TAFA5

Summary

TAFA5 (TAFA chemokine like family member 5, HGNC:21592) is a protein-coding gene on chromosome 22q13.32, encoding Chemokine-like protein TAFA-5 (Q7Z5A7). Acts as a chemokine-like protein by regulating cell proliferation and migration through activation of G protein-coupled receptors (GPCRs), such as S1PR2 and FPR2.

This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines that act as regulators of immune and nervous cells.

Source: NCBI Gene 25817 — RefSeq curated summary.

At a glance

• GWAS associations: 10
• Clinical variants (ClinVar): 37 total
• MANE Select transcript: NM_001082967

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:21592
Approved symbol	TAFA5
Name	TAFA chemokine like family member 5
Location	22q13.32
Locus type	gene with protein product
Status	Approved
Aliases	TAFA-5
Ensembl gene	ENSG00000219438
Ensembl biotype	protein_coding
OMIM	617499
Entrez	25817

Gene structure

Transcript identifiers

Ensembl transcripts: 6 — 5 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000336769, ENST00000358295, ENST00000402357, ENST00000406880, ENST00000473898, ENST00000912217

RefSeq mRNA: 2 — MANE Select: NM_001082967 NM_001082967, NM_015381

CCDS: CCDS46728, CCDS46729

Canonical transcript exons

ENST00000402357 — 4 exons

Exon	Start	End
ENSE00001547996	48489553	48489704
ENSE00001753871	48646597	48646746
ENSE00003480957	48707717	48707844
ENSE00003899493	48749839	48751932

Expression profiles

Bgee: expression breadth ubiquitous, 200 present calls, max score 96.05.

FANTOM5 (CAGE): breadth broad, TPM avg 2.2267 / max 63.9321, expressed in 446 samples.

FANTOM5 promoters (10 alternative TSS)

Promoter ID	TPM avg	Samples expressed
209517	0.6975	288
192870	0.4462	184
192868	0.3268	170
192875	0.2695	104
192871	0.2493	126
192869	0.1522	82
192913	0.0378	10
192912	0.0363	11
192911	0.0074	3
192910	0.0037	4

Top tissues by expression

249 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
cerebellar vermis	UBERON:0004720	96.05	gold quality
tibial nerve	UBERON:0001323	95.61	gold quality
hypothalamus	UBERON:0001898	95.54	gold quality
amygdala	UBERON:0001876	95.44	gold quality
Ammon’s horn	UBERON:0001954	95.43	gold quality
entorhinal cortex	UBERON:0002728	95.38	gold quality
Brodmann (1909) area 9	UBERON:0013540	95.21	gold quality
postcentral gyrus	UBERON:0002581	95.15	gold quality
temporal lobe	UBERON:0001871	95.14	gold quality
right frontal lobe	UBERON:0002810	95.06	gold quality
superior frontal gyrus	UBERON:0002661	94.98	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	94.95	gold quality
anterior cingulate cortex	UBERON:0009835	94.84	gold quality
cerebral cortex	UBERON:0000956	94.53	gold quality
secondary oocyte	CL:0000655	94.48	gold quality
parietal lobe	UBERON:0001872	94.46	gold quality
primary visual cortex	UBERON:0002436	94.42	gold quality
frontal cortex	UBERON:0001870	94.28	gold quality
neocortex	UBERON:0001950	94.25	gold quality
putamen	UBERON:0001874	94.23	gold quality
nucleus accumbens	UBERON:0001882	94.00	gold quality
caudate nucleus	UBERON:0001873	93.95	gold quality
prefrontal cortex	UBERON:0000451	93.82	gold quality
substantia nigra	UBERON:0002038	93.77	gold quality
midbrain	UBERON:0001891	93.51	gold quality
lateral globus pallidus	UBERON:0002476	93.47	gold quality
occipital lobe	UBERON:0002021	93.43	gold quality
Brodmann (1909) area 23	UBERON:0013554	93.21	gold quality
right hemisphere of cerebellum	UBERON:0014890	93.20	gold quality
cerebellar cortex	UBERON:0002129	93.13	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	4.45

