TCEA2

Summary

TCEA2 (transcription elongation factor A2, HGNC:11614) is a protein-coding gene on chromosome 20q13.33, encoding Transcription elongation factor A protein 2 (Q15560). Necessary for efficient RNA polymerase II transcription elongation past template-encoded arresting sites.

The protein encoded by this gene is found in the nucleus, where it functions as an SII class transcription elongation factor. Elongation factors in this class are responsible for releasing RNA polymerase II ternary complexes from transcriptional arrest at template-encoded arresting sites. The encoded protein has been shown to interact with general transcription factor IIB, a basal transcription factor. Two transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 6919 — RefSeq curated summary.

At a glance

• GWAS associations: 20
• Clinical variants (ClinVar): 49 total
• MANE Select transcript: NM_003195

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:11614
Approved symbol	TCEA2
Name	transcription elongation factor A2
Location	20q13.33
Locus type	gene with protein product
Status	Approved
Aliases	TFIIS
Ensembl gene	ENSG00000171703
Ensembl biotype	protein_coding
OMIM	604784
Entrez	6919

Gene structure

Transcript identifiers

Ensembl transcripts: 23 — 13 protein_coding, 10 protein_coding_CDS_not_defined

ENST00000339217, ENST00000343484, ENST00000361317, ENST00000415602, ENST00000440819, ENST00000458442, ENST00000461072, ENST00000465111, ENST00000465433, ENST00000470559, ENST00000475236, ENST00000475792, ENST00000476113, ENST00000477783, ENST00000487164, ENST00000495168, ENST00000881796, ENST00000881797, ENST00000881798, ENST00000881799, ENST00000935688, ENST00000940921, ENST00000940922

RefSeq mRNA: 2 — MANE Select: NM_003195 NM_003195, NM_198723

CCDS: CCDS13553, CCDS13554

Canonical transcript exons

ENST00000343484 — 10 exons

Exon	Start	End
ENSE00001911934	64063198	64063384
ENSE00003461655	64069765	64069821
ENSE00003474632	64069361	64069491
ENSE00003671415	64066476	64066538
ENSE00003684733	64066915	64067020
ENSE00003690574	64070260	64070414
ENSE00003784477	64068047	64068134
ENSE00003788023	64071870	64071941
ENSE00003791580	64070489	64070635
ENSE00003841448	64072172	64072347

Expression profiles

Bgee: expression breadth ubiquitous, 258 present calls, max score 98.82.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 24.9626 / max 192.5078, expressed in 1801 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
185922	23.6901	1801
185924	0.6331	387
185923	0.2552	118
185925	0.2406	100
185926	0.1435	46

Top tissues by expression

282 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right hemisphere of cerebellum	UBERON:0014890	98.82	gold quality
cerebellar hemisphere	UBERON:0002245	98.67	gold quality
cerebellar cortex	UBERON:0002129	98.56	gold quality
right frontal lobe	UBERON:0002810	98.46	gold quality
left testis	UBERON:0004533	97.95	gold quality
right testis	UBERON:0004534	97.89	gold quality
nucleus accumbens	UBERON:0001882	97.74	gold quality
cerebellum	UBERON:0002037	97.71	gold quality
prefrontal cortex	UBERON:0000451	97.69	gold quality
cingulate cortex	UBERON:0003027	97.55	gold quality
anterior cingulate cortex	UBERON:0009835	97.53	gold quality
adenohypophysis	UBERON:0002196	97.42	gold quality
ventricular zone	UBERON:0003053	97.40	gold quality
amygdala	UBERON:0001876	97.34	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	97.24	gold quality
caudate nucleus	UBERON:0001873	97.23	gold quality
Brodmann (1909) area 9	UBERON:0013540	97.17	gold quality
apex of heart	UBERON:0002098	97.15	gold quality
right uterine tube	UBERON:0001302	97.11	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	96.90	gold quality
putamen	UBERON:0001874	96.64	gold quality
left ovary	UBERON:0002119	96.51	gold quality
sural nerve	UBERON:0015488	96.48	gold quality
right coronary artery	UBERON:0001625	96.40	gold quality
ganglionic eminence	UBERON:0004023	96.40	gold quality
endocervix	UBERON:0000458	96.37	gold quality
right ovary	UBERON:0002118	96.35	gold quality
pituitary gland	UBERON:0000007	96.27	gold quality
neocortex	UBERON:0001950	96.16	gold quality
lower esophagus muscularis layer	UBERON:0035833	96.14	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-GEOD-110499	no	32.80
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

