SUMO3

Summary

SUMO3 (small ubiquitin like modifier 3, HGNC:11124) is a protein-coding gene on chromosome 21q22.3, encoding Small ubiquitin-related modifier 3 (P55854). Ubiquitin-like protein which can be covalently attached to target lysines either as a monomer or as a lysine-linked polymer.

This gene encodes a member of the small ubiquitin-related modifier (SUMO) family of eukaryotic proteins. The encoded protein is covalently conjugated to other proteins via a post-translation modification known as sumoylation. Sumoylation may play a role in a wide variety of cellular processes, including nuclear transport, DNA replication and repair, mitosis, transcriptional regulation, and signal transduction. Alternatively spliced transcript variants encoding distinct proteins have been described.

Source: NCBI Gene 6612 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 10 total
• Druggable target: yes
• MANE Select transcript: NM_006936

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:11124
Approved symbol	SUMO3
Name	small ubiquitin like modifier 3
Location	21q22.3
Locus type	gene with protein product
Status	Approved
Aliases	SMT3A
Ensembl gene	ENSG00000184900
Ensembl biotype	protein_coding
OMIM	602231
Entrez	6612

Gene structure

Transcript identifiers

Ensembl transcripts: 12 — 10 protein_coding, 1 retained_intron, 1 protein_coding_CDS_not_defined

ENST00000332859, ENST00000397893, ENST00000397898, ENST00000411651, ENST00000466861, ENST00000479153, ENST00000889596, ENST00000889597, ENST00000889598, ENST00000889599, ENST00000932423, ENST00000932424

RefSeq mRNA: 2 — MANE Select: NM_006936 NM_001286416, NM_006936

CCDS: CCDS33587, CCDS68220

Canonical transcript exons

ENST00000332859 — 4 exons

Exon	Start	End
ENSE00000000056	44817948	44818062
ENSE00003489741	44813976	44814104
ENSE00003660434	44809047	44809118
ENSE00003901867	44805617	44807040

Expression profiles

Bgee: expression breadth ubiquitous, 294 present calls, max score 99.05.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 55.9927 / max 435.5910, expressed in 1822 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
190775	46.3776	1822
190776	4.3436	1718
190774	2.9337	1470
190773	1.3067	726
209337	1.0311	779

Top tissues by expression

295 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
endothelial cell	CL:0000115	99.05	gold quality
tibia	UBERON:0000979	98.58	gold quality
parietal pleura	UBERON:0002400	98.58	gold quality
esophagus squamous epithelium	UBERON:0006920	98.58	gold quality
endometrium epithelium	UBERON:0004811	98.57	gold quality
visceral pleura	UBERON:0002401	98.53	gold quality
palpebral conjunctiva	UBERON:0001812	98.45	gold quality
pleura	UBERON:0000977	98.42	gold quality
germinal epithelium of ovary	UBERON:0001304	98.40	gold quality
epithelium of esophagus	UBERON:0001976	98.24	gold quality
squamous epithelium	UBERON:0006914	98.21	gold quality
middle temporal gyrus	UBERON:0002771	98.16	gold quality
pigmented layer of retina	UBERON:0001782	98.05	gold quality
Brodmann (1909) area 23	UBERON:0013554	97.96	gold quality
hair follicle	UBERON:0002073	97.93	gold quality
cervix squamous epithelium	UBERON:0006922	97.87	gold quality
gingival epithelium	UBERON:0001949	97.78	gold quality
hypothalamus	UBERON:0001898	97.57	gold quality
pons	UBERON:0000988	97.49	gold quality
gingiva	UBERON:0001828	97.49	gold quality
lateral nuclear group of thalamus	UBERON:0002736	97.43	gold quality
nucleus accumbens	UBERON:0001882	97.40	gold quality
superior vestibular nucleus	UBERON:0007227	97.31	gold quality
entorhinal cortex	UBERON:0002728	97.27	gold quality
superior frontal gyrus	UBERON:0002661	97.22	gold quality
temporal lobe	UBERON:0001871	97.21	gold quality
nipple	UBERON:0002030	97.21	gold quality
parotid gland	UBERON:0001831	97.20	gold quality
orbitofrontal cortex	UBERON:0004167	97.19	gold quality
amygdala	UBERON:0001876	97.14	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): SP1

miRNA regulators (miRDB)