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

74 targeting TAFA5, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-9-5P	100.00	72.28	2361
HSA-MIR-196A-5P	100.00	68.16	684
HSA-MIR-196B-5P	100.00	68.16	681
HSA-MIR-5193	100.00	67.26	1744
HSA-MIR-548AW	99.99	72.57	3559
HSA-MIR-4531	99.99	69.70	3181
HSA-MIR-607	99.97	73.62	5593
HSA-MIR-1468-3P	99.96	72.74	3797
HSA-MIR-4666A-3P	99.96	71.71	3434
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345
HSA-MIR-6778-3P	99.96	67.29	2693
HSA-MIR-548J-3P	99.94	72.61	4881
HSA-MIR-335-3P	99.93	73.36	4958
HSA-MIR-381-3P	99.93	71.87	2854
HSA-MIR-548AE-3P	99.93	72.66	4867
HSA-MIR-548AH-3P	99.93	72.54	4872
HSA-MIR-548AM-3P	99.93	72.54	4872
HSA-MIR-548AQ-3P	99.93	72.66	4867
HSA-MIR-6721-5P	99.93	68.92	2981
HSA-MIR-300	99.92	71.76	2856
HSA-MIR-3529-3P	99.90	73.55	3045
HSA-MIR-548E-5P	99.89	72.73	4486
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-130B-5P	99.83	68.50	1888
HSA-MIR-4694-3P	99.79	69.53	2640
HSA-MIR-548AJ-5P	99.78	71.12	3085
HSA-MIR-548F-5P	99.78	71.02	3093
HSA-MIR-548G-5P	99.78	71.12	3085
HSA-MIR-548X-5P	99.78	71.12	3085

Literature-anchored findings (GeneRIF, showing 7)

• Serum FAM19A5 concentrations were significantly greater in patients with type 2 diabetes and positively correlate with parameters indicating central obesity and vascular disease. (PMID:31280604)
• the results of the present study suggested that TAFA5 had significant effects on gastric cancer (GC) progression, suggesting that it may serve as a potential therapeutic target for GC therapy. (PMID:31702029)
• Association of Serum FAM19A5 with Cognitive Impairment in Vascular Dementia. (PMID:32831973)
• FAM19A5/S1PR1 signaling pathway regulates the viability and proliferation of mantle cell lymphoma. (PMID:33685344)
• Circulating levels of FAM19A5 are inversely associated with subclinical atherosclerosis in non-alcoholic fatty liver disease. (PMID:34344333)
• Increased level of FAM19A5 is associated with cerebral small vessel disease and leads to a better outcome. (PMID:35282278)
• Assessment of progranulin and FAM19A5 protein blood levels in patients with metabolic syndrome. (PMID:35793765)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	tafa5b	ENSDARG00000045608
danio_rerio	tafa5a	ENSDARG00000069160
mus_musculus	Tafa5	ENSMUSG00000054863
rattus_norvegicus	Tafa5	ENSRNOG00000049349

Protein

Protein identifiers

Chemokine-like protein TAFA-5 — Q7Z5A7 (reviewed: Q7Z5A7)

All UniProt accessions (2): Q7Z5A7, B1B1J6

UniProt curated annotations — full annotation on UniProt →

Function. Acts as a chemokine-like protein by regulating cell proliferation and migration through activation of G protein-coupled receptors (GPCRs), such as S1PR2 and FPR2. Stimulates chemotactic migration of macrophages mediated by the MAPK3/ERK1 and AKT1 pathway. Blocks TNFSF11/RANKL-induced osteoclast formation from macrophages by inhibiting up-regulation of osteoclast fusogenic and differentiation genes. Stimulation of macrophage migration and inhibition of osteoclast formation is mediated via GPCR FPR2. Acts as an adipokine by negatively regulating vascular smooth muscle cell (VSMC) proliferation and migration in response to platelet-derived growth factor stimulation via GPCR S1PR2 and G protein GNA12/GNA13-transmitted RHOA signaling. Inhibits injury-induced cell proliferation and neointima formation in the femoral arteries.

Subcellular location. Secreted.

