SYN2

Summary

SYN2 (synapsin II, HGNC:11495) is a protein-coding gene on chromosome 3p25.2, encoding Synapsin-2 (Q92777). Neuronal phosphoprotein that coats synaptic vesicles, binds to the cytoskeleton, and is believed to function in the regulation of neurotransmitter release.

This gene is a member of the synapsin gene family. Synapsins encode neuronal phosphoproteins which associate with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains, and they are implicated in synaptogenesis and the modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. This member of the synapsin family encodes a neuron-specific phosphoprotein that selectively binds to small synaptic vesicles in the presynaptic nerve terminal. Polymorphisms in this gene are associated with abnormal presynaptic function and related neuronal disorders, including autism, epilepsy, bipolar disorder and schizophrenia. Alternative splicing of this gene results in multiple transcript variants. The tissue inhibitor of metalloproteinase 4 gene is located within an intron of this gene and is transcribed in the opposite direction.

Source: NCBI Gene 6854 — RefSeq curated summary.

At a glance

• GWAS associations: 52
• Clinical variants (ClinVar): 135 total
• Phenotypes (HPO): 7
• MANE Select transcript: NM_133625

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:11495
Approved symbol	SYN2
Name	synapsin II
Location	3p25.2
Locus type	gene with protein product
Status	Approved
Aliases	SYNII, SYNIIa, SYNIIb
Ensembl gene	ENSG00000157152
Ensembl biotype	protein_coding
OMIM	600755
Entrez	6854

Gene structure

Transcript identifiers

Ensembl transcripts: 6 — 2 protein_coding_CDS_not_defined, 2 protein_coding, 1 nonsense_mediated_decay, 1 retained_intron

ENST00000424884, ENST00000425297, ENST00000439861, ENST00000447752, ENST00000620175, ENST00000621198

RefSeq mRNA: 2 — MANE Select: NM_133625 NM_003178, NM_133625

CCDS: CCDS74900, CCDS74901

Canonical transcript exons

ENST00000621198 — 13 exons

Exon	Start	End
ENSE00003711677	12187369	12187612
ENSE00003714844	12183312	12183372
ENSE00003717680	12169757	12169906
ENSE00003725435	12004388	12004928
ENSE00003727487	12167234	12167308
ENSE00003728459	12140651	12140708
ENSE00003728622	12168376	12168478
ENSE00003732371	12162012	12162154
ENSE00003737125	12151237	12151326
ENSE00003746079	12161546	12161608
ENSE00003746601	12190490	12192032
ENSE00003751015	12145679	12145835
ENSE00003752243	12141905	12141996

Expression profiles

Bgee: expression breadth ubiquitous, 217 present calls, max score 99.76.

FANTOM5 (CAGE): breadth broad, TPM avg 8.4055 / max 431.6646, expressed in 449 samples.

FANTOM5 promoters (14 alternative TSS)

Promoter ID	TPM avg	Samples expressed
35344	4.5212	298
35343	2.5625	285
35352	0.4098	76
35342	0.2994	89
35355	0.2381	70
35354	0.1754	34
35347	0.0401	3
35359	0.0392	18
35351	0.0245	11
35360	0.0241	18

Top tissues by expression

292 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
middle temporal gyrus	UBERON:0002771	99.76	gold quality
endothelial cell	CL:0000115	99.31	gold quality
Brodmann (1909) area 23	UBERON:0013554	98.50	gold quality
superior frontal gyrus	UBERON:0002661	98.21	gold quality
entorhinal cortex	UBERON:0002728	97.85	gold quality
parietal lobe	UBERON:0001872	97.67	gold quality
postcentral gyrus	UBERON:0002581	97.67	gold quality
pons	UBERON:0000988	97.36	gold quality
right frontal lobe	UBERON:0002810	97.02	gold quality
prefrontal cortex	UBERON:0000451	96.82	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	96.75	gold quality
Brodmann (1909) area 9	UBERON:0013540	96.58	gold quality
temporal lobe	UBERON:0001871	96.56	gold quality
cerebellar hemisphere	UBERON:0002245	96.31	gold quality
cerebellar cortex	UBERON:0002129	96.28	gold quality
right hemisphere of cerebellum	UBERON:0014890	96.18	gold quality
frontal cortex	UBERON:0001870	96.08	gold quality
amygdala	UBERON:0001876	95.93	gold quality
nucleus accumbens	UBERON:0001882	95.59	gold quality
primary visual cortex	UBERON:0002436	95.55	gold quality
neocortex	UBERON:0001950	95.49	gold quality
cerebellum	UBERON:0002037	95.47	gold quality
cerebral cortex	UBERON:0000956	95.42	gold quality
occipital lobe	UBERON:0002021	94.85	gold quality
cingulate cortex	UBERON:0003027	94.81	gold quality
anterior cingulate cortex	UBERON:0009835	94.67	gold quality
adult organism	UBERON:0007023	94.48	gold quality
telencephalon	UBERON:0001893	94.33	gold quality
Ammon’s horn	UBERON:0001954	93.89	gold quality
superior vestibular nucleus	UBERON:0007227	92.49	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-HCAD-25	yes	40.06
E-ANND-3	yes	7.04

