TBX10

Summary

TBX10 (T-box transcription factor 10, HGNC:11593) is a protein-coding gene on chromosome 11q13.2, encoding T-box transcription factor TBX10 (O75333). Probable transcriptional regulator involved in developmental processes.

This gene encodes a member of the T-box family of transcription factors. These transcription factors share a DNA-binding domain called the T-box, and play a role in several developmental processes including early embryonic cell fate and organogenesis. The encoded protein is a member of the T-box 1 subfamily. Mutations in this gene are thought to be a cause of isolated cleft lip with or without cleft palate.

Source: NCBI Gene 347853 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 84 total
• MANE Select transcript: NM_005995

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:11593
Approved symbol	TBX10
Name	T-box transcription factor 10
Location	11q13.2
Locus type	gene with protein product
Status	Approved
Aliases	TBX13
Ensembl gene	ENSG00000167800
Ensembl biotype	protein_coding
OMIM	604648
Entrez	347853

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000335385

RefSeq mRNA: 1 — MANE Select: NM_005995 NM_005995

CCDS: CCDS31621

Canonical transcript exons

ENST00000335385 — 8 exons

Exon	Start	End
ENSE00001117168	67632603	67632670
ENSE00001117174	67632948	67633103
ENSE00001167482	67632318	67632412
ENSE00001339508	67631303	67631894
ENSE00001339525	67634816	67634917
ENSE00001339528	67634996	67635263
ENSE00001339531	67639466	67639763
ENSE00001661658	67634189	67634360

Expression profiles

Bgee: expression breadth broad, 54 present calls, max score 86.50.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.0319 / max 17.2155, expressed in 13 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
120958	0.0148	6
120957	0.0139	5
120956	0.0032	1

Top tissues by expression

253 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	86.50	gold quality
pancreatic ductal cell	CL:0002079	83.52	silver quality
mucosa of transverse colon	UBERON:0004991	82.40	gold quality
tongue squamous epithelium	UBERON:0006919	75.49	gold quality
superficial temporal artery	UBERON:0001614	74.90	gold quality
endometrium epithelium	UBERON:0004811	74.28	gold quality
duodenum	UBERON:0002114	74.03	gold quality
mucosa of sigmoid colon	UBERON:0004993	73.93	gold quality
ileal mucosa	UBERON:0000331	73.45	gold quality
gingival epithelium	UBERON:0001949	73.34	gold quality
colonic mucosa	UBERON:0000317	72.99	gold quality
rectum	UBERON:0001052	72.63	gold quality
jejunal mucosa	UBERON:0000399	71.38	gold quality
small intestine Peyer’s patch	UBERON:0003454	70.64	gold quality
triceps brachii	UBERON:0001509	70.36	gold quality
small intestine	UBERON:0002108	70.02	gold quality
epithelial cell of pancreas	CL:0000083	69.83	gold quality
gluteal muscle	UBERON:0002000	69.57	gold quality
frontal pole	UBERON:0002795	68.53	gold quality
gingiva	UBERON:0001828	67.96	gold quality
paraflocculus	UBERON:0005351	67.17	gold quality
dorsal motor nucleus of vagus nerve	UBERON:0002870	67.03	gold quality
middle frontal gyrus	UBERON:0002702	66.81	gold quality
secondary oocyte	CL:0000655	66.51	gold quality
inferior olivary complex	UBERON:0002127	66.18	gold quality
hair follicle	UBERON:0002073	65.88	gold quality
vastus lateralis	UBERON:0001379	65.87	gold quality
quadriceps femoris	UBERON:0001377	65.78	gold quality
transverse colon	UBERON:0001157	65.73	gold quality
endothelial cell	CL:0000115	65.09	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.49

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

6 targets.