Tissue specificity. Expressed in the subcutaneous and perirenal adipose tissue (at protein level). Highly expressed in adipose tissue with moderate expression in the brain and ovary. Isoform 2: Brain-specific.

Miscellaneous. Contains a predicted signal peptide at positions 1-25.

Similarity. Belongs to the TAFA family.

Isoforms (3)

UniProt ID	Names	Canonical?
Q7Z5A7-1	1	yes
Q7Z5A7-2	2
Q7Z5A7-3	3

RefSeq proteins (2): NP_001076436, NP_056196 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR020350	Chemokine-like_TAFA	Family
IPR040329	TAFA-5	Family

Pfam: PF12020

UniProt features (6 total): splice variant 2, signal peptide 1, chain 1, glycosylation site 1, sequence conflict 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q7Z5A7-F1	83.74	0.50

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Glycosylation sites (1): 113

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 107 (showing top): GSE45365_HEALTHY_VS_MCMV_INFECTION_CD8_TCELL_IFNAR_KO_DN, GCM_MAP4K4, GCM_PTPRD, GOBP_NEGATIVE_REGULATION_OF_SMOOTH_MUSCLE_CELL_PROLIFERATION, GOBP_REGULATION_OF_WOUND_HEALING, TTTGTAG_MIR520D, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GOBP_MUSCLE_CELL_PROLIFERATION, GOBP_WOUND_HEALING, GOBP_NEGATIVE_REGULATION_OF_MULTICELLULAR_ORGANISMAL_PROCESS, GTGTTGA_MIR505, GOBP_REGULATION_OF_RESPONSE_TO_WOUNDING, GOBP_REGULATION_OF_RESPONSE_TO_STRESS, GOBP_BLOOD_VESSEL_MORPHOGENESIS, GOBP_NEGATIVE_REGULATION_OF_VASCULATURE_DEVELOPMENT

GO Biological Process (3): G protein-coupled receptor signaling pathway (GO:0007186), negative regulation of vascular wound healing (GO:0061044), negative regulation of vascular associated smooth muscle cell proliferation (GO:1904706)

GO Molecular Function (3): G protein-coupled receptor binding (GO:0001664), cytokine activity (GO:0005125), receptor ligand activity (GO:0048018)

GO Cellular Component (4): obsolete extracellular space (GO:0005615), cytoplasm (GO:0005737), extracellular region (GO:0005576), membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
signal transduction	2
signaling receptor binding	2
G protein-coupled receptor activity	1
negative regulation of angiogenesis	1
vascular wound healing	1
regulation of vascular wound healing	1
negative regulation of wound healing	1
negative regulation of smooth muscle cell proliferation	1
regulation of vascular associated smooth muscle cell proliferation	1
vascular associated smooth muscle cell proliferation	1
receptor ligand activity	1
signaling receptor activator activity	1
intracellular anatomical structure	1

Protein interactions and networks

STRING

770 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TAFA5	TCERG1L	Q5VWI1	574
TAFA5	S1PR2	O95136	506
TAFA5	FZD10	Q9ULW2	488
TAFA5	TMEM132D	Q14C87	460
TAFA5	RBAK	Q9NYW8	455
TAFA5	FPR2	P25090	439
TAFA5	FAM240B	A0A1B0GVZ2	434
TAFA5	GAL3ST4	Q96RP7	428
TAFA5	A0A0A6YYG8	A0A0A6YYG8	428
TAFA5	TMEM132C	Q8N3T6	413
TAFA5	LRRN1	Q6UXK5	412
TAFA5	PLPPR2	Q96GM1	408
TAFA5	PRLHR	P49683	407
TAFA5	TAFA1	Q7Z5A9	399
TAFA5	DPP6	P42658	392

IntAct

3 interactions, top by confidence:

A	B	Type	Score
TAFA5	GPR37	psi-mi:“MI:0915”(physical association)	0.370
TAFA5	NEBL	psi-mi:“MI:0914”(association)	0.350