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): EGR1, ETV4, TFAP2A

miRNA regulators (miRDB)

55 targeting SYN2, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-450A-1-3P	100.00	69.33	1837
HSA-MIR-4455	100.00	65.48	1587
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-4476	100.00	68.18	2030
HSA-MIR-6876-5P	100.00	67.68	2126
HSA-MIR-4725-3P	99.96	69.53	2520
HSA-MIR-6780B-5P	99.96	69.60	2562
HSA-MIR-2110	99.96	66.68	1930
HSA-MIR-4271	99.88	68.32	2244
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-765	99.84	68.24	2442
HSA-MIR-4668-5P	99.79	70.58	3782
HSA-MIR-8076	99.78	68.52	1170
HSA-MIR-4319	99.76	69.83	2586
HSA-MIR-11181-3P	99.75	66.38	2205
HSA-MIR-3175	99.65	66.30	2031
HSA-MIR-7156-5P	99.64	68.81	1369
HSA-MIR-142-3P	99.62	71.30	974
HSA-MIR-488-3P	99.61	68.79	1731
HSA-MIR-1290	99.59	69.90	2079
HSA-MIR-4753-5P	99.54	68.51	1356
HSA-MIR-543	99.52	69.03	2595
HSA-MIR-4441	99.49	66.56	3216
HSA-MIR-4498	99.47	67.42	2360
HSA-MIR-4273	99.45	67.93	1206
HSA-MIR-4279	99.19	66.70	2437
HSA-MIR-10524-5P	99.05	66.08	963
HSA-MIR-4270	99.02	66.26	1987

Literature-anchored findings (GeneRIF, showing 11)

• This study suggests a positive association between synapsin II and schizophrenia, implying that synapsin II is involved in the etiology of schizophrenia. (PMID:15271586)
• synapsin II variants are associated with susceptibility to schizophrenia. (PMID:15449241)
• Syn2 is likely to be involved in the etiology or pathogenesis of schizophrenia. (PMID:17766091)
• A case-control study with synapsin II was conducted in 506 bipolar disorder patients and 507 healthy individuals from the Han Chinese population. No association was found in this study. (PMID:19665806)
• Results from our study indicate the involvement of SYN2 gene polymorphism in conferring risk to epilepsy; however, the genetic variant does not seem to modulate drug-response in epilepsy pharmacotherapy. (PMID:20034013)
• SYN2 rs3773364 A>G polymorphism is not a risk factor for susceptibility to epilepsy in this case-control study and meta-analysis. (PMID:21465568)
• Synapsin II is involved in the molecular pathway of lithium treatment in bipolar disorder (PMID:22384280)
• Results identify SYN2 as a novel predisposing gene for autism spectrum disorders (ASD) and strengthen the hypothesis that a disturbance of synaptic homeostasis underlies ASD. (PMID:23956174)
• Both GABRA6 and Synapsin II polymorphisms are important risk factors for the development of idiopathic generalized epilepsy in a South Indian population. (PMID:25088614)
• These findings contribute to previous work showing dysregulation of Synapsins, particularly SYN2, in mood disorders and improve our understanding of the regulatory mechanisms that precipitate these changes likely leading to the BD or MDD phenotype. (PMID:27515700)
• Our findings support that ASB16-AS1 and SYN2 may represent two novel functional genes underlying bone mineral density variation (PMID:29763751)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	syn2a	ENSDARG00000045945
mus_musculus	Syn2	ENSMUSG00000009394
rattus_norvegicus	Syn2	ENSRNOG00000008157

