SYT15
gene geneOn this page
Also known as CHR10SYT
Summary
SYT15 (synaptotagmin 15, HGNC:17167) is a protein-coding gene on chromosome 10q11.22, encoding Synaptotagmin-15 (Q9BQS2). May be involved in the trafficking and exocytosis of secretory vesicles in non-neuronal tissues. It is a selective cancer dependency (DepMap: 40.0% of cell lines).
This gene encodes a member of the Synaptotagmin (Syt) family of membrane trafficking proteins. Members of this family contain a transmembrane region and a C-terminal-type tandem C2 domain. Unlike related family members, the encoded protein may be involved in membrane trafficking in non-neuronal tissues. Two trancript variants encoding distinct isoforms have been identified for this gene.
Source: NCBI Gene 83849 — RefSeq curated summary.
At a glance
- Clinical variants (ClinVar): 81 total
- Cancer dependency (DepMap): dependent in 40.0% of screened cell lines
- MANE Select transcript:
NM_031912
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:17167 |
| Approved symbol | SYT15 |
| Name | synaptotagmin 15 |
| Location | 10q11.22 |
| Locus type | gene with protein product |
| Status | Approved |
| Aliases | CHR10SYT |
| Ensembl gene | ENSG00000204176 |
| Ensembl biotype | protein_coding |
| OMIM | 608081 |
| Entrez | 83849 |
Gene structure
Transcript identifiers
Ensembl transcripts: 8 — 7 protein_coding, 1 protein_coding_CDS_not_defined
ENST00000374321, ENST00000374323, ENST00000374328, ENST00000449358, ENST00000503753, ENST00000512997, ENST00000907760, ENST00000907761
RefSeq mRNA: 2 — MANE Select: NM_031912
NM_031912, NM_181519
CCDS: CCDS73103, CCDS73104
Canonical transcript exons
ENST00000374321 — 8 exons
| Exon | Start | End |
|---|---|---|
| ENSE00001463152 | 46585598 | 46585777 |
| ENSE00001463165 | 46584495 | 46584615 |
| ENSE00001463168 | 46583732 | 46583902 |
| ENSE00001748738 | 46581896 | 46582191 |
| ENSE00001801077 | 46580164 | 46580368 |
| ENSE00002019747 | 46579128 | 46579175 |
| ENSE00002488473 | 46580894 | 46581036 |
| ENSE00003893560 | 46587505 | 46592064 |
Expression profiles
Bgee: expression breadth ubiquitous, 133 present calls, max score 78.53.
FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.2164 / max 28.1643, expressed in 86 samples.
FANTOM5 promoters (4 alternative TSS)
| Promoter ID | TPM avg | Samples expressed |
|---|---|---|
| 104815 | 0.1122 | 44 |
| 104812 | 0.0856 | 37 |
| 104813 | 0.0107 | 4 |
| 104814 | 0.0079 | 0 |
Top tissues by expression
134 total, by Bgee expression score (0-100, higher = more expressed):
| Tissue | Anatomy ID | Expression score | Quality |
|---|---|---|---|
| male germ line stem cell (sensu Vertebrata) in testis | CL:0000089 ∩ UBERON:0000473 | 78.53 | gold quality |
| right lung | UBERON:0002167 | 77.45 | gold quality |
| upper lobe of left lung | UBERON:0008952 | 77.18 | gold quality |
| lung | UBERON:0002048 | 76.31 | gold quality |
| left uterine tube | UBERON:0001303 | 76.12 | gold quality |
| ectocervix | UBERON:0012249 | 75.16 | gold quality |
| apex of heart | UBERON:0002098 | 74.82 | gold quality |
| mucosa of stomach | UBERON:0001199 | 73.77 | gold quality |
