SURF4

Summary

SURF4 (surfeit 4, HGNC:11476) is a protein-coding gene on chromosome 9q34.2, encoding Surfeit locus protein 4 (O15260). Endoplasmic reticulum cargo receptor that mediates the export of lipoproteins by recruiting cargos into COPII vesicles to facilitate their secretion.

This gene is located in the surfeit gene cluster, which is comprised of very tightly linked housekeeping genes that do not share sequence similarity. The encoded protein is a conserved integral membrane protein that interacts with endoplasmic reticulum-Golgi intermediate compartment proteins. Disruption of this gene results in reduced numbers of endoplasmic reticulum-Golgi intermediate compartment clusters and redistribution of coat protein I to the cytosol. Alternate splicing results in multiple transcript variants.

Source: NCBI Gene 6836 — RefSeq curated summary.

At a glance

• GWAS associations: 4
• Clinical variants (ClinVar): 30 total
• Druggable target: yes
• MANE Select transcript: NM_033161

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:11476
Approved symbol	SURF4
Name	surfeit 4
Location	9q34.2
Locus type	gene with protein product
Status	Approved
Aliases	ERV29, FLJ22993, MGC102753
Ensembl gene	ENSG00000148248
Ensembl biotype	protein_coding
OMIM	185660
Entrez	6836

Gene structure

Transcript identifiers

Ensembl transcripts: 14 — 11 protein_coding, 3 protein_coding_CDS_not_defined

ENST00000371982, ENST00000371989, ENST00000371991, ENST00000465565, ENST00000467910, ENST00000485435, ENST00000545297, ENST00000613129, ENST00000618229, ENST00000875633, ENST00000875634, ENST00000875635, ENST00000928729, ENST00000966075

RefSeq mRNA: 7 — MANE Select: NM_033161 NM_001280788, NM_001280789, NM_001280790, NM_001280791, NM_001280792, NM_001280793, NM_033161

CCDS: CCDS65177, CCDS65178, CCDS6968, CCDS75929

Canonical transcript exons

ENST00000371989 — 6 exons

Exon	Start	End
ENSE00001456637	133361464	133363759
ENSE00003618644	133364840	133365026
ENSE00003622121	133366599	133366675
ENSE00003658329	133365985	133366028
ENSE00003663444	133367259	133367445
ENSE00003841808	133375922	133376060

Expression profiles

Bgee: expression breadth ubiquitous, 134 present calls, max score 99.16.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 127.1158 / max 527.0319, expressed in 1828 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
102994	83.8649	1825
102995	29.0092	1818
102996	7.9845	1787
102993	5.7370	1692
102988	0.2829	124
102987	0.2373	98

Top tissues by expression

134 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
islet of Langerhans	UBERON:0000006	99.16	gold quality
stromal cell of endometrium	CL:0002255	99.09	gold quality
duodenum	UBERON:0002114	98.42	gold quality
pancreas	UBERON:0001264	98.36	gold quality
body of pancreas	UBERON:0001150	98.27	gold quality
placenta	UBERON:0001987	98.25	gold quality
adrenal tissue	UBERON:0018303	97.94	gold quality
right lobe of liver	UBERON:0001114	97.85	gold quality
liver	UBERON:0002107	97.69	gold quality
gall bladder	UBERON:0002110	97.53	gold quality
smooth muscle tissue	UBERON:0001135	97.42	gold quality
left adrenal gland	UBERON:0001234	97.36	gold quality
left uterine tube	UBERON:0001303	97.23	gold quality
left adrenal gland cortex	UBERON:0035825	97.23	gold quality
adenohypophysis	UBERON:0002196	97.16	gold quality
right adrenal gland	UBERON:0001233	97.15	gold quality
adrenal gland	UBERON:0002369	97.15	gold quality
upper lobe of left lung	UBERON:0008952	97.14	gold quality
pituitary gland	UBERON:0000007	97.13	gold quality
body of stomach	UBERON:0001161	97.08	gold quality
bone marrow	UBERON:0002371	97.06	gold quality
vermiform appendix	UBERON:0001154	97.04	gold quality
right adrenal gland cortex	UBERON:0035827	96.95	gold quality
mucosa of transverse colon	UBERON:0004991	96.94	gold quality
rectum	UBERON:0001052	96.92	gold quality
saliva-secreting gland	UBERON:0001044	96.88	gold quality
omental fat pad	UBERON:0010414	96.79	gold quality
stomach	UBERON:0000945	96.77	gold quality
minor salivary gland	UBERON:0001830	96.74	gold quality
lung	UBERON:0002048	96.64	gold quality