84 targeting SUMO3, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6758-5P	100.00	66.21	1470
HSA-MIR-6856-5P	100.00	65.47	1298
HSA-MIR-4747-5P	100.00	67.90	2681
HSA-MIR-5196-5P	100.00	67.98	2761
HSA-MIR-4510	100.00	66.60	2050
HSA-MIR-6127	100.00	66.76	2188
HSA-MIR-6129	100.00	66.46	2080
HSA-MIR-6130	100.00	66.69	2012
HSA-MIR-6133	100.00	66.48	2064
HSA-MIR-3924	100.00	72.09	2394
HSA-MIR-548AN	99.97	70.91	2817
HSA-LET-7C-3P	99.95	73.42	2862
HSA-MIR-545-3P	99.95	70.74	2783
HSA-MIR-552-5P	99.93	68.56	1583
HSA-MIR-497-5P	99.92	71.83	2674
HSA-MIR-15A-5P	99.90	72.80	2787
HSA-MIR-15B-5P	99.90	72.78	2798
HSA-MIR-16-5P	99.90	72.80	2780
HSA-MIR-195-5P	99.90	72.81	2805
HSA-MIR-424-5P	99.89	71.90	2641
HSA-MIR-6838-5P	99.89	71.94	2690
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-8080	99.82	67.52	1342
HSA-MIR-6875-3P	99.82	70.26	2983
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-4659A-3P	99.80	72.62	4248
HSA-MIR-4659B-3P	99.80	72.62	4248
HSA-MIR-498-5P	99.76	69.64	1807
HSA-MIR-199A-3P	99.75	70.48	929
HSA-MIR-199B-3P	99.75	70.48	929

Literature-anchored findings (GeneRIF, showing 40)