15 targeting TCEA2, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4692	100.00	67.32	2066
HSA-MIR-4514	99.99	67.10	1870
HSA-MIR-494-3P	99.70	71.45	2795
HSA-MIR-940	99.37	66.14	2064
HSA-MIR-6808-5P	99.31	66.23	2150
HSA-MIR-6893-5P	99.31	66.25	2119
HSA-MIR-18A-5P	99.29	71.05	806
HSA-MIR-18B-5P	99.29	71.05	806
HSA-MIR-4735-3P	99.14	69.85	777
HSA-MIR-4436B-3P	98.25	65.26	1494
HSA-MIR-6735-5P	98.24	65.36	1488
HSA-MIR-7843-5P	98.12	65.26	1421
HSA-MIR-4632-5P	97.82	65.38	1470
HSA-MIR-6879-5P	97.77	65.52	1521
HSA-MIR-6734-5P	95.70	65.56	950

Literature-anchored findings (GeneRIF, showing 3)

• RNA polymerase II complexes in the very early phase of transcription are not susceptible to TFIIS-induced exonucleolytic cleavage. (PMID:12034815)
• data suggest that because TFIIS promotes escape from promoter-proximal pauses by stimulating cleavage of back-tracked nascent RNA, TFIIS inhibition may help DSIF/NELF negatively regulate productive transcription (PMID:16214896)
• SII is important for preventing cellular death due to oxidative DNA damage, assisting RNAPII to bypass 8-oxoG (PMID:17374514)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	tcea2	ENSDARG00000012927
mus_musculus	Tcea2	ENSMUSG00000059540
rattus_norvegicus	Tcea2	ENSRNOG00000016288

Paralogs (3): TCEANC (ENSG00000176896), TCEA1 (ENSG00000187735), TCEA3 (ENSG00000204219)

Protein

Protein identifiers

Transcription elongation factor A protein 2 — Q15560 (reviewed: Q15560)

Alternative names: Testis-specific S-II, Transcription elongation factor S-II protein 2, Transcription elongation factor TFIIS.l

All UniProt accessions (5): A0A0A0MT58, Q15560, Q5JRI7, Q5JRI8, Q6IB64

UniProt curated annotations — full annotation on UniProt →

Function. Necessary for efficient RNA polymerase II transcription elongation past template-encoded arresting sites. The arresting sites in DNA have the property of trapping a certain fraction of elongating RNA polymerases that pass through, resulting in locked ternary complexes. Cleavage of the nascent transcript by S-II allows the resumption of elongation from the new 3’-terminus.

Subunit / interactions. Interacts with the basal transcription factor GTF2B. Interacts with REXO1.

Subcellular location. Nucleus.

Tissue specificity. Testis and ovary specific.

Similarity. Belongs to the TFS-II family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q15560-1	1	yes
Q15560-2	2

RefSeq proteins (2): NP_003186, NP_942016 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001222	Znf_TFIIS	Domain
IPR003617	TFIIS/CRSP70_N_sub	Domain
IPR003618	TFIIS_cen_dom	Domain
IPR006289	TFSII	Family
IPR017923	TFIIS_N	Domain
IPR035100	TF_IIS-typ	Family
IPR035441	TFIIS/LEDGF_dom_sf	Homologous_superfamily
IPR036575	TFIIS_cen_dom_sf	Homologous_superfamily

Pfam: PF01096, PF07500, PF08711

UniProt features (27 total): helix 7, binding site 4, domain 2, modified residue 2, sequence conflict 2, turn 2, strand 2, chain 1, cross-link 1, splice variant 1, zinc finger region 1, region of interest 1, compositionally biased region 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
2LW4	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q15560-F1	80.35	0.35

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (4): 261; 264; 289; 292

Post-translational modifications (3): 60, 100, 58

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 141 (showing top): CREL_01, GGGTGGRR_PAX4_03, NFKB_Q6, NFKB_C, HOSHIDA_LIVER_CANCER_SUBCLASS_S3, GGGNNTTTCC_NFKB_Q6_01, ONDER_CDH1_TARGETS_2_UP, LEE_AGING_CEREBELLUM_DN, GOBP_REGULATION_OF_DNA_TEMPLATED_TRANSCRIPTION_ELONGATION, STAT1_01, GOCC_TRANSCRIPTION_ELONGATION_FACTOR_COMPLEX, STAT5A_01, KYNG_DNA_DAMAGE_BY_4NQO_OR_UV, COUP_DR1_Q6, ONDER_CDH1_TARGETS_1_UP