Single-cell (SCXA)

Detected in 4 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-MTAB-5061	yes	18.51
E-ANND-3	yes	11.96
E-MTAB-9388	yes	10.85
E-ENAD-27	no	10.18

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

92 targeting SURF4, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-188-3P	100.00	68.76	1240
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-34A-5P	99.99	71.21	1784
HSA-MIR-449A	99.99	71.05	1776
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-6870-5P	99.99	68.55	2115
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-548P	99.98	72.25	3784
HSA-MIR-34C-5P	99.97	70.45	1577
HSA-MIR-449B-5P	99.97	70.26	1580
HSA-MIR-4723-5P	99.97	68.70	2034
HSA-MIR-5698	99.97	68.49	2029
HSA-MIR-7111-5P	99.97	68.48	2062
HSA-MIR-551B-5P	99.96	71.28	3493
HSA-MIR-3910	99.95	71.13	2227
HSA-MIR-185-3P	99.95	67.01	1743
HSA-MIR-6835-3P	99.93	70.49	2904
HSA-MIR-10527-5P	99.91	72.28	3754
HSA-MIR-4731-5P	99.89	67.23	2537
HSA-MIR-1323	99.83	69.89	2471
HSA-MIR-609	99.82	64.26	505
HSA-MIR-6764-5P	99.75	67.89	2304
HSA-MIR-548O-3P	99.74	69.30	2228
HSA-MIR-4719	99.73	72.10	3329
HSA-MIR-4524A-3P	99.72	66.85	2406

Literature-anchored findings (GeneRIF, showing 17)

• Silencing Surf4 together with ERGIC-53 or silencing the p24 family member p25 induced an identical phenotype characterized by a reduced number of ERGIC clusters and fragmentation of the Golgi apparatus without effect on anterograde transport. (PMID:18287528)
• SFT-4 and Surf4 regulate the export of soluble proteins, including lipoproteins, from the endoplasmic reticulum (ER) and participate in ER exit site organization in animals. (PMID:29643117)
• SURF4 demonstrated aberrant amplification and increased expression in the tumor tissues of several human cancer patients. (PMID:29777698)
• Surf4 (or its yeast ortholog, Erv29p) binds amino-terminal tripeptide motifs of soluble cargo proteins with different affinities, enabling prioritization of their exit from the endoplasmic reticulum. (PMID:30086131)
• These findings support a model in which SURF4 functions as an endoplasmic reticulum cargo receptor mediating the efficient cellular secretion of PCSK9. (PMID:30251625)
• These results indicate that the cellular protein Surf4 is involved in the replication of positive-strand RNA viruses that use DMVs as RNA replication sites, providing new insights into DMV formation during virus replication and potential targets for the diagnosis and treatment of positive-strand RNA viruses. (PMID:31645450)
• Study findings revealed that knockdown of Surf4 increased expression and secretion of PCSK9, indicating a negligible role of Surf4 in PCSK9 secretion in cultured human hepatocytes. (PMID:31676436)
• SURF4 maintains stem-like properties via BIRC3 in ovarian cancer cells. (PMID:32026660)
• The Endoplasmic Reticulum Cargo Receptor SURF4 Facilitates Efficient Erythropoietin Secretion. (PMID:32989016)
• Receptor-Mediated ER Export of Lipoproteins Controls Lipid Homeostasis in Mice and Humans. (PMID:33186557)
• Efficient progranulin exit from the ER requires its interaction with prosaposin, a Surf4 cargo. (PMID:34919127)
• SURF4-induced tubular ERGIC selectively expedites ER-to-Golgi transport. (PMID:35051356)
• A SURF4-to-proteoglycan relay mechanism that mediates the sorting and secretion of a tagged variant of sonic hedgehog. (PMID:35271396)
• Selective inhibition of protein secretion by abrogating receptor-coat interactions during ER export. (PMID:35901214)
• Export of polybasic motif-containing secretory proteins BMP8A and SFRP1 from the endoplasmic reticulum is regulated by surfeit locus protein 4. (PMID:36370847)
• High SURF4 expression is associated with poor prognosis of breast cancer. (PMID:36446386)
• Surf4, cargo trafficking, lipid metabolism, and therapeutic implications. (PMID:36574593)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	surf4l	ENSDARG00000035131
danio_rerio	surf4	ENSDARG00000104647
mus_musculus	Surf4	ENSMUSG00000014867
rattus_norvegicus	Surf1	ENSRNOG00000005247
drosophila_melanogaster	Surf4	FBGN0019925
caenorhabditis_elegans		WBGENE00004788