Target	Regulation
MRGPRF
PAM
PAX1
TNFRSF6B
TP53
VCAM1

miRNA regulators (miRDB)

17 targeting TBX10, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4731-5P	99.89	67.23	2537
HSA-MIR-6794-5P	99.76	66.38	1048
HSA-MIR-4524A-3P	99.72	66.85	2406
HSA-MIR-4716-3P	99.69	66.73	1022
HSA-MIR-3202	99.66	67.70	2737
HSA-MIR-1207-5P	99.49	69.11	2983
HSA-MIR-6731-5P	99.28	67.42	2375
HSA-MIR-8085	99.28	67.56	2362
HSA-MIR-4763-3P	99.10	67.83	2649
HSA-MIR-887-5P	98.82	65.90	1347
HSA-MIR-30C-1-3P	97.80	66.36	1499
HSA-MIR-30C-2-3P	97.80	66.45	1499
HSA-MIR-6788-5P	97.80	66.41	1532
HSA-MIR-3616-3P	96.96	65.45	983
HSA-MIR-7973	96.48	65.54	502
HSA-MIR-4278	95.28	65.49	351
HSA-MIR-6798-3P	94.55	68.78	325

Cross-species orthologs

11 orthologs

Organism	Symbol	Gene ID
drosophila_melanogaster	H15	FBGN0016660
drosophila_melanogaster	mid	FBGN0261963
drosophila_melanogaster	ocm	FBGN0266083
caenorhabditis_elegans		WBGENE00003106
caenorhabditis_elegans		WBGENE00004750
caenorhabditis_elegans		WBGENE00006545
caenorhabditis_elegans		WBGENE00006546
caenorhabditis_elegans		WBGENE00006556
caenorhabditis_elegans		WBGENE00006557
caenorhabditis_elegans		WBGENE00006559
caenorhabditis_elegans		WBGENE00044798

Paralogs (16): TBX21 (ENSG00000073861), TBX5 (ENSG00000089225), TBX15 (ENSG00000092607), TBX18 (ENSG00000112837), TBX2 (ENSG00000121068), TBX4 (ENSG00000121075), TBX22 (ENSG00000122145), TBX3 (ENSG00000135111), TBR1 (ENSG00000136535), TBX19 (ENSG00000143178), TBX6 (ENSG00000149922), EOMES (ENSG00000163508), TBXT (ENSG00000164458), TBX20 (ENSG00000164532), MGA (ENSG00000174197), TBX1 (ENSG00000184058)

Protein

Protein identifiers

T-box transcription factor TBX10 — O75333 (reviewed: O75333)

All UniProt accessions (1): O75333

UniProt curated annotations — full annotation on UniProt →

Function. Probable transcriptional regulator involved in developmental processes.

Subcellular location. Nucleus.

RefSeq proteins (1): NP_005986* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001699	TF_T-box	Family
IPR008967	p53-like_TF_DNA-bd_sf	Homologous_superfamily
IPR018186	TF_T-box_CS	Conserved_site
IPR036960	T-box_sf	Homologous_superfamily
IPR046360	T-box_DNA-bd	Domain

Pfam: PF00907

UniProt features (8 total): sequence conflict 3, sequence variant 2, chain 1, DNA-binding region 1, region of interest 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O75333-F1	69.66	0.45

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 28 (showing top): MYOGENIN_Q6, SABATES_COLORECTAL_ADENOMA_SIZE_DN, chr11q13, NIKOLSKY_BREAST_CANCER_11Q12_Q14_AMPLICON, GOBP_CELL_FATE_SPECIFICATION, GOBP_CELL_FATE_COMMITMENT, GOMF_SEQUENCE_SPECIFIC_DNA_BINDING, GOMF_TRANSCRIPTION_REGULATOR_ACTIVITY, NFKBIA_TARGET_GENES, ZNF592_TARGET_GENES, MIR4731_5P, MIR4524A_3P, MIR6798_3P, MIR4278, GAO_LARGE_INTESTINE_ADULT_CF_GOBLET_CELL_SUBTYPE_1