Paralogs (2): SYN1 (ENSG00000008056), SYN3 (ENSG00000185666)

Protein

Protein identifiers

Synapsin-2 — Q92777 (reviewed: Q92777)

Alternative names: Synapsin II

All UniProt accessions (2): Q92777, A0A087WW91

UniProt curated annotations — full annotation on UniProt →

Function. Neuronal phosphoprotein that coats synaptic vesicles, binds to the cytoskeleton, and is believed to function in the regulation of neurotransmitter release. May play a role in noradrenaline secretion by sympathetic neurons.

Subunit / interactions. Can form oligomers with SYN1. Interacts with CAPON.

Subcellular location. Synapse.

Tissue specificity. Central and peripheral nervous systems.

Post-translational modifications. Phosphorylation at Ser-10 dissociates synapsins from synaptic vesicles. Phosphorylation at Ser-425 by MAPK1/ERK2 and/or MAPK3/ERK1 may play a role in noradrenaline secretion by sympathetic neurons.

Disease relevance. Schizophrenia (SCZD) [MIM:181500] A complex, multifactorial psychotic disorder or group of disorders characterized by disturbances in the form and content of thought (e.g. delusions, hallucinations), in mood (e.g. inappropriate affect), in sense of self and relationship to the external world (e.g. loss of ego boundaries, withdrawal), and in behavior (e.g bizarre or apparently purposeless behavior). Although it affects emotions, it is distinguished from mood disorders in which such disturbances are primary. Similarly, there may be mild impairment of cognitive function, and it is distinguished from the dementias in which disturbed cognitive function is considered primary. Some patients manifest schizophrenic as well as bipolar disorder symptoms and are often given the diagnosis of schizoaffective disorder. Disease susceptibility may be associated with variants affecting the gene represented in this entry.

Domain organisation. The A region binds phospholipids with a preference for negatively charged species.

Similarity. Belongs to the synapsin family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q92777-1	IIa	yes
Q92777-2	IIb

RefSeq proteins (2): NP_003169, NP_598328* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001359	Synapsin	Family
IPR013815	ATP_grasp_subdomain_1	Homologous_superfamily
IPR016185	PreATP-grasp_dom_sf	Homologous_superfamily
IPR019735	Synapsin_CS	Conserved_site
IPR019736	Synapsin_P_site	PTM
IPR020897	Synapsin_pre-ATP-grasp_dom	Domain
IPR020898	Synapsin_ATP-bd_dom	Domain

Pfam: PF02078, PF02750, PF10581

UniProt features (25 total): region of interest 8, compositionally biased region 8, modified residue 3, splice variant 2, sequence conflict 2, chain 1, sequence variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q92777-F1	75.24	0.53

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (3): 10, 421, 425

Function

Pathways and Gene Ontology

Reactome pathways

5 pathways

ID	Pathway
R-HSA-181429	Serotonin Neurotransmitter Release Cycle
R-HSA-212676	Dopamine Neurotransmitter Release Cycle
R-HSA-112310	Neurotransmitter release cycle
R-HSA-112315	Transmission across Chemical Synapses
R-HSA-112316	Neuronal System

MSigDB gene sets: 179 (showing top): GOBP_SYNAPTIC_VESICLE_LOCALIZATION, MODULE_274, GOBP_VESICLE_LOCALIZATION, TGCACTT_MIR519C_MIR519B_MIR519A, AAGTCCA_MIR422B_MIR422A, GOBP_NEUROTRANSMITTER_TRANSPORT, GOBP_VESICLE_MEDIATED_TRANSPORT, GOBP_CELL_CELL_SIGNALING, MODULE_381, GOBP_EXOCYTOSIS, GOBP_CELL_JUNCTION_ORGANIZATION, REACTOME_DOPAMINE_NEUROTRANSMITTER_RELEASE_CYCLE, GOBP_SECRETION, GOBP_SIGNAL_RELEASE, GOBP_CALCIUM_ION_REGULATED_EXOCYTOSIS

