TDRD9

Summary

TDRD9 (tudor domain containing 9, HGNC:20122) is a protein-coding gene on chromosome 14q32.33, encoding ATP-dependent RNA helicase TDRD9 (Q8NDG6). ATP-binding RNA helicase required during spermatogenesis.

Predicted to enable ATP hydrolysis activity; RNA binding activity; and helicase activity. Involved in spermatogenesis. Located in cytoplasm and nucleus. Implicated in spermatogenic failure 30.

Source: NCBI Gene 122402 — RefSeq curated summary.

At a glance

• Gene–disease (curated): spermatogenic failure 30 (Strong, GenCC) — +1 more curated relationship
• GWAS associations: 6
• Clinical variants (ClinVar): 272 total — 5 pathogenic, 6 likely-pathogenic
• Phenotypes (HPO): 13
• MANE Select transcript: NM_153046

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:20122
Approved symbol	TDRD9
Name	tudor domain containing 9
Location	14q32.33
Locus type	gene with protein product
Status	Approved
Aliases	DKFZp434N0820, FLJ36164, NET54
Ensembl gene	ENSG00000156414
Ensembl biotype	protein_coding
OMIM	617963
Entrez	122402

Gene structure

Transcript identifiers

Ensembl transcripts: 9 — 4 protein_coding, 3 retained_intron, 2 protein_coding_CDS_not_defined

ENST00000409874, ENST00000462273, ENST00000466378, ENST00000481318, ENST00000496087, ENST00000554571, ENST00000557332, ENST00000967811, ENST00000967812

RefSeq mRNA: 1 — MANE Select: NM_153046 NM_153046

CCDS: CCDS9987

Canonical transcript exons

ENST00000409874 — 36 exons

Exon	Start	End
ENSE00001216298	104015981	104016088
ENSE00001216304	104014725	104014841
ENSE00001216312	104008413	104008466
ENSE00001216319	104007160	104007204
ENSE00001216343	104005274	104005405
ENSE00001216345	104004238	104004335
ENSE00001216349	103998624	103998728
ENSE00001216354	103995750	103995807
ENSE00001216358	103994519	103994603
ENSE00001216360	103994332	103994386
ENSE00001216364	103991160	103991224
ENSE00001216367	103986217	103986320
ENSE00001609572	104040196	104040334
ENSE00001661544	103966709	103966831
ENSE00001668459	104032017	104032087
ENSE00001678412	104034960	104035056
ENSE00001685628	104018092	104018192
ENSE00001697359	103970541	103970621
ENSE00001719263	104024569	104024680
ENSE00001752047	104031108	104031263
ENSE00001753816	104025564	104025776
ENSE00001758567	104022157	104022330
ENSE00001758623	104026679	104026939
ENSE00001776538	104033960	104034069
ENSE00001796779	104026047	104026136
ENSE00001902125	103928456	103928724
ENSE00001949466	104051981	104052667
ENSE00003503812	103965333	103965554
ENSE00003523711	104006782	104006845
ENSE00003534915	103955664	103955770
ENSE00003588020	104006389	104006554
ENSE00003656182	104006646	104006709
ENSE00003694590	103963079	103963176
ENSE00003713340	104042069	104042187
ENSE00003723949	104049608	104049680
ENSE00003725027	103975389	103975553

Expression profiles

Bgee: expression breadth ubiquitous, 188 present calls, max score 95.02.

FANTOM5 (CAGE): breadth broad, TPM avg 1.1131 / max 116.7442, expressed in 225 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
141775	0.5435	162
141785	0.3477	68
141784	0.0966	37
141787	0.0580	13
141774	0.0484	17
141786	0.0188	15

Top tissues by expression

247 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right testis	UBERON:0004534	95.02	gold quality
left testis	UBERON:0004533	94.37	gold quality
testis	UBERON:0000473	93.13	gold quality
left lobe of thyroid gland	UBERON:0001120	93.13	gold quality
right lobe of thyroid gland	UBERON:0001119	93.02	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	92.55	gold quality
thyroid gland	UBERON:0002046	92.33	gold quality
adenohypophysis	UBERON:0002196	91.70	gold quality
pituitary gland	UBERON:0000007	90.76	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	90.73	gold quality
sperm	CL:0000019	89.92	gold quality
nucleus accumbens	UBERON:0001882	86.99	gold quality
secondary oocyte	CL:0000655	86.44	gold quality
monocyte	CL:0000576	83.65	gold quality
leukocyte	CL:0000738	82.81	gold quality
Ammon’s horn	UBERON:0001954	80.93	gold quality
endothelial cell	CL:0000115	80.51	gold quality
anterior cingulate cortex	UBERON:0009835	80.26	gold quality
right atrium auricular region	UBERON:0006631	80.00	gold quality
caudate nucleus	UBERON:0001873	79.49	gold quality
putamen	UBERON:0001874	79.47	gold quality
Brodmann (1909) area 9	UBERON:0013540	78.95	gold quality
cardiac atrium	UBERON:0002081	78.27	gold quality
oocyte	CL:0000023	77.87	gold quality
forebrain	UBERON:0001890	76.64	gold quality
pigmented layer of retina	UBERON:0001782	76.56	gold quality
tibia	UBERON:0000979	76.25	gold quality
Brodmann (1909) area 23	UBERON:0013554	76.17	gold quality
adult organism	UBERON:0007023	76.16	gold quality
corpus epididymis	UBERON:0004359	76.09	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	5.93