• SUMO3 has a role in PIASy-enhanced modification of C-EPB alpha (PMID:12511558)
• SUMO-1 shows patterns of utilization that are clearly discrete from the patterns of SUMO-2 and -3 throughout the cell cycle (PMID:15456902)
• Dissimilarities between SUMO-3 and SUMO-1 in tertiary structure. (PMID:15723523)
• c-Fos/c-Jun AP-1 dimer activity is downregulated by SUMO-1, SUMO-2, and SUMO-3 (PMID:16055710)
• SMT3A expression was down-regulated in association with DNA synthesis induction after X-ray irradiation in basal cell nevus syndrome cells. (PMID:16154602)
• Results describe the crystal structure of the central region of thymine-DNA glycosylase conjugated to SUMO-3. (PMID:16626738)
• p53 and pRB can be sumoylated by SUMO-2/3 in vivo, and such modification of p53 and pRB may play roles in premature senescence and stress response (PMID:17012228)
• sumoylation has a role in keratinocyte differentiation (PMID:17164289)
• SUMOylation is a key regulator of the mammalian cell cycle, with SUMO-2/3 modification of different proteins regulating distinct processes. (PMID:18374647)
• SUMO-2/3 conjugation and the ubiquitin-proteasome system are tightly integrated and act in a cooperative manner. (PMID:18565875)
• SUMO-2/3, though expressed similarly to SUMO-1, may function separately and independently during pachytene in men. (PMID:18694876)
• BLM, the RecQ DNA helicase mutated in Bloom syndrome, is preferentially modified by SUMO-2/3 both in vitro and in vivo (PMID:18708356)
• the acidic stretch of the SIM of MCAF1 plays an important role in the binding to SUMO-3. (PMID:18842587)
• Data describe a mitotic SUMO2/3 conjugation-deconjugation cycle of Borealin and further assign a regulatory function of RanBP2 and SENP3 in the mitotic SUMO pathway. (PMID:18946085)
• CTCF protein can be posttranslationally modified by the small ubiquitin-like protein SUMO. (PMID:19029252)
• HSP27-induced HSF1 modification by SUMO-2/3 takes place downstream of the transcription factor phosphorylation on S303 and S307 and does not affect its DNA-binding ability (PMID:19597476)
• Results show that nuclear actin is modified by SUMO2 and SUMO3 and that computational modeling and site-directed mutagenesis identified K68 and K284 as critical sites for SUMOylating actin. (PMID:19635839)
• these findings suggest an expanded role of p150 as a SUMO2/3-interacting factor, and raise the intriguing possibility that p150 plays a role in promoting delivery of SUMO2/3 or SUMO2/3-modified proteins (or both) on chromatin fibers during replication. (PMID:19919826)
• SENP3-mediated de-conjugation of SUMO2/3 from promyelocytic leukemia is correlated with accelerated cell proliferation under mild oxidative stress. (PMID:20181954)
• The expression of SUMO2 and SUMO3 is regulated differently by reactive oxygen species. (PMID:21291420)
• Loop 1 insertion in SENP6 and SENP7 as a platform to discriminate between SUMO1 and SUMO2/3 isoforms in this subclass of the SUMO protease family. (PMID:21878624)
• Conjugation of SUMO-2/3 to p53 correlates with a reduction of both activation and repression of a subset of p53-target genes. (PMID:21900752)
• sumoylation of proteins during keratinocyte differentiation is a complex process which likely reflects and contributes to the biochemical changes that drive differentiation. (PMID:22291911)
• The 15q24 microdeletion may thus represent the first genetic hit to initiate leukaemogenesis and implicates PML and SUMO3 as novel components of the leukaemogenic network in TMD/AMKL. (PMID:22296450)
• SUMO-2/3 conjugates accumulating under the heat shock or MG132 treatment result largely from new protein synthesis. (PMID:22306003)
• Only two missense variants were identified, both within SUMO3, however, these were both present in multiple affected individuals and a similar number of controls. (PMID:22492558)
• SUMO3-conjugated IRF8 shows reduced mobility in live nuclei and binds poorly to the interleukin (IL)12p40 gene. (PMID:22942423)
• Data suggest that SUMO1 and SUMO2/3 are highly enriched in neck area of sperm; SUMOs are also associated with redundant nuclear envelope, flagella, and some sperm head regions. (PMID:23077236)
• findings show levels of SUMO1- and SUMO2/3-conjugated proteins are elevated in astrocytic tumors; findings highlight the pivotal role of SUMO conjugation in DNA damage repair processes (PMID:23078246)
• Overexpression of SUMO-1 and 3 enhanced accumulation of viral DNA, which correlated with an increase in viral replication. (PMID:23407422)
• We show that human RNF111/Arkadia is a new sumo targeted ligase, which used three adjacent sumo acting motifs for specific recognition of poly-SUMO2/3 chains. (PMID:23751493)
• K-Rta degrades SUMO-2/3 and SUMO-2/3 modified proteins, including promyelocytic leukemia (PML) and K-bZIP. (PMID:23990779)
• Stress-induced phosphorylation of Thr486 in c-Myb by p38 mitogen-activated protein kinases attenuates conjugation of SUMO-2/3. (PMID:24257756)
• SUMO-2/3 modification near protein-coding gene promoters occurs in order to maintain host immune-related gene unaltered during viral reactivation. (PMID:24267727)
• Expression of SUMO1/2/3 is dramatically enhanced by interferons through an miRNA-based mechanism involving the Lin28/let-7. (PMID:24942926)
• In human cells, Ehrlichia chaffeensis TRP120 was selectively conjugated with SUMO2/3 isoforms. (PMID:25047847)
• PHD3 SUMOylation occurs at a cluster of four lysines at the C-terminal end of the protein. Furthermore, PHD3 SUMOylation by SUMO2 or SUMO3 contributes to PHD3-mediated repression of HIF1-dependent transcriptional activity. (PMID:25380826)
• DBC1 modification by Small Ubiquitin-like Modifier 2/3 is crucial for p53 transactivation under genotoxic stress. (PMID:25406032)
• These findings demonstrated a role for the human adenovirus E4-ORF3 protein as a regulator of ubiquitin-like modifications and revealed new SUMO3 substrates induced by E4-ORF3. (PMID:25410875)
• The interactions of SLX4 with SUMO and ubiquitin increase its affinity for factors recognizing different DNA lesions or telomeres, helping to direct the SLX4 complex in distinct functional contexts. (PMID:25533185)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	sumo3a	ENSDARG00000028119
danio_rerio	sumo3b	ENSDARG00000035993
mus_musculus	Sumo3	ENSMUSG00000020265
rattus_norvegicus	Sumo3	ENSRNOG00000038489
drosophila_melanogaster	Sumo	FBGN0264922