GO Biological Process (6): chemical synaptic transmission (GO:0007268), neurotransmitter secretion (GO:0007269), calcium-ion regulated exocytosis (GO:0017156), synapse organization (GO:0050808), synaptic vesicle clustering (GO:0097091), synaptic vesicle cycle (GO:0099504)

GO Molecular Function (3): ATP binding (GO:0005524), identical protein binding (GO:0042802), protein binding (GO:0005515)

GO Cellular Component (8): plasma membrane (GO:0005886), postsynaptic density (GO:0014069), synaptic vesicle membrane (GO:0030672), SNARE complex (GO:0031201), synapse (GO:0045202), Schaffer collateral - CA1 synapse (GO:0098685), glutamatergic synapse (GO:0098978), synaptic vesicle (GO:0008021)

Reactome top-level categories

Rollup of top-3 pathways:

Category	Pathways
Neurotransmitter release cycle	2
Transmission across Chemical Synapses	1
Neuronal System	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
presynapse	3
establishment of localization in cell	2
synapse	2
anterograde trans-synaptic signaling	1
neurotransmitter transport	1
chemical synaptic transmission	1
signal release from synapse	1
regulated exocytosis	1
cell junction organization	1
synaptic vesicle localization	1
synaptic vesicle cycle	1
vesicle-mediated transport in synapse	1
adenyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
protein binding	1
binding	1
membrane	1
cell periphery	1
asymmetric synapse	1
postsynaptic specialization	1
synaptic vesicle	1
exocytic vesicle membrane	1
cytoplasm	1
membrane protein complex	1
cell junction	1
exocytic vesicle	1

Protein interactions and networks

STRING

2384 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SYN2	DLG4	P78352	852
SYN2	RIC8B	Q9NVN3	818
SYN2	SLC17A7	Q9P2U7	816
SYN2	MARCKS	P29966	809
SYN2	SNAP25	P13795	804
SYN2	SYP	P08247	762
SYN2	NOS1AP	O75052	759
SYN2	SLC32A1	Q9H598	750
SYN2	GRIA1	P42261	728
SYN2	SYT1	P21579	727
SYN2	STXBP5	Q5T5C0	727
SYN2	CALML4	Q96GE6	713
SYN2	GAP43	P17677	705
SYN2	TIMP4	Q99727	699
SYN2	NSF	P46459	677

IntAct

21 interactions, top by confidence:

A	B	Type	Score
PDCD6IP	CEP55	psi-mi:“MI:0914”(association)	0.960
SYN3	SYN2	psi-mi:“MI:0915”(physical association)	0.560
SYN2	CHRM4	psi-mi:“MI:0915”(physical association)	0.370
PRNP	WDR91	psi-mi:“MI:0914”(association)	0.350
IQCB1	PCP4L1	psi-mi:“MI:0914”(association)	0.350
MAPT	SHTN1	psi-mi:“MI:0914”(association)	0.350
SYNGAP1	POTEF	psi-mi:“MI:0914”(association)	0.350
SYNGAP1	POM121C	psi-mi:“MI:0914”(association)	0.350
CAPZB	ENAH	psi-mi:“MI:0914”(association)	0.350
YWHAB	BRAF	psi-mi:“MI:0914”(association)	0.350
YWHAG	BRAF	psi-mi:“MI:0914”(association)	0.350
GPM6A	KIF2A	psi-mi:“MI:0914”(association)	0.350
POLL	SULT1C2	psi-mi:“MI:0914”(association)	0.350
HAX1	DNM1L	psi-mi:“MI:0914”(association)	0.350
DNAAF2	DNM1L	psi-mi:“MI:0914”(association)	0.350
DGUOK	BIN1	psi-mi:“MI:0914”(association)	0.350
DUSP2	SYN3	psi-mi:“MI:0914”(association)	0.350
ARMC1	DCX	psi-mi:“MI:0914”(association)	0.350
KLHL22	TRAV18	psi-mi:“MI:0914”(association)	0.350
SYN3	GART	psi-mi:“MI:0914”(association)	0.350