GO Biological Process (6): DNA-templated transcription elongation (GO:0006354), regulation of transcription by RNA polymerase II (GO:0006357), transcription elongation by RNA polymerase II (GO:0006368), regulation of DNA-templated transcription elongation (GO:0032784), DNA-templated transcription (GO:0006351), translational elongation (GO:0006414)

GO Molecular Function (6): DNA binding (GO:0003677), zinc ion binding (GO:0008270), nucleic acid binding (GO:0003676), translation elongation factor activity (GO:0003746), protein binding (GO:0005515), metal ion binding (GO:0046872)

GO Cellular Component (5): nucleus (GO:0005634), nucleoplasm (GO:0005654), centrosome (GO:0005813), transcription elongation factor complex (GO:0008023), ciliary basal body (GO:0036064)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
RNA biosynthetic process	2
regulation of DNA-templated transcription	2
transcription by RNA polymerase II	2
DNA-templated transcription elongation	2
binding	2
microtubule organizing center	2
DNA-templated transcription	1
gene expression	1
translation	1
macromolecule biosynthetic process	1
nucleic acid binding	1
transition metal ion binding	1
translational elongation	1
translation factor activity	1
cation binding	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
cellular anatomical structure	1
centriole	1
nucleoplasm	1
nuclear protein-containing complex	1
cilium	1

Protein interactions and networks

STRING

1778 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TCEA2	GTF2B	Q00403	945
TCEA2	SUPT4H1	P63272	872
TCEA2	SUPT5H	O00267	870
TCEA2	POLR2I	P36954	836
TCEA2	TBP	P20226	809
TCEA2	SUPT6H	Q7KZ85	809
TCEA2	POLR2B	P30876	803
TCEA2	PLAG1	Q6DJT9	765
TCEA2	POLR1H	Q9P1U0	751
TCEA2	POLI	Q9UNA4	733
TCEA2	POLR2A	P24928	725
TCEA2	POLR3K	Q9Y2Y1	723
TCEA2	ELOA2	Q8IYF1	716
TCEA2	LEO1	Q8WVC0	715
TCEA2	IWS1	Q96ST2	703

IntAct

392 interactions, top by confidence:

A	B	Type	Score
TCEA2	TNIP1	psi-mi:“MI:0915”(physical association)	0.830
TRAF2	TCEA2	psi-mi:“MI:0915”(physical association)	0.780
GPKOW	TCEA2	psi-mi:“MI:0915”(physical association)	0.780
TCEA2	GPKOW	psi-mi:“MI:0915”(physical association)	0.780
TCEA2	TRIM27	psi-mi:“MI:0915”(physical association)	0.720
GOLGA2	TCEA2	psi-mi:“MI:0915”(physical association)	0.720
TCEA2	KIAA1958	psi-mi:“MI:0915”(physical association)	0.720
TCEA2	TRIM54	psi-mi:“MI:0915”(physical association)	0.720
THAP1	TCEA2	psi-mi:“MI:0915”(physical association)	0.720
TRIM27	TCEA2	psi-mi:“MI:0915”(physical association)	0.720
KIAA1958	TCEA2	psi-mi:“MI:0915”(physical association)	0.720
MEOX2	TCEA2	psi-mi:“MI:0915”(physical association)	0.560
TCEA2	DAB1	psi-mi:“MI:0915”(physical association)	0.560
TCEA2	ALAS1	psi-mi:“MI:0915”(physical association)	0.560
TCEA2	TCF4	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (178): TCEA2 (Two-hybrid), TCEA2 (Two-hybrid), TCEA2 (Two-hybrid), TCEA2 (Two-hybrid), TCEA2 (Two-hybrid), TCEA2 (Two-hybrid), TCF4 (Two-hybrid), TFCP2 (Two-hybrid), TRAF2 (Two-hybrid), MKRN3 (Two-hybrid), TAX1BP1 (Two-hybrid), TNIP1 (Two-hybrid), MID2 (Two-hybrid), EXOSC8 (Two-hybrid), GPKOW (Two-hybrid)