Paralogs (3): NFATC2IP (ENSG00000176953), SUMO4 (ENSG00000177688), SUMO2 (ENSG00000188612)

Protein

Protein identifiers

Small ubiquitin-related modifier 3 — P55854 (reviewed: P55854)

Alternative names: SMT3 homolog 1, SUMO-2, Ubiquitin-like protein SMT3A

All UniProt accessions (3): A8MU27, A8MUA9, P55854

UniProt curated annotations — full annotation on UniProt →

Function. Ubiquitin-like protein which can be covalently attached to target lysines either as a monomer or as a lysine-linked polymer. Does not seem to be involved in protein degradation and may function as an antagonist of ubiquitin in the degradation process. Plays a role in a number of cellular processes such as nuclear transport, DNA replication and repair, mitosis and signal transduction. Covalent attachment to its substrates requires prior activation by the E1 complex SAE1-SAE2 and linkage to the E2 enzyme UBE2I, and can be promoted by an E3 ligase such as PIAS1-4, RANBP2 or CBX4. Plays a role in the regulation of sumoylation status of SETX.

Subunit / interactions. Covalently attached to a number of proteins. Interacts with BMAL1. Interacts with USP25 (via ts SIM domain); the interaction sumoylates USP25 and inhibits its ubiquitin hydrolyzing activity. Interacts with SAE2 and UBE2I.

Subcellular location. Cytoplasm. Nucleus. PML body.

Tissue specificity. Expressed predominantly in liver.

Post-translational modifications. Polymeric chains can be formed through Lys-11 cross-linking. Cleavage of precursor form by SENP1, SENP2 or SENP5 is necessary for function.

Similarity. Belongs to the ubiquitin family. SUMO subfamily.

Isoforms (2)

UniProt ID	Names	Canonical?
P55854-1	1	yes
P55854-2	2

RefSeq proteins (2): NP_001273345, NP_008867* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000626	Ubiquitin-like_dom	Domain
IPR022617	Rad60/SUMO-like_dom	Domain
IPR029071	Ubiquitin-like_domsf	Homologous_superfamily

Pfam: PF11976

UniProt features (26 total): strand 7, cross-link 5, mutagenesis site 3, turn 3, sequence conflict 2, chain 1, propeptide 1, domain 1, helix 1, splice variant 1, sequence variant 1

Structure

Experimental structures (PDB)

8 structures.

PDB	Method	Resolution (Å)
7R2E	X-RAY DIFFRACTION	1.74
7ZJU	X-RAY DIFFRACTION	2.17
9GNN	X-RAY DIFFRACTION	2.36
2IO1	X-RAY DIFFRACTION	2.6
6NNQ	X-RAY DIFFRACTION	2.62
1U4A	SOLUTION NMR
2MP2	SOLUTION NMR
6K5R	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P55854-F1	81.94	0.54

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (5): 5, 7, 11, 11, 92

Mutagenesis-validated functional residues (3):

Position	Phenotype
11	abolishes the formation of poly(sumo) chains.
33	impaired interaction with usp25; when associated with a-34.
34	impaired interaction with usp25; when associated with a-33.

Function

Pathways and Gene Ontology

Reactome pathways

19 pathways

ID	Pathway
R-HSA-3065676	SUMO is conjugated to E1 (UBA2:SAE1)
R-HSA-3065678	SUMO is transferred from E1 to E2 (UBE2I, UBC9)
R-HSA-3065679	SUMO is proteolytically processed
R-HSA-3108214	SUMOylation of DNA damage response and repair proteins
R-HSA-3232118	SUMOylation of transcription factors
R-HSA-3899300	SUMOylation of transcription cofactors
R-HSA-4090294	SUMOylation of intracellular receptors
R-HSA-4551638	SUMOylation of chromatin organization proteins
R-HSA-4615885	SUMOylation of DNA replication proteins
R-HSA-4755510	SUMOylation of immune response proteins
R-HSA-5696395	Formation of Incision Complex in GG-NER
R-HSA-2990846	SUMOylation
R-HSA-3108232	SUMO E3 ligases SUMOylate target proteins
R-HSA-3215018	Processing and activation of SUMO
R-HSA-392499	Metabolism of proteins
R-HSA-5696398	Nucleotide Excision Repair
R-HSA-5696399	Global Genome Nucleotide Excision Repair (GG-NER)
R-HSA-597592	Post-translational protein modification
R-HSA-73894	DNA Repair