| lymph node | UBERON:0000029 | 72.79 | gold quality |
| endocervix | UBERON:0000458 | 72.62 | gold quality |
| subcutaneous adipose tissue | UBERON:0002190 | 72.49 | gold quality |
| uterine cervix | UBERON:0000002 | 72.41 | gold quality |
| placenta | UBERON:0001987 | 71.95 | gold quality |
| vagina | UBERON:0000996 | 71.94 | gold quality |
| adipose tissue | UBERON:0001013 | 71.80 | gold quality |
| body of pancreas | UBERON:0001150 | 71.59 | gold quality |
| lower esophagus muscularis layer | UBERON:0035833 | 71.51 | gold quality |
| lower esophagus | UBERON:0013473 | 71.49 | gold quality |
| fallopian tube | UBERON:0003889 | 71.18 | gold quality |
| esophagogastric junction muscularis propria | UBERON:0035841 | 71.13 | gold quality |
| omental fat pad | UBERON:0010414 | 71.06 | gold quality |
| myometrium | UBERON:0001296 | 71.04 | gold quality |
| body of uterus | UBERON:0009853 | 70.96 | gold quality |
| esophagus | UBERON:0001043 | 70.72 | gold quality |
| urinary bladder | UBERON:0001255 | 70.65 | gold quality |
| right lobe of thyroid gland | UBERON:0001119 | 70.54 | gold quality |
| tibial nerve | UBERON:0001323 | 70.47 | gold quality |
| right coronary artery | UBERON:0001625 | 70.21 | gold quality |
| left coronary artery | UBERON:0001626 | 70.03 | gold quality |
| esophagus mucosa | UBERON:0002469 | 69.93 | gold quality |
Single-cell (SCXA)
Detected in 1 experiment(s), a significant marker in 1.
| Experiment | Marker? | Max mean expression |
|---|---|---|
| E-ANND-3 | yes | 9.34 |
Regulation
Is transcription factor: no
miRNA regulators (miRDB)
136 targeting SYT15, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):
| miRNA | Max score | Avg score | miRNA target_count |
|---|---|---|---|
| HSA-MIR-3613-3P | 100.00 | 76.36 | 7965 |
| HSA-MIR-8485 | 100.00 | 77.57 | 4731 |
| HSA-MIR-1252-5P | 100.00 | 69.80 | 2774 |
| HSA-LET-7A-3P | 100.00 | 74.03 | 3932 |
| HSA-LET-7B-3P | 100.00 | 74.08 | 3913 |
| HSA-LET-7F-1-3P | 100.00 | 74.02 | 3928 |
| HSA-MIR-98-3P | 100.00 | 74.08 | 3907 |
| HSA-MIR-12118 | 100.00 | 65.88 | 1270 |
| HSA-MIR-3163 | 100.00 | 77.23 | 8605 |
| HSA-MIR-4673 | 100.00 | 66.64 | 1490 |
| HSA-MIR-5692A | 100.00 | 74.40 | 6850 |
| HSA-MIR-371B-5P | 99.99 | 75.34 | 4759 |
| HSA-MIR-548C-3P | 99.99 | 74.01 | 7587 |
| HSA-MIR-511-3P | 99.99 | 68.85 | 1467 |
| HSA-MIR-4531 | 99.99 | 69.70 | 3181 |
| HSA-MIR-373-5P | 99.98 | 75.36 | 4753 |
| HSA-MIR-616-5P | 99.98 | 75.58 | 4775 |
| HSA-MIR-6891-5P | 99.98 | 66.53 | 1372 |
| HSA-MIR-4482-3P | 99.98 | 72.50 | 3147 |
| HSA-MIR-3173-3P | 99.98 | 66.49 | 1217 |
| HSA-MIR-4645-5P | 99.98 | 65.81 | 1284 |
| HSA-MIR-7152-3P | 99.97 | 67.47 | 849 |
| HSA-MIR-3148 | 99.97 | 75.06 | 6478 |
| HSA-MIR-5688 | 99.96 | 73.23 | 4504 |
| HSA-MIR-495-3P | 99.96 | 72.81 | 4197 |
| HSA-MIR-590-3P | 99.96 | 74.34 | 6478 |
| HSA-MIR-3605-5P | 99.96 | 67.12 | 932 |
| HSA-MIR-6825-5P | 99.96 | 69.81 | 3431 |
| HSA-MIR-3910 | 99.95 | 71.13 | 2227 |
| HSA-MIR-545-3P | 99.95 | 70.74 | 2783 |
Functional genomics
DepMap (CRISPR cell-line fitness): dependent in 40.0% of screened cell lines.