BioGRID (43): SYN2 (Affinity Capture-Western), SYN2 (Affinity Capture-MS), SYN2 (Affinity Capture-MS), SYN2 (Affinity Capture-MS), SYN2 (Affinity Capture-MS), SYN2 (Affinity Capture-MS), SYN2 (Two-hybrid), SYN2 (Affinity Capture-MS), SYN2 (Affinity Capture-MS), SYN2 (Affinity Capture-MS), SYN2 (Affinity Capture-MS), SYN2 (Affinity Capture-MS), SYN2 (Two-hybrid), SYN2 (Affinity Capture-MS), SYN2 (Negative Genetic)

ESM2 similar proteins: A0A125YYR0, A0A7J6JXB6, A0A7J6K2G0, A0A7J6K9S4, A2WYE9, A5PF44, A8JAM0, B9EHT4, D0Z5N4, F1M4A4, O14065, O46072, O54825, P0C5E7, P34305, P53904, Q02331, Q09459, Q09475, Q0JGK4, Q13895, Q17388, Q3V0G7, Q4R8C7, Q57WH1, Q5R686, Q5RAV3, Q5VVW2, Q63537, Q64332, Q6C7G0, Q6DTM3, Q6PAW0, Q6PB19, Q6PBN2, Q6QM28, Q6XL73, Q7XZU0, Q80WL2, Q8C4Q6

Diamond homologs: O14994, O62732, O70441, O88935, P09951, P17599, P17600, Q24546, Q63537, Q64332, Q6QM28, Q8JZP2, Q92777

SIGNOR signaling

5 interactions.

A	Effect	B	Mechanism
SYN2	down-regulates	Synaptic_vesicle_exocytosis
PKA	“down-regulates activity”	SYN2	phosphorylation
SYN2	“up-regulates activity”	ACTB	binding
SYN2	“up-regulates activity”	Actin_cytoskeleton_reorganization	binding
PRKACA	“down-regulates activity”	SYN2	phosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 33 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Membrane Trafficking	5	7.4×	8e-03
Vesicle-mediated transport	5	7.0×	8e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

135 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	109
Likely benign	6
Benign	8

Top pathogenic / likely-pathogenic (0)

SpliceAI

3203 predictions. Top by Δscore:

Variant	Effect	Δscore
3:12107296:A:T	donor_gain	1.0000
3:12140789:C:G	donor_gain	1.0000
3:12141903:A:AG	acceptor_gain	1.0000
3:12141904:G:GG	acceptor_gain	1.0000
3:12141904:G:GT	acceptor_loss	1.0000
3:12141904:GGC:G	acceptor_gain	1.0000
3:12141904:GGCA:G	acceptor_gain	1.0000
3:12141994:CCG:C	donor_loss	1.0000
3:12141995:CGG:C	donor_loss	1.0000
3:12141996:GGT:G	donor_loss	1.0000
3:12141997:G:GG	donor_gain	1.0000
3:12141998:T:A	donor_loss	1.0000
3:12145831:GGGTG:G	donor_gain	1.0000
3:12145832:GGTGG:G	donor_gain	1.0000
3:12145833:GTG:G	donor_gain	1.0000
3:12151232:TGCA:T	acceptor_gain	1.0000
3:12151233:GCAG:G	acceptor_gain	1.0000
3:12151233:GCAGT:G	acceptor_loss	1.0000
3:12151234:CAGTT:C	acceptor_loss	1.0000
3:12151235:A:AG	acceptor_gain	1.0000
3:12151235:AG:A	acceptor_loss	1.0000
3:12151235:AGTTT:A	acceptor_gain	1.0000
3:12151236:G:GA	acceptor_gain	1.0000
3:12151236:GT:G	acceptor_gain	1.0000
3:12151236:GTT:G	acceptor_gain	1.0000
3:12151236:GTTT:G	acceptor_gain	1.0000
3:12151236:GTTTG:G	acceptor_gain	1.0000
3:12151323:GATG:G	donor_gain	1.0000
3:12151324:ATGGT:A	donor_loss	1.0000
3:12151325:TG:T	donor_gain	1.0000