ESM2 similar proteins: A0A1B0GTH9, A6QQM4, A7SKE9, B4KLC0, B4LRY2, B4Q5Z1, E0X9N4, O60308, P0CR50, P0CR51, P10711, P23193, Q02336, Q09464, Q0VA16, Q15560, Q17CJ5, Q1HE00, Q28CY2, Q29RL9, Q3B7L8, Q3EA33, Q4KLL0, Q4R4J1, Q4V7D7, Q5EB92, Q5RAY5, Q5U2P3, Q5ZM16, Q63799, Q641B2, Q6DJI8, Q6DRC4, Q6GPP0, Q6IDS6, Q6NZZ9, Q6P616, Q7QJV0, Q7ZXB5, Q8BHS3

Diamond homologs: B1ASB6, P10711, P23193, Q148K0, Q15560, Q29RL9, Q4KLL0, Q6ZMY3, Q92576, B0UYI1, F4J4Y5, O75764, P07273, P0C8F5, P0C8F6, P0C8F7, P0C8F8, P20232, P23881, P27948, P49373, P52652, Q04307, Q07271, Q2KI09, Q2M2S7, Q3US16, Q54YG9, Q5UQS8, Q63799, Q6GZP4, Q8C9B9, Q8N8B7, Q90YL3, Q9BTC0, Q9CQZ7, Q9FHK9, Q9GMV6, Q9QVN7, Q9Y2Y1

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

49 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	29
Likely benign	3
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

2363 predictions. Top by Δscore:

Variant	Effect	Δscore
20:64066470:TTCCA:T	acceptor_loss	1.0000
20:64066471:TCCAG:T	acceptor_loss	1.0000
20:64066472:CCAG:C	acceptor_loss	1.0000
20:64066473:CAG:C	acceptor_loss	1.0000
20:64066474:A:AT	acceptor_loss	1.0000
20:64066535:CCAGG:C	donor_loss	1.0000
20:64066536:CAGG:C	donor_loss	1.0000
20:64066538:GGTA:G	donor_loss	1.0000
20:64066539:GTAG:G	donor_loss	1.0000
20:64066540:T:A	donor_loss	1.0000
20:64069359:A:AG	acceptor_gain	1.0000
20:64069360:G:GG	acceptor_gain	1.0000
20:64069487:GGACC:G	donor_gain	1.0000
20:64069488:GACC:G	donor_gain	1.0000
20:64069488:GACCG:G	donor_gain	1.0000
20:64069492:G:GG	donor_gain	1.0000
20:64069496:G:GG	donor_gain	1.0000
20:64070258:A:AG	acceptor_gain	1.0000
20:64070258:AC:A	acceptor_gain	1.0000
20:64070259:C:CA	acceptor_gain	1.0000
20:64070276:T:A	acceptor_gain	1.0000
20:64070412:GAG:G	donor_gain	1.0000
20:64070634:AGGTG:A	donor_loss	1.0000
20:64070635:GGTGA:G	donor_loss	1.0000
20:64070636:GTGAG:G	donor_loss	1.0000
20:64070637:T:A	donor_loss	1.0000
20:64063380:GCGCG:G	donor_gain	0.9900
20:64063486:G:GT	donor_gain	0.9900
20:64063526:G:T	donor_gain	0.9900
20:64066474:A:AG	acceptor_gain	0.9900

AlphaMissense

1963 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
20:64066937:T:A	V53D	1.000
20:64067005:T:A	W76R	1.000
20:64067005:T:C	W76R	1.000
20:64070329:T:C	L196P	0.999
20:64070597:T:C	C261R	0.999
20:64071906:T:C	F286L	0.999
20:64071908:T:A	F286L	0.999
20:64071908:T:G	F286L	0.999
20:64071910:T:A	V287D	0.999
20:64071915:T:A	C289S	0.999
20:64071915:T:C	C289R	0.999
20:64071916:G:A	C289Y	0.999
20:64071916:G:C	C289S	0.999
20:64071917:C:G	C289W	0.999
20:64071936:T:A	W296R	0.999
20:64071936:T:C	W296R	0.999
20:64071938:G:C	W296C	0.999
20:64071938:G:T	W296C	0.999
20:64066504:T:C	L34P	0.998
20:64066928:G:A	G50E	0.998
20:64066985:C:A	A69D	0.998
20:64066994:T:C	L72P	0.998
20:64067007:G:C	W76C	0.998
20:64067007:G:T	W76C	0.998
20:64067010:G:C	K77N	0.998
20:64067010:G:T	K77N	0.998
20:64070317:G:C	R192P	0.998
20:64070496:C:A	A227D	0.998
20:64070520:G:C	R235P	0.998
20:64070540:G:C	A242P	0.998