BioGRID (17): FAM19A5 (Affinity Capture-RNA), FAM19A5 (Two-hybrid), SDK2 (Affinity Capture-MS), TMEM67 (Affinity Capture-MS), FAT4 (Affinity Capture-MS), DCBLD2 (Affinity Capture-MS), VWDE (Affinity Capture-MS), NEBL (Affinity Capture-MS), FREM2 (Affinity Capture-MS), PLTP (Affinity Capture-MS), LNPEP (Affinity Capture-MS), TENM3 (Affinity Capture-MS), ASPH (Affinity Capture-MS), GPR98 (Affinity Capture-MS), LRRC4B (Affinity Capture-MS)

ESM2 similar proteins: A0A1D5PUP4, A2AFS3, M0R7X9, O70472, O75882, O95803, P01134, P26012, P52799, P52848, P69849, Q02353, Q05204, Q0VCJ8, Q12841, Q13635, Q15155, Q3UHN9, Q3ZBS2, Q58D84, Q5EA46, Q5JPE7, Q5R9Y1, Q5U4X8, Q5VV63, Q5ZJB7, Q5ZMH6, Q61115, Q62356, Q62632, Q6A051, Q6GQK9, Q6GQT9, Q6P988, Q6UXG2, Q7Z5A7, Q86TD4, Q90693, Q91WE9, Q96CW9

Diamond homologs: M0R7X9, Q3ZBS2, Q5R6N2, Q7TPG5, Q7TPG6, Q7TPG7, Q7TPG8, Q7Z5A7, Q7Z5A8, Q7Z5A9, Q8N3H0, Q91WE9, Q96LR4, Q9N0D3

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

37 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	30
Likely benign	2
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

3095 predictions. Top by Δscore:

Variant	Effect	Δscore
22:48646592:TGCA:T	acceptor_loss	1.0000
22:48646595:A:AG	acceptor_gain	1.0000
22:48646595:A:C	acceptor_loss	1.0000
22:48646596:G:GG	acceptor_gain	1.0000
22:48646596:GGTC:G	acceptor_gain	1.0000
22:48646596:GGTCA:G	acceptor_gain	1.0000
22:48646742:GGACG:G	donor_gain	1.0000
22:48646743:GACG:G	donor_gain	1.0000
22:48646743:GACGG:G	donor_gain	1.0000
22:48646744:ACGG:A	donor_loss	1.0000
22:48646745:CGGTA:C	donor_loss	1.0000
22:48646746:GGT:G	donor_loss	1.0000
22:48646747:G:C	donor_loss	1.0000
22:48646747:G:GG	donor_gain	1.0000
22:48646748:TAA:T	donor_loss	1.0000
22:48707714:CA:C	acceptor_loss	1.0000
22:48707715:A:AG	acceptor_gain	1.0000
22:48707716:G:GA	acceptor_gain	1.0000
22:48707716:GCA:G	acceptor_gain	1.0000
22:48707716:GCAA:G	acceptor_gain	1.0000
22:48707842:ACGG:A	donor_loss	1.0000
22:48707843:CGGT:C	donor_loss	1.0000
22:48707844:GGTA:G	donor_loss	1.0000
22:48707845:G:GG	donor_gain	1.0000
22:48707845:GTAT:G	donor_loss	1.0000
22:48707846:T:A	donor_loss	1.0000
22:48576568:GAAG:G	donor_gain	0.9900
22:48576572:G:GA	donor_loss	0.9900
22:48576573:T:A	donor_loss	0.9900
22:48646595:AG:A	acceptor_gain	0.9900