AlphaMissense

3777 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
3:12004570:C:A	R7S	1.000
3:12162051:A:C	S293R	1.000
3:12162053:C:A	S293R	1.000
3:12162053:C:G	S293R	1.000
3:12167256:T:A	W335R	1.000
3:12167256:T:C	W335R	1.000
3:12167258:G:C	W335C	1.000
3:12167258:G:T	W335C	1.000
3:12167259:A:G	K336E	1.000
3:12167261:G:C	K336N	1.000
3:12167261:G:T	K336N	1.000
3:12168386:T:A	W356R	1.000
3:12168386:T:C	W356R	1.000
3:12168435:T:A	V372D	1.000
3:12190602:T:C	F576L	1.000
3:12190604:T:A	F576L	1.000
3:12190604:T:G	F576L	1.000
3:12004561:T:C	F4L	0.999
3:12004563:C:A	F4L	0.999
3:12004563:C:G	F4L	0.999
3:12004570:C:T	R7C	0.999
3:12004571:G:C	R7P	0.999
3:12004582:G:C	D11H	0.999
3:12004583:A:T	D11V	0.999
3:12004591:T:C	F14L	0.999
3:12004593:C:A	F14L	0.999
3:12004593:C:G	F14L	0.999
3:12004604:T:C	L18P	0.999
3:12004898:T:C	L116P	0.999
3:12004901:T:C	L117P	0.999

dbSNP variants (sampled 300 via entrez): RS1000026690 (3:12127914 T>G), RS1000058253 (3:12124975 T>C), RS1000067342 (3:12082177 C>G), RS1000081820 (3:12038063 C>A,T), RS1000114457 (3:12080719 C>G), RS1000129887 (3:12124687 G>A), RS1000134365 (3:12010239 T>C), RS1000135400 (3:12091403 C>G,T), RS1000136671 (3:12134633 T>C), RS1000139332 (3:12149052 GGAGGGTGGGGTGAGCTCCCT>G), RS1000188116 (3:12150791 C>G), RS1000202749 (3:12141572 A>G), RS1000225072 (3:12144395 G>A), RS1000243335 (3:12050358 T>G), RS1000270758 (3:12106750 G>A,T)

Disease associations

OMIM: gene MIM:600755 | disease phenotypes: MIM:181500

GenCC curated gene-disease

Mondo (1): schizophrenia (MONDO:0005090)

Orphanet (1): NON RARE IN EUROPE: Schizophrenia (Orphanet:3140)

HPO phenotypes

7 total (7 of 7 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000738	Hallucinations
HP:0000746	Delusion
HP:0002353	EEG abnormality
HP:0007086	Social and occupational deterioration
HP:0100753	Schizophrenia
HP:0410291	Negativism

GWAS associations

52 associations (top):

Study	Trait	p-value
GCST000167_10	Type 2 diabetes	2.000000e-07
GCST001337_9	Platelet count	5.000000e-08
GCST001526_14	Fasting blood insulin (BMI interaction)	2.000000e-07
GCST004009_4	Leprosy	2.000000e-08
GCST005956_72	Waist-to-hip ratio adjusted for BMI	1.000000e-07
GCST005957_11	Waist-to-hip ratio adjusted for BMI (age <50)	9.000000e-06
GCST005958_19	Waist-to-hip ratio adjusted for BMI (age >50)	2.000000e-06
GCST005962_29	Waist-to-hip ratio adjusted for BMI x sex x age interaction (4df test)	9.000000e-09
GCST005984_7	Glomerular filtration rate	1.000000e-09
GCST005985_64	Creatinine levels	7.000000e-10
GCST005991_3	Platelet count	1.000000e-09
GCST006613_93	Triglycerides	7.000000e-11
GCST006979_99	Heel bone mineral density	4.000000e-09
GCST007692_43	Chronic obstructive pulmonary disease	3.000000e-06
GCST007954_7	Glycated hemoglobin levels	5.000000e-10
GCST008058_150	Estimated glomerular filtration rate	2.000000e-14
GCST008077_25	LDL cholesterol levels	2.000000e-06
GCST008077_63	LDL cholesterol levels	5.000000e-10
GCST008078_105	LDL cholesterol levels x alcohol consumption (regular vs non-regular drinkers) interaction (2df)	1.000000e-13
GCST008078_33	LDL cholesterol levels x alcohol consumption (regular vs non-regular drinkers) interaction (2df)	4.000000e-09
GCST008079_158	LDL cholesterol levels x alcohol consumption (drinkers vs non-drinkers) interaction (2df)	7.000000e-14
GCST008079_61	LDL cholesterol levels x alcohol consumption (drinkers vs non-drinkers) interaction (2df)	8.000000e-10
GCST008086_69	LDL cholesterol levels in current drinkers	2.000000e-09
GCST008163_54	Height	5.000000e-06
GCST008165_3	Thyroid stimulating hormone levels	6.000000e-09
GCST010272_4	Circulating leptin levels or type 2 diabetes	2.000000e-08
GCST010653_65	Thyroid stimulating hormone levels	1.000000e-25
GCST011155_4	Nontraumatic osteonecrosis of the femoral head	3.000000e-08
GCST90002381_136	Eosinophil count	3.000000e-15
GCST90020024_1124	A body shape index	5.000000e-10