Literature-anchored findings (GeneRIF, showing 1)
- molecular cloning and structure (PMID:12788067)
Cross-species orthologs
3 orthologs
| Organism | Symbol | Gene ID |
|---|---|---|
| danio_rerio | syt15 | ENSDARG00000079926 |
| mus_musculus | Syt15 | ENSMUSG00000041479 |
| rattus_norvegicus | Syt15 | ENSRNOG00000051688 |
Paralogs (31): SYT7 (ENSG00000011347), SYT13 (ENSG00000019505), SYT1 (ENSG00000067715), RPH3A (ENSG00000089169), SYTL4 (ENSG00000102362), SYT17 (ENSG00000103528), SYT10 (ENSG00000110975), SYT5 (ENSG00000129990), SYT11 (ENSG00000132718), SYT4 (ENSG00000132872), SYT6 (ENSG00000134207), SYTL2 (ENSG00000137501), SYT16 (ENSG00000139973), SYTL1 (ENSG00000142765), SYT14 (ENSG00000143469), SYT2 (ENSG00000143858), SYTL5 (ENSG00000147041), SYT8 (ENSG00000149043), DOC2A (ENSG00000149927), SYTL3 (ENSG00000164674), TC2N (ENSG00000165929), SYT9 (ENSG00000170743), SYT12 (ENSG00000173227), RPH3AL (ENSG00000181031), C2CD4C (ENSG00000183186), C2CD4A (ENSG00000198535), C2CD4B (ENSG00000205502), SYT3 (ENSG00000213023), C2CD4D (ENSG00000225556), DOC2B (ENSG00000272636), SYT15B (ENSG00000277758)
Protein
Protein identifiers
Synaptotagmin-15 — Q9BQS2 (reviewed: Q9BQS2)
Alternative names: Chr10Syt, Synaptotagmin XV
All UniProt accessions (3): D6RF99, Q9BQS2, H3BLX3
UniProt curated annotations — full annotation on UniProt →
Function. May be involved in the trafficking and exocytosis of secretory vesicles in non-neuronal tissues.
Subunit / interactions. Homodimer.
Subcellular location. Cell membrane Cell membrane Cell membrane.
Domain organisation. Neither C2 domains mediates Ca(2+)-dependent or -independent phospholipid binding.
Similarity. Belongs to the synaptotagmin family.
Isoforms (4)
| UniProt ID | Names | Canonical? |
|---|---|---|
| Q9BQS2-1 | 1, Syt XV-a | yes |
| Q9BQS2-2 | 2, Syt XV-b | |
| Q9BQS2-3 | 3 | |
| Q9BQS2-4 | 4 |
RefSeq proteins (2): NP_114118, NP_852660 (=MANE)
Domains & families (InterPro)
| ID | Name | Type |
|---|---|---|
| IPR000008 | C2_dom | Domain |
| IPR035892 | C2_domain_sf | Homologous_superfamily |
| IPR047897 | Synaptotagmin-15/17_C2A | Domain |
Pfam: PF00168
UniProt features (13 total): splice variant 4, topological domain 2, sequence conflict 2, domain 2, chain 1, transmembrane region 1, region of interest 1
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
| Model | pLDDT | Fraction very-high |
|---|---|---|
| AF-Q9BQS2-F1 | 77.25 | 0.52 |
Function
Pathways and Gene Ontology
Reactome pathways
0 pathways
MSigDB gene sets: 68 (showing top):
GOBP_REGULATION_OF_EXOCYTOSIS, GOBP_VESICLE_MEDIATED_TRANSPORT, GOBP_REGULATION_OF_VESICLE_MEDIATED_TRANSPORT, GOBP_EXOCYTOSIS, GOBP_SECRETION, GOBP_REGULATION_OF_REGULATED_SECRETORY_PATHWAY, GOBP_REGULATION_OF_CALCIUM_ION_DEPENDENT_EXOCYTOSIS, GOBP_CALCIUM_ION_REGULATED_EXOCYTOSIS, GOBP_REGULATION_OF_TRANSPORT, GOCC_EXOCYTIC_VESICLE, GOCC_SECRETORY_VESICLE, GOMF_SNARE_BINDING, GOMF_LIPID_BINDING, GOMF_PHOSPHOLIPID_BINDING, GOMF_CALCIUM_DEPENDENT_PHOSPHOLIPID_BINDING