MSigDB gene sets: 218 (showing top): REACTOME_FORMATION_OF_INCISION_COMPLEX_IN_GG_NER, ELVIDGE_HYPOXIA_DN, TGCTGCT_MIR15A_MIR16_MIR15B_MIR195_MIR424_MIR497, MORF_UBE2I, MORF_HDAC1, MORF_RAD21, MITSIADES_RESPONSE_TO_APLIDIN_DN, MONNIER_POSTRADIATION_TUMOR_ESCAPE_UP, GOBP_PEPTIDYL_LYSINE_MODIFICATION, MORF_SKP1A, BLALOCK_ALZHEIMERS_DISEASE_UP, MORF_CTBP1, SCHAEFFER_PROSTATE_DEVELOPMENT_12HR_DN, GOBP_PROTEIN_SUMOYLATION, YAO_TEMPORAL_RESPONSE_TO_PROGESTERONE_CLUSTER_13

GO Biological Process (3): protein sumoylation (GO:0016925), regulation of protein localization to nucleus (GO:1900180), negative regulation of DNA binding (GO:0043392)

GO Molecular Function (3): protein tag activity (GO:0031386), ubiquitin-like protein ligase binding (GO:0044389), protein binding (GO:0005515)

GO Cellular Component (5): kinetochore (GO:0000776), nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), PML body (GO:0016605)

Reactome top-level categories

Rollup of top-8 pathways:

Category	Pathways
SUMO E3 ligases SUMOylate target proteins	7
Processing and activation of SUMO	3
SUMOylation	2
Global Genome Nucleotide Excision Repair (GG-NER)	1
Post-translational protein modification	1
DNA Repair	1
Nucleotide Excision Repair	1
Metabolism of proteins	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	2
peptidyl-lysine modification	1
protein modification by small protein conjugation	1
regulation of protein localization	1
protein localization to nucleus	1
DNA binding	1
negative regulation of binding	1
regulation of DNA binding	1
molecular tag activity	1
enzyme binding	1
binding	1
condensed chromosome, centromeric region	1
intracellular membraneless organelle	1
supramolecular complex	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
intracellular anatomical structure	1
nuclear body	1

Protein interactions and networks

STRING

0 interactions, top by confidence (×1000):

IntAct

120 interactions, top by confidence:

A	B	Type	Score
SUMO3	SENP2	psi-mi:“MI:0915”(physical association)	0.800
SENP2	SUMO3	psi-mi:“MI:0915”(physical association)	0.800
SENP2	SUMO3	psi-mi:“MI:0407”(direct interaction)	0.800
USPL1	SUMO3	psi-mi:“MI:0915”(physical association)	0.780
USPL1	SUMO3	psi-mi:“MI:0407”(direct interaction)	0.780
SUMO3	USPL1	psi-mi:“MI:0407”(direct interaction)	0.780
SUMO3	USPL1	psi-mi:“MI:0194”(cleavage reaction)	0.780
USPL1	SUMO3	psi-mi:“MI:0194”(cleavage reaction)	0.780
SUMO3	ZCCHC12	psi-mi:“MI:0915”(physical association)	0.670
ZBTB39	SUMO3	psi-mi:“MI:0915”(physical association)	0.560
	SUMO3	psi-mi:“MI:0915”(physical association)	0.560
SUMO3	ZNF496	psi-mi:“MI:0915”(physical association)	0.560
SUMO3	ZBTB33	psi-mi:“MI:0915”(physical association)	0.560
FAM221A	SUMO3	psi-mi:“MI:0915”(physical association)	0.560
SUMO3	ATXN2	psi-mi:“MI:0915”(physical association)	0.560
HTT	SUMO3	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (178): SUMO3 (Biochemical Activity), SUMO3 (Biochemical Activity), SUMO3 (Biochemical Activity), SUMO3 (Biochemical Activity), SUMO3 (Reconstituted Complex), SUMO3 (Biochemical Activity), SUMO3 (Biochemical Activity), SUMO3 (Biochemical Activity), USPL1 (Two-hybrid), SENP2 (Two-hybrid), SUMO3 (Affinity Capture-RNA), SUMO3 (Affinity Capture-RNA), SUMO3 (Affinity Capture-RNA), SUMO3 (Reconstituted Complex), SUMO3 (Reconstituted Complex)