Paralogs (1): SURF1 (ENSG00000148290)

Protein

Protein identifiers

Surfeit locus protein 4 — O15260 (reviewed: O15260)

All UniProt accessions (3): O15260, B7Z1G8, Q5T8U5

UniProt curated annotations — full annotation on UniProt →

Function. Endoplasmic reticulum cargo receptor that mediates the export of lipoproteins by recruiting cargos into COPII vesicles to facilitate their secretion. Acts as a cargo receptor for lipoproteins bearing both APOB and APOA1, thereby regulating lipoprotein delivery and the maintenance of lipid homeostasis. Synergizes with the GTPase SAR1B to mediate transport of circulating lipoproteins. Promotes the secretion of PCSK9. Also mediates the efficient secretion of erythropoietin (EPO). May also play a role in the maintenance of the architecture of the endoplasmic reticulum-Golgi intermediate compartment and of the Golgi.

Subunit / interactions. Found in a complex composed at least of SURF4, TMED2 and TMED10. May interact with LMAN1. Interacts with ZFYVE27 and with KIF5A in a ZFYVE27-dependent manner. Interacts with STING1. Interacts with SAR1B. Interacts with TMEM41B.

Subcellular location. Endoplasmic reticulum membrane. Endoplasmic reticulum-Golgi intermediate compartment membrane. Golgi apparatus membrane.

Domain organisation. The di-lysine motif confers endoplasmic reticulum localization for type I membrane proteins.

Similarity. Belongs to the SURF4 family.

Isoforms (3)

UniProt ID	Names	Canonical?
O15260-1	1	yes
O15260-2	2
O15260-3	3

RefSeq proteins (7): NP_001267717, NP_001267718, NP_001267719, NP_001267720, NP_001267721, NP_001267722, NP_149351* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002995	Surf4	Family
IPR045214	Surf1/Surf4	Family

Pfam: PF02077

UniProt features (14 total): transmembrane region 5, splice variant 4, initiator methionine 1, chain 1, mutagenesis site 1, sequence conflict 1, short sequence motif 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O15260-F1	84.65	0.40

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Mutagenesis-validated functional residues (1):

Position	Phenotype
265–267	targeted to the golgi.

