP:0001410	Decreased liver function
HP:0001433	Hepatosplenomegaly
HP:0001744	Splenomegaly
HP:0001873	Thrombocytopenia
HP:0001875	Decreased total neutrophil count
HP:0001903	Anemia
HP:0001945	Fever
HP:0001954	Recurrent fever
HP:0002086	Abnormality of the respiratory system
HP:0002155	Hypertriglyceridemia
HP:0002240	Hepatomegaly
HP:0002383	Infectious encephalitis
HP:0002500	Abnormal cerebral white matter morphology
HP:0002583	Colitis
HP:0002611	Cholestatic liver disease
HP:0002716	Lymphadenopathy
HP:0002788	Recurrent upper respiratory tract infections
HP:0002910	Elevated circulating hepatic transaminase concentration
HP:0002958	Immune dysregulation

GWAS associations

0 associations (top):

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D013921	Thrombocytopenia	C15.378.140.855; C15.378.243.937
C567752	Hemophagocytic Lymphohistiocytosis, Familial, 5 (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

38 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Air Pollutants	affects expression, increases expression, affects cotreatment, increases abundance, increases oxidation	3
Smoke	decreases expression, increases abundance, increases expression	3
Ozone	increases abundance, affects expression, affects cotreatment, increases oxidation	2
Tetrachlorodibenzodioxin	increases expression	2
Tobacco Smoke Pollution	affects expression, increases expression	2
Tretinoin	increases expression	2
aristolochic acid I	increases expression	1
triphenyl phosphate	affects expression	1
alpha-pinene	increases abundance, affects cotreatment, increases oxidation	1
pyrogallol 1,3-dimethyl ether	affects cotreatment, affects localization, increases expression	1
beta-lapachone	increases expression, decreases expression	1
sodium arsenite	increases expression	1
aflatoxin B2	increases methylation	1
nickel sulfate	increases expression	1
methacrylaldehyde	affects cotreatment, increases oxidation, increases abundance	1
monomethylarsonous acid	increases expression	1
abrine	increases expression	1
hexabrominated diphenyl ether 153	decreases expression	1
(+)-JQ1 compound	decreases expression	1
Sunitinib	decreases expression	1
Acrolein	affects cotreatment, increases oxidation, increases abundance	1
Amiodarone	increases expression	1
Benzo(a)pyrene	affects methylation	1
Carmustine	decreases expression	1
Furaldehyde	affects cotreatment, affects localization, decreases expression	1
Gasoline	increases abundance, increases expression, affects cotreatment	1
Ivermectin	decreases expression	1
Polycyclic Aromatic Hydrocarbons	increases abundance, increases expression, affects cotreatment	1
Sodium Chloride	increases expression, affects cotreatment, affects localization, decreases expression	1
Sulindac	increases expression	1

Cellosaurus cell lines

2 cell lines: 1 cancer cell line, 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_GR67	HeLa-Munc18b	Cancer cell line	Female
CVCL_GR68	HEK-293-Munc18b	Transformed cell line	Female

Clinical trials (associated diseases)