EFO canonical traits (15, from GWAS)

EFO ID	Trait name
EFO:0004309	platelet count
EFO:0004340	body mass index
EFO:0007788	BMI-adjusted waist-hip ratio
EFO:0008007	age at assessment
EFO:0008343	sex interaction measurement
EFO:0004530	triglyceride measurement
EFO:0009270	heel bone mineral density
EFO:0004541	HbA1c measurement
EFO:0004611	low density lipoprotein cholesterol measurement
EFO:0004329	alcohol drinking
EFO:0005000	leptin measurement
EFO:1001930	idiopathic osteonecrosis of the femoral head
EFO:0004842	eosinophil count
EFO:0007789	BMI-adjusted waist circumference
EFO:0008039	BMI-adjusted hip circumference

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

27 total (human), top 27 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	increases expression	4
Benzo(a)pyrene	affects methylation, increases methylation	2
Nickel	decreases expression	2
Phenylmercuric Acetate	decreases expression, affects cotreatment	2
propionaldehyde	increases expression	1
bisphenol A	decreases methylation	1
O,O-diethyl O-3,5,6-trichloro-2-pyridyl phosphate	affects expression, affects response to substance	1
butyraldehyde	increases expression	1
benzo(e)pyrene	increases methylation	1
pentanal	increases expression	1
CGP 52608	increases reaction, affects binding	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
abrine	decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
(+)-JQ1 compound	decreases expression	1
Sunitinib	increases expression	1
Aldehydes	increases expression	1
Cisplatin	increases expression	1
Colforsin	decreases reaction, increases expression	1
Ivermectin	decreases expression	1
Methapyrilene	increases methylation	1
Smoke	decreases expression	1
Isotretinoin	decreases expression	1
Aflatoxin B1	decreases methylation	1
Cadmium Chloride	decreases reaction, increases expression, decreases expression	1
Okadaic Acid	increases expression	1
Permethrin	increases expression	1