Function

Pathways and Gene Ontology

Reactome pathways

8 pathways

ID	Pathway
R-HSA-6798695	Neutrophil degranulation
R-HSA-6811434	COPI-dependent Golgi-to-ER retrograde traffic
R-HSA-168249	Innate Immune System
R-HSA-168256	Immune System
R-HSA-199991	Membrane Trafficking
R-HSA-5653656	Vesicle-mediated transport
R-HSA-6811442	Intra-Golgi and retrograde Golgi-to-ER traffic
R-HSA-8856688	Golgi-to-ER retrograde transport

MSigDB gene sets: 200 (showing top): REACTOME_INNATE_IMMUNE_SYSTEM, GOBP_INTRACELLULAR_PROTEIN_TRANSPORT, GOCC_VACUOLAR_MEMBRANE, GOCC_SECRETORY_GRANULE, GOBP_VESICLE_ORGANIZATION, GCANCTGNY_MYOD_Q6, GRAESSMANN_APOPTOSIS_BY_SERUM_DEPRIVATION_UP, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_UP, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_UP, GOBP_VESICLE_MEDIATED_TRANSPORT, REACTOME_MEMBRANE_TRAFFICKING, GOBP_POSITIVE_REGULATION_OF_ORGANELLE_ORGANIZATION, GOBP_LIPID_HOMEOSTASIS, WEI_MYCN_TARGETS_WITH_E_BOX, GOBP_ENDOPLASMIC_RETICULUM_TO_GOLGI_VESICLE_MEDIATED_TRANSPORT

GO Biological Process (9): endoplasmic reticulum to Golgi vesicle-mediated transport (GO:0006888), Golgi organization (GO:0007030), positive regulation of organelle organization (GO:0010638), regulation of lipid transport (GO:0032368), lipoprotein transport (GO:0042953), lipid homeostasis (GO:0055088), COPII-coated vesicle cargo loading (GO:0090110), lipid export from cell (GO:0140353), protein transport (GO:0015031)

GO Molecular Function (3): cargo receptor activity (GO:0038024), COPII receptor activity (GO:0097020), protein binding (GO:0005515)

GO Cellular Component (14): Golgi membrane (GO:0000139), endoplasmic reticulum (GO:0005783), endoplasmic reticulum membrane (GO:0005789), endoplasmic reticulum-Golgi intermediate compartment (GO:0005793), Golgi apparatus (GO:0005794), cytosol (GO:0005829), plasma membrane (GO:0005886), transport vesicle (GO:0030133), COPII-coated ER to Golgi transport vesicle (GO:0030134), nuclear membrane (GO:0031965), endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116), azurophil granule membrane (GO:0035577), endoplasmic reticulum exit site (GO:0070971), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-6 pathways:

Category	Pathways
Innate Immune System	1
Golgi-to-ER retrograde transport	1
Immune System	1
Vesicle-mediated transport	1
Membrane Trafficking	1
Intra-Golgi and retrograde Golgi-to-ER traffic	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cytoplasm	5
endomembrane system	3
intracellular membrane-bounded organelle	3
cellular anatomical structure	3
intracellular transport	2
organelle organization	2
lipid transport	2
bounding membrane of organelle	2
organelle membrane	2
intercellular transport	1
Golgi vesicle transport	1
endomembrane system organization	1
regulation of organelle organization	1
positive regulation of cellular component organization	1
regulation of transport	1
regulation of lipid localization	1
protein transport	1
lipoprotein localization	1
chemical homeostasis	1
vesicle cargo loading	1
COPII-coated vesicle budding	1
export from cell	1
transport	1
intracellular protein localization	1
establishment of protein localization	1
molecular_function	1
vesicle-mediated transport	1
molecular adaptor activity	1
cargo receptor activity	1
binding	1
Golgi apparatus	1
nuclear outer membrane-endoplasmic reticulum membrane network	1
endoplasmic reticulum subcompartment	1
membrane	1
cell periphery	1
cytoplasmic vesicle	1
coated vesicle	1
nucleus	1
nuclear envelope	1
endoplasmic reticulum-Golgi intermediate compartment	1