ESM2 similar proteins: A7WLH8, A7WLI0, B3H5R8, G2XKQ0, O13351, O57686, P29504, P55852, P55853, P55854, P55857, P61955, P61956, P61957, P61958, P61959, P62982, P62983, P63165, P63166, Q12306, Q17QV3, Q28H04, Q2EF74, Q2PFW2, Q3E8A8, Q5E9D1, Q5EAX4, Q5I0H3, Q5R6J4, Q5XIF4, Q5ZHQ1, Q5ZJM9, Q6DEP7, Q6DHL4, Q6DI05, Q6DK72, Q6EEV6, Q6GPW2, Q6LDZ8

Diamond homologs: A7WLH8, A7WLI0, B3H5R8, G2XKQ0, O13351, O57686, P55852, P55853, P55854, P55857, P61955, P61956, P61957, P61958, P61959, P63165, P63166, Q0P4K8, Q12306, Q17QV3, Q28H04, Q2EF74, Q2PFW2, Q5E9D1, Q5EAX4, Q5I0H3, Q5R6J4, Q5XIF4, Q5ZHQ1, Q5ZJM9, Q6DEP7, Q6DHL4, Q6DI05, Q6DK72, Q6EEV6, Q6GPW2, Q6LDZ8, Q6NV25, Q7SZ22, Q7SZR5

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 69 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
SUMOylation of transcription cofactors	8	39.7×	1e-08
SUMOylation of DNA damage response and repair proteins	7	20.9×	1e-05
SUMOylation	5	16.6×	1e-03
SUMOylation of chromatin organization proteins	5	16.2×	1e-03
Activation of anterior HOX genes in hindbrain development during early embryogenesis	5	9.3×	1e-02

GO biological processes:

GO term	Partners	Fold	FDR
protein sumoylation	9	50.3×	8e-11

Disease & clinical

Clinical variants and AI predictions

ClinVar

10 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	5
Likely benign	1
Benign	2

Top pathogenic / likely-pathogenic (0)

SpliceAI

718 predictions. Top by Δscore:

Variant	Effect	Δscore
21:44807050:T:C	acceptor_gain	1.0000
21:44807054:C:CT	acceptor_gain	1.0000
21:44807057:A:T	acceptor_gain	1.0000
21:44807059:C:CT	acceptor_gain	1.0000
21:44807060:A:T	acceptor_gain	1.0000
21:44807063:C:CT	acceptor_gain	1.0000
21:44807065:C:CT	acceptor_gain	1.0000
21:44807066:A:T	acceptor_gain	1.0000
21:44814100:CCCTC:C	acceptor_gain	1.0000
21:44814101:CCTCC:C	acceptor_gain	1.0000
21:44814103:TCCTG:T	acceptor_loss	1.0000
21:44814104:CCTGC:C	acceptor_loss	1.0000
21:44814105:C:A	acceptor_loss	1.0000
21:44814106:T:G	acceptor_loss	1.0000
21:44817943:CTTA:C	donor_loss	1.0000
21:44817944:TTA:T	donor_loss	1.0000
21:44817945:TA:T	donor_loss	1.0000
21:44807037:CCAG:C	acceptor_gain	0.9900
21:44807038:CAGC:C	acceptor_gain	0.9900
21:44807045:C:CT	acceptor_gain	0.9900
21:44807050:T:TC	acceptor_gain	0.9900
21:44807056:C:CT	acceptor_gain	0.9900
21:44807068:C:CT	acceptor_gain	0.9900
21:44807069:G:T	acceptor_gain	0.9900
21:44809045:ACC:A	donor_loss	0.9900
21:44809046:C:CT	donor_loss	0.9900
21:44809117:CC:C	acceptor_gain	0.9900
21:44809118:CC:C	acceptor_gain	0.9900
21:44809119:CTG:C	acceptor_loss	0.9900
21:44809120:T:G	acceptor_loss	0.9900