251 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT05744063	PHASE4	COMPLETED	A Post-authorization Study to Describe the Safety and Efficacy of Emapalumab for the Treatment of pHLH in Treatment Experienced Chinese Patients
NCT00039858	PHASE4	COMPLETED	Evaluation of Argatroban Injection in Pediatric Patients Requiring Anticoagulant Alternatives to Heparin
NCT00239733	PHASE4	TERMINATED	Anti-D for Treating Thrombocytopenia in Adults Infected With Hepatitis C Virus With or Without HIV Co-Infection
NCT00907478	PHASE4	COMPLETED	Study on Bone Marrow Morphology in Adults Receiving Romiplostim for Treatment of Thrombocytopenia Associated With Immune Thrombocytopenia Purpura (ITP)
NCT01727401	PHASE4	TERMINATED	Thromboprophylaxis of Venous Thromboembolism in Acutely-ill Medical Inpatients With Thrombocytopenia
NCT02032134	PHASE4	TERMINATED	Protocol for the Infusion of Buffy Coat-derived Cryopreserved Platelets in Patients With Severe Thrombocytopenia
NCT02267993	PHASE4	COMPLETED	Efficacy and Safety of rhTPO for the Treatment of Thrombocytopenia After Chemotherapy in AML Patients
NCT03633019	PHASE4	UNKNOWN	High-dose Use of rhTPO in CIT Patients
NCT03688191	PHASE4	UNKNOWN	Study of Sirolimus in CTD-TP in China
NCT04906083	PHASE4	UNKNOWN	Avatrombopag in Patients With End-stage Liver Disease and Thrombocytopenia
NCT05217719	PHASE4	UNKNOWN	Effects of Recombinant Human Thrombopoietin on Platelet Levels in ICU Patients
NCT05255003	PHASE4	RECRUITING	STrategies for Anticoagulation in Patients With thRombocytopenia and Cancer-associated Thrombosis
NCT05382013	PHASE4	UNKNOWN	Efficacy and Safety of Avatrombopag for Treating TCP in HBV-ACLF Patients Receiving ALSS Treatment
NCT05944458	PHASE4	COMPLETED	Efficacy of Intravenous N-Acetylcysteine in Preventing Linezolid-Induced Thrombocytopenia in Critically Ill Patients
NCT06562738	PHASE4	RECRUITING	Clinical Study on Efficacy and Safety of Hetrombopag in the Preoperative Patients of Thrombocytopenia
NCT03312751	PHASE3	COMPLETED	Study to Assess the Efficacy and Safety of Emapalumab in Primary Haemophagocytic Lymphohistiocytosis
NCT00037791	PHASE3	COMPLETED	Safety and Efficacy of (PN-152,243)/PN-196,444 in the Prevention of Thrombocytopenia
NCT00039910	PHASE3	COMPLETED	Safety and Efficacy of (PN-152,243)/PN-196,444 in the Prevention of Thrombocytopenia
NCT00073580	PHASE3	COMPLETED	Angiomax in Patients With HIT/HITTS Type II Undergoing Off-Pump Coronary Artery Bypass Grafting (CABG) (CHOOSE)
NCT00102323	PHASE3	COMPLETED	AMG 531 Treatment of Thrombocytopenic Subjects With Immune (Idiopathic) Thrombocytopenic Purpura (ITP) Refractory to Splenectomy
NCT00102336	PHASE3	COMPLETED	AMG 531 Treatment of Thrombocytopenic Subjects With Immune (Idiopathic) Thrombocytopenic Purpura (ITP) Prior to Splenectomy
NCT00116688	PHASE3	COMPLETED	Open Label Extension Study of Romiplostim (AMG 531) in Thrombocytopenic Patients With Immune (Idiopathic) Thrombocytopenic Purpura (ITP)
NCT00128713	PHASE3	COMPLETED	Optimal Platelet Dose Strategy for Management of Thrombocytopenia
NCT00151866	PHASE3	COMPLETED	Efficacy of Transfusions With Platelets Stored in Platelet Additive Solution II Versus Plasma
NCT00261924	PHASE3	COMPLETED	Efficacy and Safety Study of Platelets Treated for Pathogen Inactivation and Stored for Up to Seven Days
NCT00415532	PHASE3	COMPLETED	Romiplostim (AMG 531) Versus Medical Standard of Care for Immune (Idiopathic) Thrombocytopenic Purpura
NCT00420914	PHASE3	TERMINATED	Strategies for Transfusion of Platelets (SToP)
NCT00501345	PHASE3	TERMINATED	Aspirin in Patients With Myocardial Infarction and Thrombocytopenia
NCT00508820	PHASE3	COMPLETED	An Open Label Study of Romiplostim in Adult Thrombocytopenic Subjects With ITP
NCT00678587	PHASE3	TERMINATED	Eltrombopag To Reduce The Need For Platelet Transfusion In Subjects With Chronic Liver Disease And Thrombocytopenia Undergoing Elective Invasive Procedures
NCT01438840	PHASE3	COMPLETED	Efficacy and Safety of Oral E5501 Plus Standard of Care for the Treatment of Thrombocytopenia in Adults With Chronic Immune Thrombocytopenia (Amendment 02)
NCT01444417	PHASE3	COMPLETED	Safety and Efficacy Study of Romiplostim to Treat Immune Thrombocytopenia (ITP) in Pediatric Patients
NCT01805648	PHASE3	UNKNOWN	Efficacy and Safety Study of Maintenance Treatment With rhTPO in Thrombocytopenic Subjects With ITP
NCT02244658	PHASE3	UNKNOWN	Recombinant Human Thrombopoietin (rhTPO) in Management of Chemotherapy-induced Thrombocytopenia in Acute Myelocytic Leukemia
NCT02389621	PHASE3	COMPLETED	Safety and Efficacy Study of Lusutrombopag for Thrombocytopenia in Patients With Chronic Liver Disease Undergoing Elective Invasive Procedures
NCT02444728	PHASE3	TERMINATED	Cyclophosphamide and Hydroxychloroquine for Thrombocytopenia in SLE
NCT02487563	PHASE3	COMPLETED	Prospective Study of Patients With Thrombocytopenia Following HSCT
NCT02578901	PHASE3	COMPLETED	American Trial Using Tranexamic Acid in Thrombocytopenia
NCT03326843	PHASE3	TERMINATED	Avatrombopag for the Treatment of Thrombocytopenia in Adults Scheduled for a Surgical Procedure
NCT03515096	PHASE3	COMPLETED	Eltrombopag vs. rhTPO to Increase Platelet Level After HSCT