TBC1D28

Summary

TBC1D28 (TBC1 domain family member 28, HGNC:26858) is a protein-coding gene on chromosome 17p11.2, encoding TBC1 domain family member 28 (Q2M2D7). It is a selective cancer dependency (DepMap: 11.7% of cell lines).

At a glance

• Clinical variants (ClinVar): 37 total
• Cancer dependency (DepMap): dependent in 11.7% of screened cell lines
• MANE Select transcript: NM_001039397

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:26858
Approved symbol	TBC1D28
Name	TBC1 domain family member 28
Location	17p11.2
Locus type	gene with protein product
Status	Approved
Aliases	FLJ40244
Ensembl gene	ENSG00000189375
Ensembl biotype	protein_coding
Entrez	254272

Gene structure

Transcript identifiers

Ensembl transcripts: 8 — 5 protein_coding, 3 protein_coding_CDS_not_defined

ENST00000345096, ENST00000405044, ENST00000573652, ENST00000575211, ENST00000575220, ENST00000575570, ENST00000575970, ENST00000579178

RefSeq mRNA: 1 — MANE Select: NM_001039397 NM_001039397

CCDS: CCDS42273

Canonical transcript exons

ENST00000405044 — 10 exons

Exon	Start	End
ENSE00001536461	18634247	18636597
ENSE00001767451	18644290	18644391
ENSE00002326069	18638621	18638701
ENSE00002328424	18641632	18641733
ENSE00002340444	18641828	18641998
ENSE00002341030	18637864	18637973
ENSE00002395368	18638313	18638420
ENSE00002398753	18641278	18641353
ENSE00002409001	18639175	18639214
ENSE00003786998	18641022	18641104

Expression profiles

Bgee: expression breadth broad, 32 present calls, max score 91.76.

Top tissues by expression

183 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
sperm	CL:0000019	91.76	silver quality
right testis	UBERON:0004534	82.41	gold quality
left testis	UBERON:0004533	81.34	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	78.93	gold quality
testis	UBERON:0000473	78.70	gold quality
bone marrow cell	CL:0002092	56.47	silver quality
tendon of biceps brachii	UBERON:0008188	53.75	gold quality
buccal mucosa cell	CL:0002336	52.86	gold quality
colonic epithelium	UBERON:0000397	45.41	gold quality
amniotic fluid	UBERON:0000173	43.71	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	43.37	gold quality
nucleus accumbens	UBERON:0001882	43.19	gold quality
secondary oocyte	CL:0000655	42.57	gold quality
seminal vesicle	UBERON:0000998	42.32	gold quality
bone marrow	UBERON:0002371	42.11	gold quality
middle temporal gyrus	UBERON:0002771	42.06	gold quality
spleen	UBERON:0002106	41.63	silver quality
vastus lateralis	UBERON:0001379	41.41	gold quality
cartilage tissue	UBERON:0002418	41.39	gold quality
quadriceps femoris	UBERON:0001377	41.37	gold quality
superficial temporal artery	UBERON:0001614	41.33	gold quality
palpebral conjunctiva	UBERON:0001812	41.10	gold quality
mucosa of paranasal sinus	UBERON:0005030	40.98	gold quality
vermiform appendix	UBERON:0001154	40.75	gold quality
Brodmann (1909) area 23	UBERON:0013554	40.61	gold quality
jejunal mucosa	UBERON:0000399	40.59	gold quality
biceps brachii	UBERON:0001507	40.57	gold quality
medial globus pallidus	UBERON:0002477	40.54	gold quality
epithelium of nasopharynx	UBERON:0001951	40.45	gold quality
myocardium	UBERON:0002349	40.45	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	1.78

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

24 targeting TBC1D28, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-9902	99.89	69.15	2250
HSA-MIR-605-3P	99.88	69.22	1833
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-6752-3P	99.72	66.71	1587
HSA-MIR-1825	99.72	68.11	1089
HSA-MIR-4663	99.62	65.33	957
HSA-MIR-6126	99.62	68.09	996
HSA-MIR-4696	99.48	67.48	1040
HSA-MIR-4727-5P	99.23	67.55	1154
HSA-MIR-491-5P	99.13	65.98	1468
HSA-MIR-452-3P	99.01	66.25	1241
HSA-MIR-4742-5P	98.89	68.41	1542
HSA-MIR-4646-3P	98.65	66.98	693
HSA-MIR-4733-3P	98.35	65.20	994
HSA-MIR-4446-3P	97.91	64.29	991
HSA-MIR-6783-5P	97.67	67.21	1528
HSA-MIR-4786-5P	97.45	67.89	924
HSA-MIR-3116	97.07	65.78	1324
HSA-MIR-576-3P	96.14	65.63	773
HSA-MIR-8071	95.69	64.93	484
HSA-MIR-24-1-5P	95.57	65.85	492
HSA-MIR-24-2-5P	95.57	66.16	484
HSA-MIR-1915-5P	95.25	65.78	571
HSA-MIR-4497	92.25	64.06	134

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 11.7% of screened cell lines.