Protein interactions and networks

STRING

1664 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SURF4	SURF2	Q15527	982
SURF4	ERGIC1	Q969X5	934
SURF4	LMAN1	P49257	917
SURF4	SURF1	Q15526	887
SURF4	SEC24B	O95487	778
SURF4	SAR1A	Q9NR31	722
SURF4	SAR1B	Q9Y6B6	710
SURF4	KDELR1	P24390	683
SURF4	SURF6	O75683	649
SURF4	PREB	Q9HCU5	646
SURF4	STIM1	Q13586	632
SURF4	RPN1	P04843	620
SURF4	RER1	O15258	617
SURF4	MIA3	Q5JRA6	604
SURF4	COPA	P53621	597

IntAct

203 interactions, top by confidence:

A	B	Type	Score
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
CFTR	ESYT2	psi-mi:“MI:0914”(association)	0.710
SURF4	TMED10	psi-mi:“MI:0915”(physical association)	0.660
TMED10	SURF4	psi-mi:“MI:0914”(association)	0.660
TMED2	SURF4	psi-mi:“MI:0914”(association)	0.660
SURF4	TMED10	psi-mi:“MI:0914”(association)	0.660
CD27	TCAF2	psi-mi:“MI:0914”(association)	0.640
SURF4	STING1	psi-mi:“MI:0915”(physical association)	0.620
CFTR	HAX1	psi-mi:“MI:0914”(association)	0.610
CFTR	SURF4	psi-mi:“MI:0403”(colocalization)	0.550
SPPL2B	UQCRQ	psi-mi:“MI:0914”(association)	0.530
YIPF3	TMEM120B	psi-mi:“MI:0914”(association)	0.530
SLC22A9	GPR89A	psi-mi:“MI:0914”(association)	0.530
TMEM184A	SLC33A1	psi-mi:“MI:0914”(association)	0.530
TMEM63A	AP3D1	psi-mi:“MI:0914”(association)	0.530
FAM8A1	PLSCR1	psi-mi:“MI:0914”(association)	0.530
STOM	EI24	psi-mi:“MI:0914”(association)	0.510
	SCD	psi-mi:“MI:0914”(association)	0.500
Unc93b1	SURF4	psi-mi:“MI:0915”(physical association)	0.500
NRAS	ESYT2	psi-mi:“MI:2364”(proximity)	0.480
SURF4	LMAN1	psi-mi:“MI:0403”(colocalization)	0.460
SURF4	LMAN1	psi-mi:“MI:0915”(physical association)	0.460
env	PGRMC1	psi-mi:“MI:0914”(association)	0.460

BioGRID (281): SURF4 (Affinity Capture-RNA), SURF4 (Affinity Capture-RNA), SURF4 (Affinity Capture-MS), SURF4 (Affinity Capture-MS), SURF4 (Affinity Capture-MS), SURF4 (Affinity Capture-MS), ATP5O (Co-fractionation), SURF4 (Proximity Label-MS), SURF4 (Proximity Label-MS), SURF4 (Affinity Capture-MS), SURF4 (Affinity Capture-MS), SURF4 (Affinity Capture-MS), SURF4 (Affinity Capture-MS), SURF4 (Affinity Capture-MS), SURF4 (Affinity Capture-MS)

ESM2 similar proteins: A0JNC1, A2VE61, A6QL84, A7YY49, B2RZ37, O15260, O15431, O57590, O95674, P31064, Q00765, Q06400, Q0VCK9, Q0X0A5, Q3KNM2, Q3T126, Q3ZC24, Q5M7T4, Q5R705, Q5R7B1, Q5R9I4, Q5R9M4, Q5RBJ7, Q5RE33, Q5ZJ41, Q5ZKJ0, Q64310, Q6DD32, Q6GM44, Q6P360, Q6P3N5, Q7SZQ7, Q800K9, Q8BG21, Q8C407, Q8R1Z9, Q91ZQ0, Q940S0, Q96GC9, Q96KA5