GO Biological Process (5): cell fate specification (GO:0001708), regulation of transcription by RNA polymerase II (GO:0006357), anatomical structure morphogenesis (GO:0009653), positive regulation of DNA-templated transcription (GO:0045893), regulation of DNA-templated transcription (GO:0006355)

GO Molecular Function (4): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), DNA binding (GO:0003677), DNA-binding transcription factor activity (GO:0003700)

GO Cellular Component (2): chromatin (GO:0000785), nucleus (GO:0005634)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
regulation of DNA-templated transcription	3
DNA-templated transcription	2
RNA polymerase II transcription regulatory region sequence-specific DNA binding	2
cell fate commitment	1
cellular developmental process	1
transcription by RNA polymerase II	1
developmental process	1
anatomical structure development	1
positive regulation of RNA biosynthetic process	1
regulation of gene expression	1
regulation of RNA biosynthetic process	1
cis-regulatory region sequence-specific DNA binding	1
chromatin	1
DNA-binding transcription factor activity	1
regulation of transcription by RNA polymerase II	1
nucleic acid binding	1
transcription cis-regulatory region binding	1
transcription regulator activity	1
chromosome	1
cellular anatomical structure	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

434 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TBX10	FOXE1	O00358	659
TBX10	SATB2	Q9UPW6	649
TBX10	IRF6	O14896	646
TBX10	MSX2	P35548	589
TBX10	MSX1	P28360	575
TBX10	SPRY2	O43597	547
TBX10	GABRB3	P28472	518
TBX10	GLI2	P10070	514
TBX10	MAFB	Q9Y5Q3	498
TBX10	ZNF202	O95125	495
TBX10	JAG2	Q9Y219	494
TBX10	ADTRP	Q96IZ2	493
TBX10	STK32B	Q9NY57	493
TBX10	ABCA4	P78363	492
TBX10	TRMO	Q9BU70	491

IntAct

0 interactions, top by confidence:

BioGRID (1): TBX10 (Reconstituted Complex)

ESM2 similar proteins: A1YF56, A2AEV7, A6NCS4, A7Y7W2, D3ZJK7, E1BEA8, F1MUS9, O15534, O35973, O43435, O43638, O60248, O75333, O77728, O94983, O95935, O95947, P22736, P46099, P51666, P56261, P57082, P70325, P70327, Q03484, Q0V8F0, Q15744, Q497V6, Q5DTT2, Q61660, Q61663, Q63HR2, Q64731, Q66JL1, Q6PZD9, Q6ZQN5, Q80Y50, Q810F8, Q861Q9, Q8AV66

Diamond homologs: A1YF56, A2AWL7, D3ZJK7, E1BEA8, O01409, O13161, O15119, O15178, O17212, O43435, O54839, O60806, O70306, O73718, O75333, O95935, O95936, O95947, P20293, P24781, P55965, P56158, P57082, P70323, P70324, P70325, P70326, P70327, P79742, P79777, P79778, P79779, P79944, P80492, P87377, P90971, Q07998, Q13207, Q16650, Q17134

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

84 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	63
Likely benign	15
Benign	3

Top pathogenic / likely-pathogenic (0)

SpliceAI

1165 predictions. Top by Δscore:

Variant	Effect	Δscore
11:67632946:AC:A	donor_gain	1.0000
11:67632947:CC:C	donor_gain	1.0000
11:67633099:ATGAT:A	acceptor_gain	1.0000
11:67633100:TGAT:T	acceptor_gain	1.0000
11:67633101:GAT:G	acceptor_gain	1.0000
11:67633102:AT:A	acceptor_gain	1.0000
11:67633102:ATC:A	acceptor_loss	1.0000
11:67633104:C:CC	acceptor_gain	1.0000
11:67633105:T:G	acceptor_loss	1.0000
11:67634187:A:AC	donor_gain	1.0000
11:67634188:C:CC	donor_gain	1.0000
11:67634188:CGTGG:C	donor_gain	1.0000
11:67634361:CTG:C	acceptor_loss	1.0000
11:67632668:GATCT:G	acceptor_loss	0.9900
11:67632670:TC:T	acceptor_loss	0.9900
11:67632671:CTGCA:C	acceptor_loss	0.9900
11:67632939:TTCAC:T	donor_loss	0.9900
11:67632940:TCAC:T	donor_loss	0.9900
11:67632941:CACC:C	donor_loss	0.9900
11:67632942:ACCC:A	donor_loss	0.9900
11:67632943:CCCA:C	donor_loss	0.9900
11:67632944:CCAC:C	donor_loss	0.9900
11:67632945:CACC:C	donor_loss	0.9900
11:67632946:A:C	donor_loss	0.9900
11:67633106:G:C	acceptor_gain	0.9900
11:67633106:G:GC	acceptor_gain	0.9900
11:67633116:C:CT	acceptor_gain	0.9900
11:67634202:T:TA	donor_gain	0.9900
11:67634356:CATAC:C	acceptor_gain	0.9900
11:67634779:TGAG:T	donor_gain	0.9900

AlphaMissense

2497 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
11:67634908:G:C	F95L	1.000
11:67634908:G:T	F95L	1.000
11:67634910:A:G	F95L	1.000
11:67632638:A:C	F246L	0.999
11:67632638:A:T	F246L	0.999
11:67632640:A:G	F246L	0.999
11:67632644:G:C	N244K	0.999
11:67632644:G:T	N244K	0.999
11:67632656:T:A	K240N	0.999
11:67632656:T:G	K240N	0.999
11:67632657:T:A	K240I	0.999
11:67632962:A:G	Y231H	0.999
11:67632978:G:C	F225L	0.999
11:67632978:G:T	F225L	0.999
11:67632979:A:G	F225S	0.999
11:67632980:A:G	F225L	0.999
11:67633069:C:G	R195P	0.999
11:67633096:A:G	L186P	0.999
11:67634213:G:C	N175K	0.999
11:67634213:G:T	N175K	0.999
11:67634217:G:A	T174I	0.999
11:67634257:A:G	W161R	0.999
11:67634257:A:T	W161R	0.999
11:67634338:A:G	W134R	0.999
11:67634338:A:T	W134R	0.999
11:67634909:A:C	F95C	0.999
11:67634996:C:A	R92M	0.999
11:67635011:A:T	V87D	0.999
11:67635017:A:G	M85T	0.999
11:67635037:G:C	F78L	0.999

dbSNP variants (sampled 300 via entrez): RS1000072502 (11:67634329 C>A,G,T), RS1000462975 (11:67641549 C>T), RS1000873272 (11:67638678 G>C), RS1000927932 (11:67643270 T>G), RS1001291572 (11:67637374 C>G), RS1001368173 (11:67638343 A>T), RS1001418309 (11:67641997 G>A), RS1001556307 (11:67631001 A>G,T), RS1001803621 (11:67636995 A>G), RS1002025117 (11:67638958 C>T), RS1002035255 (11:67643607 G>A), RS1002198261 (11:67633859 C>T), RS1002230878 (11:67633986 C>G,T), RS1002264972 (11:67636679 TTAGAGACGGGATTTCACCATGTTGTC>T), RS1002670562 (11:67639148 G>C)

Disease associations

OMIM: gene MIM:604648 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (1): Orofacial clefting syndrome (Orphanet:139039)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST009733_130	Urinary metabolite levels in chronic kidney disease	2.000000e-13
GCST012226_352	Waist circumference adjusted for body mass index	9.000000e-10

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0005116	urinary metabolite measurement
EFO:0007789	BMI-adjusted waist circumference

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

10 total (human), top 10 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
(+)-JQ1 compound	affects expression	1
Atrazine	increases expression	1
Benzo(a)pyrene	affects methylation	1
Tetrachlorodibenzodioxin	increases expression	1
Triclosan	decreases expression	1
Valproic Acid	increases methylation	1
Aflatoxin B1	decreases methylation	1
Okadaic Acid	decreases expression	1
Acrylamide	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.