Cross-species orthologs

0 orthologs

Paralogs (45): RABGAP1 (ENSG00000011454), TBC1D22A (ENSG00000054611), TBC1D22B (ENSG00000065491), TBC1D1 (ENSG00000065882), EVI5 (ENSG00000067208), TBC1D25 (ENSG00000068354), TBC1D2 (ENSG00000095383), TBC1D10A (ENSG00000099992), SGSM3 (ENSG00000100359), TBC1D17 (ENSG00000104946), TBC1D13 (ENSG00000107021), TBC1D12 (ENSG00000108239), TBC1D9 (ENSG00000109436), TBC1D30 (ENSG00000111490), TBC1D15 (ENSG00000121749), TBC1D5 (ENSG00000131374), TBC1D14 (ENSG00000132405), TBC1D8B (ENSG00000133138), TBC1D4 (ENSG00000136111), GRTP1 (ENSG00000139835), SGSM2 (ENSG00000141258), EVI5L (ENSG00000142459), TBCK (ENSG00000145348), USP6NL (ENSG00000148429), RABGAP1L (ENSG00000152061), SGSM1 (ENSG00000167037), TBC1D21 (ENSG00000167139), TBC1D2B (ENSG00000167202), TBC1D16 (ENSG00000167291), TBC1D10B (ENSG00000169221), TBC1D10C (ENSG00000175463), TBC1D9B (ENSG00000197226), TBC1D8 (ENSG00000204634), TBC1D26 (ENSG00000214946), TBC1D3G (ENSG00000260287), TBC1D3K (ENSG00000273513), TBC1D3H (ENSG00000274226), TBC1D3D (ENSG00000274419), TBC1D3L (ENSG00000274512), TBC1D3 (ENSG00000274611)

Protein

Protein identifiers

TBC1 domain family member 28 — Q2M2D7 (reviewed: Q2M2D7)

All UniProt accessions (4): Q2M2D7, I3L197, I3L433, I3L502

UniProt curated annotations — full annotation on UniProt →

RefSeq proteins (1): NP_001034486* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000195	Rab-GAP-TBC_dom	Domain
IPR035969	Rab-GAP_TBC_sf	Homologous_superfamily
IPR050302	Rab_GAP_TBC_domain	Family

Pfam: PF00566

UniProt features (3 total): chain 1, domain 1, sequence conflict 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q2M2D7-F1	78.13	0.39

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 13 (showing top): CBX5_TARGET_GENES, GLI1_TARGET_GENES, HES2_TARGET_GENES, ZIM3_TARGET_GENES, ZNF274_TARGET_GENES, MIR4742_5P, MIR452_3P, MIR4663, SUMO1_TARGET_GENES, GSE2706_R848_VS_R848_AND_LPS_8H_STIM_DC_DN, GSE40666_STAT1_KO_VS_STAT4_KO_CD8_TCELL_WITH_IFNA_STIM_90MIN_DN, GSE40666_STAT1_KO_VS_STAT4_KO_CD8_TCELL_DN, chr17p11

GO Biological Process (0):

GO Molecular Function (0):

GO Cellular Component (0):

Protein interactions and networks

STRING

648 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TBC1D28	CDRT15L2	A8MXV6	621
TBC1D28	CCDC144A	A2RUR9	583
TBC1D28	SLC35G3	Q8N808	542
TBC1D28	SLC35G6	P0C7Q6	542
TBC1D28	SPDYE4	A6NLX3	515
TBC1D28	OR3A2	P47893	513
TBC1D28	CHCT1	Q86WR6	507
TBC1D28	TVP23B	Q9NYZ1	506
TBC1D28	LRRC3C	A6NJW4	480
TBC1D28	FBXW10B	O95170	479
TBC1D28	TMEM95	Q3KNT9	479
TBC1D28	MFSD6L	Q8IWD5	472
TBC1D28	TBC1D19	Q8N5T2	470
TBC1D28	TBC1D22B	Q9NU19	467
TBC1D28	TBC1D21	Q8IYX1	447
TBC1D28	ERLN	P0DI80	447

IntAct

4 interactions, top by confidence:

A	B	Type	Score
TBC1D28	PRKDC	psi-mi:“MI:0915”(physical association)	0.400
TBC1D28	H3-4	psi-mi:“MI:0915”(physical association)	0.400
TBC1D28	CAPS	psi-mi:“MI:0914”(association)	0.350

BioGRID (5): TBC1D28 (Proximity Label-MS), TBC1D28 (Proximity Label-MS), DUPD1 (Affinity Capture-MS), CAPS (Affinity Capture-MS), KCNIP1 (Affinity Capture-MS)

ESM2 similar proteins: A0A087WVF3, A0A087WXS9, A0A087X179, A0A087X1G2, A0JN92, A6H5X4, A6NDS4, A6NER0, A6NNV3, B9A6J9, C9J202, D4A693, F6QZ15, P0C5K3, P0C5K4, P0C5K5, P0C7X1, P0C7X4, P0DV79, P18063, P35125, P83946, Q03385, Q03386, Q12967, Q2M2D7, Q3U827, Q3UX83, Q52LC2, Q58DE2, Q5I0E2, Q5I0J8, Q5NCI0, Q5RFJ8, Q5TG30, Q6DHY5, Q6IPX1, Q86UD7, Q8BVM9, Q8C262