GO Biological Process (2): vesicle-mediated transport (GO:0016192), regulation of calcium ion-dependent exocytosis (GO:0017158)
GO Molecular Function (4): SNARE binding (GO:0000149), calcium-dependent phospholipid binding (GO:0005544), calcium ion sensor activity (GO:0061891), protein binding (GO:0005515)
GO Cellular Component (3): plasma membrane (GO:0005886), exocytic vesicle (GO:0070382), membrane (GO:0016020)
GO top-level categories
Rollup of top GO terms by namespace:
| Category | Terms |
|---|---|
| transport | 1 |
| cellular process | 1 |
| calcium-ion regulated exocytosis | 1 |
| regulation of regulated secretory pathway | 1 |
| protein binding | 1 |
| phospholipid binding | 1 |
| calcium ion binding | 1 |
| metal ion sensor activity | 1 |
| binding | 1 |
| membrane | 1 |
| cell periphery | 1 |
| transport vesicle | 1 |
| secretory vesicle | 1 |
| cellular anatomical structure | 1 |
Protein interactions and networks
STRING
342 interactions, top by confidence (×1000):
| Protein A | Protein B | Partner UniProt | Score |
|---|---|---|---|
| SYT15 | GPRIN2 | O60269 | 537 |
| SYT15 | ANTXRL | A6NF34 | 482 |
| SYT15 | NPY4R2 | P0DQD5 | 399 |
| SYT15 | ASB14 | A6NK59 | 384 |
| SYT15 | FRMPD2 | Q68DX3 | 380 |
| SYT15 | AGAP6 | Q5VW22 | 380 |
| SYT15 | KNCN | A6PVL3 | 369 |
| SYT15 | TMEM161A | Q9NX61 | 363 |
| SYT15 | ALG14 | Q96F25 | 359 |
| SYT15 | SNAP25 | P13795 | 357 |
| SYT15 | COLQ | Q9Y215 | 330 |
| SYT15 | FAM25A | B3EWG3 | 324 |
| SYT15 | ASAH2B | P0C7U1 | 322 |
| SYT15 | RAPSN | Q13702 | 316 |
| SYT15 | ZNF510 | Q9Y2H8 | 311 |
IntAct
2 interactions, top by confidence:
| A | B | Type | Score |
|---|---|---|---|
| NEK4 | E2F8 | psi-mi:“MI:0914”(association) | 0.350 |
BioGRID (15): SYT15 (Affinity Capture-MS), SYT15 (Two-hybrid), LOC102724488 (Two-hybrid), SYT15 (Two-hybrid), LOC102724488 (Two-hybrid), SYT15 (Two-hybrid), LOC102724488 (Two-hybrid), SYT15 (Two-hybrid), LOC102724488 (Two-hybrid), SYT15 (Two-hybrid), LOC102724488 (Two-hybrid), SYT15 (Affinity Capture-MS), SYT15 (Affinity Capture-MS), C6orf211 (Cross-Linking-MS (XL-MS)), SYT15 (Affinity Capture-RNA)
ESM2 similar proteins: A0A0B4J1F4, A0A0G2JXN2, A2AWP8, A2RRH5, C9J798, O43374, O70277, O95294, P04629, P59926, Q0GA42, Q13368, Q14318, Q16512, Q29RM4, Q2HY40, Q2T9P3, Q2TBA3, Q5BIM1, Q5M7W1, Q5R5M3, Q5R811, Q5T7P8, Q5XIS9, Q62746, Q6PFQ7, Q6PFY8, Q7TNM2, Q7TP90, Q7Z4K8, Q8BG60, Q8BHT7, Q8BQC3, Q8C6N3, Q8CIW5, Q8IZ69, Q8NCT1, Q920N2, Q92546, Q925B4
Diamond homologs: A0A075F932, A0FGR8, A4IJ05, K8FE10, O00445, O00750, O08625, O08835, O35681, O43581, P04409, P05128, P05129, P05130, P05696, P10102, P10829, P13677, P17252, P20444, P21521, P21579, P21707, P24505, P24506, P24507, P29101, P34693, P40748, P40749, P41823, P41885, P46096, P46097, P47191, P47708, P47709, P47861, P48018, P50232
SIGNOR signaling
0 interactions.