dbSNP variants (sampled 300 via entrez): RS1000068550 (20:64062120 G>A,T), RS1000257777 (20:64071679 C>T), RS1000564790 (20:64056149 G>A), RS1000629487 (20:64062780 CGGCCTTCTAGGCCAAGTGGGGCGCGCGCAG>C), RS1000669068 (20:64060704 A>G), RS1000712814 (20:64071408 C>T), RS1000776530 (20:64065733 G>T), RS1001040310 (20:64066415 G>A,T), RS1001123934 (20:64060437 C>A), RS1001212565 (20:64056526 G>C,T), RS1001493748 (20:64070836 T>C,G), RS1001649322 (20:64057050 C>G), RS1001841577 (20:64060400 G>A,C), RS1001893614 (20:64060256 C>G), RS1001914969 (20:64065581 G>A)

Disease associations

OMIM: gene MIM:604784 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

20 associations (top):

Study	Trait	p-value
GCST002707_16	Serum thyroid-stimulating hormone levels	4.000000e-06
GCST007001_16	Cerebrospinal AB1-42 levels in normal cognition	3.000000e-07
GCST007096_122	Pulse pressure	3.000000e-07
GCST007099_192	Systolic blood pressure	1.000000e-09
GCST007269_143	Pulse pressure	4.000000e-18
GCST007324_27	Adventurousness	3.000000e-08
GCST009152_9	Triglyceride levels	1.000000e-18
GCST009380_10	Type 2 diabetes (adjusted for BMI)	2.000000e-08
GCST009837_5	Anxiety	3.000000e-08
GCST010204_37	Low density lipoprotein cholesterol levels	1.000000e-08
GCST010988_331	Adult body size	7.000000e-10
GCST90002381_255	Eosinophil count	2.000000e-09
GCST90013663_8	Alanine aminotransferase levels	2.000000e-09
GCST90013664_34	Aspartate aminotransferase levels	4.000000e-09
GCST90020025_1763	Waist-to-hip ratio adjusted for BMI	6.000000e-10
GCST90020025_1764	Waist-to-hip ratio adjusted for BMI	2.000000e-08
GCST90020025_1766	Waist-to-hip ratio adjusted for BMI	3.000000e-08
GCST90020026_201	Hip index	3.000000e-08
GCST90020027_359	Waist-hip index	6.000000e-10
GCST90020027_360	Waist-hip index	4.000000e-09

EFO canonical traits (11, from GWAS)

EFO ID	Trait name
EFO:0004670	beta-amyloid 1-42 measurement
EFO:0005763	pulse pressure measurement
EFO:0006335	systolic blood pressure
EFO:0008579	risk-taking behaviour
EFO:0004530	triglyceride measurement
EFO:0009863	anxiety measurement
EFO:0004611	low density lipoprotein cholesterol measurement
EFO:0004842	eosinophil count
EFO:0004736	aspartate aminotransferase measurement
EFO:0007788	BMI-adjusted waist-hip ratio
EFO:0008039	BMI-adjusted hip circumference

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

57 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, increases abundance, increases expression	3
bisphenol A	affects cotreatment, increases expression, decreases methylation	2
Decitabine	affects expression, affects cotreatment	2
Arsenic	affects methylation, increases abundance, increases expression	2
Cisplatin	increases expression, affects expression, affects cotreatment	2
Phenylmercuric Acetate	affects cotreatment, decreases expression	2
Valproic Acid	increases expression	2
aristolochic acid I	increases expression	1
afuresertib	increases expression	1
methylmercuric chloride	decreases expression	1
quercitrin	decreases expression	1
2,4,5,2’,4’,5’-hexachlorobiphenyl	affects expression	1
beta-lapachone	increases expression, decreases expression	1
butyraldehyde	decreases expression	1
cupric chloride	decreases expression	1
isobutyl alcohol	decreases expression, increases abundance, affects cotreatment	1
beta-methylcholine	affects expression	1
monomethylarsonous acid	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
obeticholic acid	increases expression	1
oligofectamine	increases expression	1
2-methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazophenyl)amide	decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
jinfukang	affects cotreatment, increases expression	1
Sunitinib	increases expression	1
Vorinostat	affects cotreatment, affects expression	1
Acetaminophen	decreases expression	1
Benzo(a)pyrene	affects methylation, decreases methylation	1
Calcitriol	increases expression	1
Chenodeoxycholic Acid	affects cotreatment, increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.