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00000374	PHASE4	COMPLETED	Treatment for First-Episode Schizophrenia
NCT00001656	PHASE4	COMPLETED	Comparison of Clozapine vs Olanzapine in Childhood-Onset Psychotic Disorders
NCT00007774	PHASE4	COMPLETED	To Determine if Olanzapine is More Cost Effective Than Haloperidol for the Treatment of Schizophrenia
NCT00014001	PHASE4	COMPLETED	CATIE- Schizophrenia Trial
NCT00018668	PHASE4	COMPLETED	Antipsychotic Response in Schizophrenia
NCT00034801	PHASE4	COMPLETED	Olanzapine Versus Active Comparator in the Treatment of Depression in Patients With Schizophrenia
NCT00034905	PHASE4	COMPLETED	A Comparison of Seroquel vs. Risperidone in Schizophrenia
NCT00036088	PHASE4	COMPLETED	Olanzapine Versus An Active Comparator in the Treatment of Schizophrenia
NCT00044187	PHASE4	COMPLETED	The Assessment of a Weight-Gain Agent for the Treatment of Olanzapine-Associated Anti-Obesity Agent in Patients With Schizophrenia, Schizophreniform Disorder, Schizoaffective Disorder, and Bipolar I Disorder
NCT00044655	PHASE4	COMPLETED	Switching Medication to Treat Schizophrenia
NCT00048828	PHASE4	COMPLETED	Treating Drug-Resistant Childhood Schizophrenia
NCT00053703	PHASE4	COMPLETED	Treatment of Early Onset Schizophrenia Spectrum Disorders (TEOSS)
NCT00056498	PHASE4	COMPLETED	Risperidone Treatment in Schizophrenia Patients Who Are Currently Taking Clozapine
NCT00061802	PHASE4	COMPLETED	Efficacy and Safety of Two Atypical Antipsychotics vs. Placebo in Patients With an Acute Exacerbation of Either Schizophrenia or Schizoaffective Disorder
NCT00080327	PHASE4	COMPLETED	Study of Three Doses of Aripiprazole in Patients With Acute Schizophrenia
NCT00088049	PHASE4	COMPLETED	Study of Olanzapine vs. Aripiprazole in the Treatment of Schizophrenia
NCT00090012	PHASE4	COMPLETED	Comparison of Continuing Olanzapine to Switching to Quetiapine in Overweight or Obese Patients With Schizophrenia and Schizoaffective Disorder
NCT00100776	PHASE4	COMPLETED	Efficacy of High Dose Olanzapine for the Treatment of Schizophrenia and Schizoaffective Disorder
NCT00103571	PHASE4	COMPLETED	Olanzapine Versus Aripiprazole in the Treatment of Acutely Ill Patients With Schizophrenia
NCT00108368	PHASE4	COMPLETED	The Effects of Risperidone and Olanzapine on Thinking
NCT00114595	PHASE4	COMPLETED	Ethyl-Eicosapentaenoic Acid and Tardive Dyskinesia
NCT00130923	PHASE4	COMPLETED	Risperidone Long-acting Versus Oral Risperidone in Patients With Schizophrenia and Alcohol Use Disorder
NCT00137020	PHASE4	COMPLETED	Clinical Effect Of Cross Titration Of Antipsychotics With Ziprasidone In Schizophrenia Or Schizoaffective Disorder
NCT00140166	PHASE4	COMPLETED	Treatment of Acute Schizophrenia With Vitamin Therapy
NCT00145847	PHASE4	COMPLETED	Naltrexone Treatment of Alcohol Abuse in Schizophrenia
NCT00148564	PHASE4	COMPLETED	Energy Homeostasis Under Treatment With Atypical Antipsychotics
NCT00156715	PHASE4	COMPLETED	Efficacy of Quetiapine in the Treatment of Patients With Schizophrenia and a Comorbid Substance Use Disorder
NCT00158223	PHASE4	COMPLETED	Effectiveness of Pimozide in Augmenting the Effects of Clozapine in the Treatment of Schizophrenia
NCT00159081	PHASE4	COMPLETED	One Year Drug Treatment in First-Episode Schizophrenia
NCT00159120	PHASE4	COMPLETED	Maintenance Treatment vs. Stepwise Drug Discontinuation in First-Episode Schizophrenia
NCT00159133	PHASE4	COMPLETED	Prodrome-Based Early Intervention With Antipsychotics vs. Benzodiazepines in First-Episode Schizophrenia
NCT00159757	PHASE4	TERMINATED	12 Week Open, Non-Comparative Switch Study Of Oral Ziprazidone In Previously Treated Schizophrenic Patients
NCT00167817	PHASE4	COMPLETED	Effect of Switch to Aripiprazole on Health and Smoking Parameters in Patients With Schizophrenia: A Pilot Study
NCT00169026	PHASE4	TERMINATED	Alcoholism and Schizophrenia: Effects of Clozapine
NCT00169039	PHASE4	TERMINATED	Clozapine Versus Chlorpromazine for Treatment-Unresponsive Schizophrenia
NCT00169065	PHASE4	COMPLETED	Effectiveness of Clozapine Versus Olanzapine for Treatment-resistant Schizophrenia
NCT00169091	PHASE4	TERMINATED	Clozapine Versus Haloperidol for Treating the First Episode of Schizophrenia
NCT00176423	PHASE4	COMPLETED	Efficacy Study of Galantamine for Cognitive Impairments in Schizophrenia
NCT00176436	PHASE4	COMPLETED	Atomoxetine for Treatment of Weight Gain in Olanzapine or Clozapine Patients
NCT00177008	PHASE4	COMPLETED	Aripiprazole for the Treatment of Schizophrenia With Co-Morbid Social Anxiety