Disease & clinical
Clinical variants and AI predictions
ClinVar
81 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 0 |
| Likely pathogenic | 0 |
| Uncertain significance | 64 |
| Likely benign | 7 |
| Benign | 0 |
Top pathogenic / likely-pathogenic (0)
SpliceAI
1759 predictions. Top by Δscore:
| Variant | Effect | Δscore |
|---|---|---|
| 10:46582190:C:CA | donor_loss | 1.0000 |
| 10:46582191:A:AT | donor_loss | 1.0000 |
| 10:46582192:TACCT:T | donor_loss | 1.0000 |
| 10:46582193:GTACC:G | donor_loss | 1.0000 |
| 10:46582194:TGTA:T | donor_loss | 1.0000 |
| 10:46583729:C:CC | acceptor_gain | 1.0000 |
| 10:46583729:C:T | acceptor_gain | 1.0000 |
| 10:46583730:CC:C | acceptor_gain | 1.0000 |
| 10:46583731:AC:A | acceptor_gain | 1.0000 |
| 10:46583732:CAC:C | acceptor_gain | 1.0000 |
| 10:46583732:CACC:C | acceptor_gain | 1.0000 |
| 10:46583733:ACAC:A | acceptor_gain | 1.0000 |
| 10:46583734:GACAC:G | acceptor_gain | 1.0000 |
| 10:46583796:T:TA | donor_gain | 1.0000 |
| 10:46583899:T:TA | donor_gain | 1.0000 |
| 10:46583901:C:A | donor_loss | 1.0000 |
| 10:46583902:AC:A | donor_loss | 1.0000 |
| 10:46583902:ACCTC:A | donor_loss | 1.0000 |
| 10:46583903:TACCT:T | donor_loss | 1.0000 |
| 10:46583904:ATAC:A | donor_loss | 1.0000 |
| 10:46583905:CATA:C | donor_loss | 1.0000 |
| 10:46584481:A:T | acceptor_gain | 1.0000 |
| 10:46584482:C:CT | acceptor_gain | 1.0000 |
| 10:46584492:C:CA | acceptor_loss | 1.0000 |
| 10:46584492:C:CC | acceptor_gain | 1.0000 |
| 10:46584493:GC:G | acceptor_loss | 1.0000 |
| 10:46584493:GCTG:G | acceptor_loss | 1.0000 |
| 10:46584495:GGG:G | acceptor_gain | 1.0000 |
| 10:46584496:GGGG:G | acceptor_gain | 1.0000 |
| 10:46584497:GGGGG:G | acceptor_gain | 1.0000 |
AlphaMissense
2736 scored. Top likely-pathogenic:
| Variant | Protein change | am_pathogenicity |
|---|---|---|
| 10:46585607:T:A | V318D | 0.996 |
| 10:46587573:T:A | W398R | 0.995 |
| 10:46587573:T:C | W398R | 0.995 |
| 10:46587534:G:C | G385R | 0.994 |
| 10:46587575:G:C | W398C | 0.994 |
| 10:46587575:G:T | W398C | 0.994 |
| 10:46584517:T:C | L282P | 0.993 |
| 10:46585650:G:C | K332N | 0.993 |
| 10:46585650:G:T | K332N | 0.993 |
| 10:46585619:T:C | L322P | 0.992 |
| 10:46585706:T:C | F351S | 0.992 |
| 10:46587535:G:A | G385D | 0.992 |
| 10:46584529:T:C | L286P | 0.991 |
| 10:46584556:T:C | L295P | 0.991 |
| 10:46587615:T:A | W412R | 0.991 |
| 10:46587615:T:C | W412R | 0.991 |
| 10:46584562:T:A | V297E | 0.990 |
| 10:46585742:T:C | L363P | 0.990 |
| 10:46585738:A:C | S362R | 0.989 |
| 10:46585740:C:A | S362R | 0.989 |
| 10:46585740:C:G | S362R | 0.989 |
| 10:46587574:G:C | W398S | 0.989 |