Diamond homologs: A0A087WVF3, A0A087WXS9, A0A087X179, A0A087X1G2, A2AWA9, A6H6A9, A6NDS4, A6NER0, B9A6J9, H2KZZ6, P0C7X1, P35125, Q2M2D7, Q5RAN1, Q5SVR0, Q66K14, Q6DHY5, Q6IPX1, Q80XC3, Q86UD7, Q8IZP1, Q92738, Q9UFV1, Q9Y3P9, O95759, Q5R372, Q5RCW6, Q5ZJ17, Q8BHL3, Q9Y7J5, A0JM59, A5PMR2, A5PN09, A6NNY8, A6QNM7, A6QR55, A6ZY34, A7TGY3, A7Z056, A8HAL1

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

37 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	34
Likely benign	2
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1581 predictions. Top by Δscore:

Variant	Effect	Δscore
17:18637862:A:AC	donor_gain	1.0000
17:18637863:C:CC	donor_gain	1.0000
17:18638418:CAG:C	acceptor_gain	1.0000
17:18639215:C:CC	acceptor_gain	1.0000
17:18641286:A:AC	donor_gain	1.0000
17:18641287:C:CC	donor_gain	1.0000
17:18641290:A:AC	donor_gain	1.0000
17:18637863:CTTGA:C	donor_gain	0.9900
17:18637865:TG:T	donor_gain	0.9900
17:18637971:GACCT:G	acceptor_loss	0.9900
17:18637973:CCTG:C	acceptor_loss	0.9900
17:18637975:T:A	acceptor_loss	0.9900
17:18638421:C:A	acceptor_loss	0.9900
17:18638421:C:CC	acceptor_gain	0.9900
17:18638422:T:C	acceptor_loss	0.9900
17:18639210:TCTCA:T	acceptor_gain	0.9900
17:18639211:CTCA:C	acceptor_gain	0.9900
17:18639211:CTCAC:C	acceptor_gain	0.9900
17:18639212:TCACT:T	acceptor_gain	0.9900
17:18639213:CA:C	acceptor_gain	0.9900
17:18641020:A:AC	donor_gain	0.9900
17:18641021:C:CC	donor_gain	0.9900
17:18641251:C:A	donor_gain	0.9900
17:18641291:G:C	donor_gain	0.9900
17:18636598:C:CC	acceptor_gain	0.9800
17:18637989:A:T	acceptor_gain	0.9800
17:18638306:GACTT:G	donor_loss	0.9800
17:18638307:ACTT:A	donor_loss	0.9800
17:18638308:CTTAC:C	donor_loss	0.9800
17:18638309:TTACC:T	donor_loss	0.9800

AlphaMissense

1378 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
17:18637884:G:C	F159L	0.891
17:18637884:G:T	F159L	0.891
17:18637886:A:G	F159L	0.891
17:18637872:G:C	F163L	0.840
17:18637872:G:T	F163L	0.840
17:18637874:A:G	F163L	0.840
17:18637965:C:A	K132N	0.726
17:18637965:C:G	K132N	0.726
17:18638668:A:G	W78R	0.691
17:18638668:A:T	W78R	0.691
17:18638666:C:A	W78C	0.669
17:18638666:C:G	W78C	0.669
17:18637968:C:A	M131I	0.655
17:18637968:C:G	M131I	0.655
17:18637968:C:T	M131I	0.655
17:18636594:C:A	Q167H	0.632
17:18636594:C:G	Q167H	0.632
17:18636586:A:G	L170S	0.599
17:18638645:C:A	W85C	0.585
17:18638645:C:G	W85C	0.585
17:18638337:C:A	K121N	0.566
17:18638337:C:G	K121N	0.566

dbSNP variants (sampled 300 via entrez): RS1000065631 (17:18642092 G>A), RS1000416866 (17:18642416 C>A), RS1001477783 (17:18640648 C>T), RS1001703409 (17:18634869 C>G), RS1001757140 (17:18634193 TAAAA>T,TAA,TAAA,TAAAAA,TAAAAAA), RS1002309927 (17:18639432 G>A,T), RS1002466540 (17:18645779 C>G,T), RS1003314363 (17:18638157 C>T), RS1003418465 (17:18644870 G>A,C), RS1003775552 (17:18645112 TC>T,TCC), RS1004054832 (17:18639288 G>A,T), RS1004105697 (17:18638908 G>A), RS1005040773 (17:18644062 G>A), RS1005049370 (17:18638064 TGGAAGGAA>T,TGGAA,TGGAAGGAAGGAA,TGGAAGGAAGGAAGGAA,TGGAAGGAAGGAAGGAAGGAA), RS1005103080 (17:18637902 C>A)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

5 total (human), top 5 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Resveratrol	affects cotreatment, decreases expression	1
Benzo(a)pyrene	increases mutagenesis	1
Plant Extracts	affects cotreatment, decreases expression	1
Testosterone	increases expression	1
Valproic Acid	increases methylation	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.