AlphaMissense

846 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
22:48707742:G:C	W96C	1.000
22:48707742:G:T	W96C	1.000
22:48707805:G:C	W117C	1.000
22:48707805:G:T	W117C	1.000
22:48646617:T:A	C45S	0.999
22:48646618:G:A	C45Y	0.999
22:48646618:G:C	C45S	0.999
22:48646686:T:A	C68S	0.999
22:48646686:T:C	C68R	0.999
22:48646687:G:A	C68Y	0.999
22:48646687:G:C	C68S	0.999
22:48646692:T:A	C70S	0.999
22:48646693:G:A	C70Y	0.999
22:48646693:G:C	C70S	0.999
22:48646711:C:A	A76D	0.999
22:48646714:G:A	G77D	0.999
22:48646737:T:A	C85S	0.999
22:48646737:T:C	C85R	0.999
22:48646738:G:A	C85Y	0.999
22:48646738:G:C	C85S	0.999
22:48707740:T:A	W96R	0.999
22:48707740:T:C	W96R	0.999
22:48707743:T:A	C97S	0.999
22:48707744:G:C	C97S	0.999
22:48707776:T:A	C108S	0.999
22:48707777:G:C	C108S	0.999
22:48707800:G:T	G116C	0.999
22:48707803:T:A	W117R	0.999
22:48707803:T:C	W117R	0.999
22:48707809:T:A	C119S	0.999

dbSNP variants (sampled 300 via entrez): RS1000004469 (22:48750379 G>A), RS1000006625 (22:48676714 G>A), RS1000017660 (22:48676018 G>A,C), RS1000020703 (22:48575929 GGGCGGCGGAGGAGGC>G,GGGCGGCGGAGGAGGCGGCGGCGGAGGAGGC), RS1000024092 (22:48555936 C>T), RS1000025667 (22:48630680 C>G,T), RS1000027800 (22:48599390 G>A), RS1000030052 (22:48526950 G>A), RS1000032246 (22:48615352 C>T), RS1000038139 (22:48722771 G>A), RS1000042501 (22:48659984 G>A), RS1000059404 (22:48672448 T>C), RS1000065167 (22:48709888 G>A), RS1000072959 (22:48489419 AGCGCGGGCGGCGCGGGCGCGGCGCGGG>A), RS1000089889 (22:48568173 A>C)

Disease associations

OMIM: gene MIM:617499 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

10 associations (top):

Study	Trait	p-value
GCST001350_10	Pancreatic cancer	1.000000e-10
GCST003815_4	Late-onset Alzheimer’s disease	3.000000e-06
GCST003993_43	Menarche (age at onset)	4.000000e-09
GCST006575_2	Takayasu arteritis	4.000000e-06
GCST006575_54	Takayasu arteritis	4.000000e-06
GCST008369_7	Plasma anti-thyroglobulin levels	2.000000e-06
GCST009849_13	Hallux valgus	8.000000e-07
GCST010242_74	HDL cholesterol levels	5.000000e-09
GCST010988_516	Adult body size	4.000000e-08
GCST90000514_33	Gastroesophageal reflux disease	1.000000e-08

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:1001870	late-onset Alzheimers disease
EFO:0004703	age at menarche
EFO:0004612	high density lipoprotein cholesterol measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB variants

1 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs5768434	TAFA5		0.00	0

CTD chemical–gene interactions

36 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation, decreases expression, increases methylation	3
Valproic Acid	increases expression, increases methylation, affects expression	3
methylmercuric chloride	increases expression, affects cotreatment	2
bisphenol A	decreases methylation, affects expression, affects cotreatment	2
Arsenic	affects methylation, decreases methylation, increases abundance	2
Phenylmercuric Acetate	affects cotreatment, decreases expression	2
Silicon Dioxide	decreases expression, increases expression	2
Cyclosporine	decreases expression, decreases methylation	2
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
benzo(e)pyrene	increases methylation	1
aflatoxin B2	increases methylation	1
resorcinol	increases expression	1
CGP 52608	affects binding, increases reaction	1
K 7174	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression, decreases expression	1
clothianidin	increases expression	1
dorsomorphin	affects cotreatment, increases expression, decreases expression	1
bisphenol S	decreases methylation	1
jinfukang	affects cotreatment, decreases expression	1
Arsenic Trioxide	increases expression	1
Fulvestrant	affects cotreatment, decreases methylation	1
Allergens	decreases expression	1
Cadmium	increases abundance, increases expression	1
Cisplatin	affects cotreatment, decreases expression	1
Methapyrilene	increases methylation	1
Nickel	decreases expression	1
Quercetin	decreases expression	1
Tobacco Smoke Pollution	increases methylation	1
Tretinoin	decreases expression	1
8-Bromo Cyclic Adenosine Monophosphate	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.