| 10:46585705:T:C | F351L | 0.988 |
| 10:46585707:C:A | F351L | 0.988 |
| 10:46585707:C:G | F351L | 0.988 |
| 10:46582031:T:C | L164P | 0.987 |
| 10:46584553:G:C | R294P | 0.987 |
| 10:46584568:T:A | V299E | 0.987 |
| 10:46587535:G:T | G385V | 0.987 |
| 10:46585748:T:C | L365P | 0.986 |
dbSNP variants (sampled 300 via entrez): RS10545241 (10:46594606 AGAC>A), RS10588658 (10:46580719 CGTGTGTGT>C,CGT,CGTGT,CGTGTGT,CGTGTGTGTGT), RS10588659 (10:46580680 CTGTGTGTGTGTGTGTGTGTGTGTGTG>C,CTG,CTGTG,CTGTGTGTG,CTGTGTGTGTGTG,CTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG), RS10712659 (10:46586841 CAAAAA>C,CAA,CAAA,CAAAA,CAAAAAA,CAAAAAAAAA), RS111273873 (10:46578735 A>G), RS111596780 (10:46586805 A>C,G), RS111625798 (10:46579453 C>A,T), RS111852046 (10:46584752 C>T), RS111926928 (10:46579627 G>T), RS112001859 (10:46578821 C>T), RS11204657 (10:46592826 C>G), RS112255958 (10:46589134 G>A), RS112965082 (10:46583722 TC>T,TCC,TCCC), RS113324281 (10:46584716 A>C), RS113796296 (10:46584214 C>A,T)
Disease associations
OMIM: gene MIM:608081 | disease phenotypes:
GenCC curated gene-disease
Mondo (0):
Orphanet (0):
HPO phenotypes
0 total (0 of 0 shown, HPO-id order):
GWAS associations
0 associations (top):
Drugs & pharmacology
Drug and pharmacology data
Is drug target: no
PharmGKB: 1 entry (VIP=true, CPIC=false)
CTD chemical–gene interactions
21 total (human), top 21 by PubMed support.
| Chemical | Actions (top 5) | PubMed papers |
|---|---|---|
| aristolochic acid I | increases expression | 1 |
| bisphenol A | decreases expression | 1 |
| 2,5,2’,5’-tetrachlorobiphenyl | increases expression | 1 |
| tris(2-butoxyethyl) phosphate | affects expression | 1 |
| sodium arsenite | increases expression | 1 |
| Dasatinib | increases expression | 1 |
| Resveratrol | affects cotreatment, decreases expression | 1 |
| Sunitinib | increases expression | 1 |
| Benzo(a)pyrene | decreases methylation | 1 |
| Copper | affects cotreatment, decreases expression | 1 |
| Folic Acid | decreases expression | 1 |
| Glucose | increases expression | 1 |
| Smoke | increases expression | 1 |
| Thalidomide | decreases expression | 1 |
| Tobacco Smoke Pollution | increases methylation | 1 |
| Tretinoin | increases expression | 1 |
| Urethane | decreases expression | 1 |
| Valproic Acid | increases methylation | 1 |
| Acrylamide | decreases expression | 1 |
| S-Nitrosoglutathione | decreases expression | 1 |
| Particulate Matter | increases expression | 1 |
Clinical trials (associated diseases)
0 trials via MONDO — disease-level, not drug-specific.
Related Atlas pages
No linked Atlas pages yet — the cross-entity mesh grows as the corpus expands.