Diamond homologs: A7YY49, O15260, O18405, O45731, O57590, O74559, P53337, Q18864, Q5R705, Q64310, Q7SZQ7, Q800K9

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 203 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
SLC-mediated transport of neurotransmitters	5	16.7×	2e-03
R-HSA-425366	7	10.4×	1e-03
SLC-mediated transmembrane transport	12	5.8×	6e-04

GO biological processes:

GO term	Partners	Fold	FDR
amino acid transport	6	11.3×	9e-03
transport across blood-brain barrier	8	8.6×	5e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

30 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	22
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1064 predictions. Top by Δscore:

Variant	Effect	Δscore
9:133363769:T:C	acceptor_gain	1.0000
9:133363769:T:TC	acceptor_gain	1.0000
9:133363775:C:CT	acceptor_gain	1.0000
9:133366026:CGT:C	acceptor_gain	1.0000
9:133366594:TGTA:T	donor_loss	1.0000
9:133366595:GTAC:G	donor_loss	1.0000
9:133366596:TA:T	donor_loss	1.0000
9:133366597:AC:A	donor_loss	1.0000
9:133366598:CCTGC:C	donor_loss	1.0000
9:133366672:CCAG:C	acceptor_gain	1.0000
9:133366673:CAG:C	acceptor_gain	1.0000
9:133366673:CAGC:C	acceptor_gain	1.0000
9:133366674:AGCTG:A	acceptor_loss	1.0000
9:133366675:GC:G	acceptor_loss	1.0000
9:133366676:C:CA	acceptor_loss	1.0000
9:133366676:C:CC	acceptor_gain	1.0000
9:133366677:T:A	acceptor_loss	1.0000
9:133367255:TCA:T	donor_loss	1.0000
9:133367257:A:AC	donor_gain	1.0000
9:133367257:ACT:A	donor_gain	1.0000
9:133367258:C:CA	donor_gain	1.0000
9:133367258:CT:C	donor_gain	1.0000
9:133367258:CTC:C	donor_gain	1.0000
9:133367258:CTCA:C	donor_gain	1.0000
9:133367258:CTCAG:C	donor_gain	1.0000
9:133367262:G:C	donor_gain	1.0000
9:133375916:CCGCA:C	donor_loss	1.0000
9:133375917:CGCAC:C	donor_loss	1.0000
9:133375918:GCAC:G	donor_loss	1.0000
9:133375919:CA:C	donor_loss	1.0000

AlphaMissense

1774 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
9:133363561:C:G	G248R	1.000
9:133363563:C:A	G247V	1.000
9:133363563:C:T	G247E	1.000
9:133363564:C:A	G247W	1.000
9:133363564:C:G	G247R	1.000
9:133363564:C:T	G247R	1.000
9:133363636:A:G	W223R	1.000
9:133363636:A:T	W223R	1.000
9:133363655:G:C	N216K	1.000
9:133363655:G:T	N216K	1.000
9:133363668:A:G	L212P	1.000
9:133363710:C:T	G198D	1.000
9:133363711:C:G	G198R	1.000
9:133365009:C:T	G125E	1.000
9:133365993:A:C	F116L	1.000
9:133365993:A:T	F116L	1.000
9:133365995:A:G	F116L	1.000
9:133367374:G:C	D40E	1.000
9:133367374:G:T	D40E	1.000
9:133367375:T:A	D40V	1.000
9:133367375:T:G	D40A	1.000
9:133367376:C:G	D40H	1.000
9:133367383:G:C	F37L	1.000
9:133367383:G:T	F37L	1.000
9:133367385:A:G	F37L	1.000
9:133367389:G:C	S35R	1.000
9:133367389:G:T	S35R	1.000
9:133367391:T:G	S35R	1.000
9:133367400:A:G	C32R	1.000
9:133363516:C:G	D263H	0.999