AlphaMissense

694 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
21:44807015:A:T	I83N	1.000
21:44807033:A:G	M77T	1.000
21:44809054:G:T	P72Q	1.000
21:44809072:A:T	I66N	1.000
21:44809081:C:A	G63V	1.000
21:44809081:C:T	G63E	1.000
21:44809082:C:A	G63W	1.000
21:44809086:G:C	F61L	1.000
21:44809086:G:T	F61L	1.000
21:44809088:A:G	F61L	1.000
21:44809092:G:C	F59L	1.000
21:44809092:G:T	F59L	1.000
21:44809093:A:G	F59S	1.000
21:44809094:A:G	F59L	1.000
21:44814033:G:C	F31L	1.000
21:44814033:G:T	F31L	1.000
21:44814034:A:C	F31C	1.000
21:44814034:A:G	F31S	1.000
21:44814035:A:G	F31L	1.000
21:44814070:A:G	L19P	1.000
21:44814070:A:T	L19Q	1.000
21:44807005:G:C	F86L	0.999
21:44807005:G:T	F86L	0.999
21:44807007:A:G	F86L	0.999
21:44807015:A:C	I83S	0.999
21:44807021:T:A	D81V	0.999
21:44807022:C:G	D81H	0.999
21:44807033:A:C	M77R	0.999
21:44807033:A:T	M77K	0.999
21:44807039:A:G	L75P	0.999

dbSNP variants (sampled 300 via entrez): RS1000074792 (21:44808212 TA>T,TAA,TAAA), RS1000082421 (21:44819634 G>A,C), RS1000312058 (21:44815678 G>A), RS1000315242 (21:44805788 T>C), RS1000356114 (21:44818494 G>A), RS1000436887 (21:44810927 C>G,T), RS1000674085 (21:44806910 A>G), RS1000778170 (21:44812193 A>C,T), RS1000806509 (21:44807741 C>T), RS1001520669 (21:44818762 C>G,T), RS1001706081 (21:44813260 C>T), RS1001803923 (21:44818892 C>T), RS1001821046 (21:44808373 A>C,T), RS1002155280 (21:44813025 C>A), RS1002235837 (21:44811125 TACACACAGGCACACACCCACACATAC>T,TACACACAGGCACACACCCACACATACACACACAGGCACACACCCACACATAC)

Disease associations

OMIM: gene MIM:602231 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST005851_10	Delirium	8.000000e-07

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL3885639 (PROTEIN FAMILY)

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

1 potent at pChembl≥5 of 3 total, top 1 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
5.72	Kd	1900	nM	CHEMBL3580707

CTD chemical–gene interactions

35 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, increases methylation, affects cotreatment, increases expression, decreases expression	8
trichostatin A	affects cotreatment, decreases expression, affects binding, decreases reaction, increases reaction (+1 more)	4
bisphenol A	affects expression, decreases expression, increases expression	3
sodium arsenite	affects cotreatment, decreases expression, increases expression	3
Cyclosporine	decreases expression, decreases methylation	3
FR900359	affects phosphorylation	1
lead acetate	affects cotreatment, decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
hinokiflavone	increases localization	1
K 7174	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	decreases expression, affects cotreatment	1
bisphenol B	increases expression	1
abrine	decreases expression	1
Grape Seed Proanthocyanidins	affects cotreatment, increases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
5-(2,4-dihydroxy-5-isopropylphenyl)-4-(4-morpholin-4-ylmethylphenyl)isoxazole-3-carboxylic acid ethylamide	decreases expression	1
STA 9090	decreases expression	1
bisphenol S	increases expression	1
Acetaminophen	affects response to substance	1
Arsenic	affects methylation	1
Aspirin	increases expression	1
Benzo(a)pyrene	increases methylation	1
Catechin	increases expression, affects cotreatment	1
Endosulfan	increases expression	1
Hydralazine	affects cotreatment, increases expression	1
Methyl Methanesulfonate	decreases expression	1
Phenobarbital	affects expression	1
Rifampin	increases reaction, affects binding, affects cotreatment, decreases reaction	1
Smoke	decreases expression	1
Sulindac	decreases expression	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL3582507	Binding	Binding affinity to His-tagged SUMO2/3 (unknown origin) expressed in Escherichia coli BL21 (DE3) measured over 120 secs by SPR analysis	Discovery of small molecule inhibitors targeting the SUMOSIM interaction using a protein interface consensus approach — Medchemcomm

Cellosaurus cell lines

2 cell lines: 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_TR24	HAP1 SUMO3 (-) 1	Cancer cell line	Male
CVCL_TR25	HAP1 SUMO3 (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.