dbSNP variants (sampled 300 via entrez): RS1000027809 (9:133375527 G>A,C), RS1000082481 (9:133364755 CCAGGGAGGGGTGAG>C,CCAGGGAGGGGTGAGCAGGGAGGGGTGAG), RS1000094615 (9:133374372 G>C), RS1000492737 (9:133369743 A>G), RS1000672464 (9:133373130 G>A,T), RS1000766779 (9:133367636 T>C), RS1000790901 (9:133364485 G>A), RS1001127275 (9:133373362 GC>G), RS1001173417 (9:133364914 T>A,G), RS1001337394 (9:133375319 G>A), RS1001386458 (9:133370301 C>T), RS1001392284 (9:133364553 G>A), RS1001788613 (9:133375434 G>A), RS1001942951 (9:133378843 G>A), RS1002202840 (9:133375720 G>A)

Disease associations

OMIM: gene MIM:185660 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

4 associations (top):

Study	Trait	p-value
GCST001574_9	Activated partial thromboplastin time	9.000000e-100
GCST010725_19	Malaria	9.000000e-11
GCST010725_31	Malaria	9.000000e-21
GCST010725_98	Malaria	1.000000e-19

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL5725083 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

4 potent at pChembl≥5 of 4 total, top 4 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.82	Kd	15.1	nM	CHEMBL5653589
7.82	ED50	15.1	nM	CHEMBL5653589
7.77	Kd	17.04	nM	CHEMBL3752910
7.77	ED50	17.04	nM	CHEMBL3752910

PubChem BioAssay actives

2 with measured affinity, of 10 total; 2 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2149530: Binding affinity to human SURF4 incubated for 45 mins by Kinobead based pull down assay	kd	0.0151	uM
4-methyl-3-[(1-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2149530: Binding affinity to human SURF4 incubated for 45 mins by Kinobead based pull down assay	kd	0.0170	uM

CTD chemical–gene interactions

39 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, affects cotreatment, increases abundance, increases expression	3
bisphenol A	increases expression	2
Tunicamycin	increases expression	2
bisphenol F	affects cotreatment, increases expression	1
2,4,6-tribromophenol	decreases expression	1
sodium arsenate	increases expression	1
decabromobiphenyl ether	decreases expression	1
beta-lapachone	increases expression	1
tetrabromobisphenol A	decreases expression	1
manganese chloride	affects cotreatment, increases abundance, increases expression	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	affects binding, increases reaction	1
chloropicrin	decreases expression	1
bisphenol B	increases expression	1
2,2’,4,4’-tetrabromodiphenyl ether	decreases expression	1
pentabrominated diphenyl ether 100	decreases expression	1
hexabrominated diphenyl ether 153	decreases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	decreases expression	1
Arsenic	increases abundance, increases expression, affects cotreatment	1
Benzene	increases expression	1
Cadmium	increases abundance, increases expression	1
Cytarabine	decreases expression	1
Dexamethasone	increases expression, affects cotreatment	1
Doxorubicin	decreases expression	1
Estradiol	decreases expression	1
Folic Acid	decreases expression	1
Indomethacin	increases expression, affects cotreatment	1
Ivermectin	decreases expression	1
Manganese	affects cotreatment, increases abundance, increases expression	1
Smoke	decreases expression	1

ChEMBL screening assays

7 unique, capped per target: 7 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5652572	Binding	Binding affinity to human SURF4 incubated for 45 mins by Kinobead based pull down assay	NVP-BHG712: Effects of Regioisomers on the Affinity and Selectivity toward the EPHrin Family. — ChemMedChem

Cellosaurus cell lines

3 cell lines: 2 cancer cell line, 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B3IR	Abcam HEK293T SURF4 KO	Transformed cell line	Female
CVCL_TR26	HAP1 SURF4 (-) 1	Cancer cell line	Male
CVCL_TR27	HAP1 SURF4 (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.