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

27 targeting TDRD9, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4455	100.00	65.48	1587
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-302C-5P	99.97	72.56	3642
HSA-MIR-6508-5P	99.92	70.67	2465
HSA-MIR-589-3P	99.91	69.62	2088
HSA-MIR-3140-3P	99.88	68.47	2069
HSA-MIR-8067	99.86	69.59	2260
HSA-MIR-374C-5P	99.80	72.06	2910
HSA-MIR-655-3P	99.80	72.19	2909
HSA-MIR-4446-5P	99.72	69.19	2544
HSA-MIR-651-5P	99.64	68.49	1104
HSA-MIR-1260A	99.61	66.67	1098
HSA-MIR-1260B	99.61	66.67	1098
HSA-MIR-186-3P	99.51	66.24	1685
HSA-MIR-155-5P	99.35	70.16	1509
HSA-MIR-4652-3P	99.33	70.02	2742
HSA-MIR-6734-3P	99.15	66.27	1627
HSA-MIR-10524-5P	99.05	66.08	963
HSA-MIR-8066	99.05	68.66	1532
HSA-MIR-194-5P	99.01	69.65	1465
HSA-MIR-5701	98.97	69.54	1502
HSA-MIR-606	98.72	67.34	960
HSA-MIR-216B-5P	97.16	66.76	1126
HSA-MIR-301A-5P	96.88	68.07	931
HSA-MIR-301B-5P	96.88	67.75	946
HSA-MIR-500B-3P	96.49	65.40	1087

Literature-anchored findings (GeneRIF, showing 3)

• first report of a recessive deleterious mutation in TDRD9 in humans; study demonstrates that non-obstructive azoospermia can be caused by a mutation in TDRD9 (PMID:28536242)
• Mutational alterations of TDRD 1, 4 and 9 genes in colorectal cancers. (PMID:32036563)
• Here we evaluate gene and protein expression levels of four key TDRDs (TDRD1, TDRD5, TDRD9 and TDRD12) in testicular biopsy samples obtained from men with obstructive azoospermia (OA, n = 29), as controls, and various types of non-obstructive azoospermia containing hypospermatogenesis (HP, 28), maturation arrest (MA, n = 30), and Sertoli cell-only syndrome (SCOS, n = 32) as cases. (PMID:32059713)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	tdrd9	ENSDARG00000013453
mus_musculus	Tdrd9	ENSMUSG00000054003
rattus_norvegicus	Tdrd9	ENSRNOG00000053631
drosophila_melanogaster	spn-E	FBGN0003483

Paralogs (18): DHX33 (ENSG00000005100), YTHDC2 (ENSG00000047188), DHX29 (ENSG00000067248), DHX8 (ENSG00000067596), DHX32 (ENSG00000089876), DHX35 (ENSG00000101452), DHX40 (ENSG00000108406), DHX15 (ENSG00000109606), HELB (ENSG00000127311), DHX30 (ENSG00000132153), DHX34 (ENSG00000134815), DHX9 (ENSG00000135829), DHX38 (ENSG00000140829), DQX1 (ENSG00000144045), DHX37 (ENSG00000150990), DHX57 (ENSG00000163214), DHX36 (ENSG00000174953), DHX16 (ENSG00000204560)

Protein

Protein identifiers

ATP-dependent RNA helicase TDRD9 — Q8NDG6 (reviewed: Q8NDG6)

Alternative names: Tudor domain-containing protein 9

All UniProt accessions (2): Q8NDG6, H0YJJ2

UniProt curated annotations — full annotation on UniProt →

Function. ATP-binding RNA helicase required during spermatogenesis. Required to repress transposable elements and prevent their mobilization, which is essential for the germline integrity. Acts via the piRNA metabolic process, which mediates the repression of transposable elements during meiosis by forming complexes composed of piRNAs and Piwi proteins and governs the methylation and subsequent repression of transposons. Acts downstream of piRNA biogenesis: exclusively required for transposon silencing in the nucleus, suggesting that it acts as a nuclear effector in the nucleus together with PIWIL4.

Subunit / interactions. Interacts with piRNA-associated proteins PIWIL1 and PIWIL4.

Subcellular location. Cytoplasm. Nucleus.

Disease relevance. Spermatogenic failure 30 (SPGF30) [MIM:618110] An autosomal recessive infertility disorder caused by spermatogenesis defects that result in non-obstructive azoospermia or cryptozoospermia. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the DEAD box helicase family. DEAH subfamily.

Isoforms (2)

UniProt ID	Names	Canonical?
Q8NDG6-1	1	yes
Q8NDG6-2	2

RefSeq proteins (1): NP_694591* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001650	Helicase_C-like	Domain
IPR002999	Tudor	Domain
IPR007502	Helicase-assoc_dom	Domain
IPR011545	DEAD/DEAH_box_helicase_dom	Domain
IPR014001	Helicase_ATP-bd	Domain
IPR027417	P-loop_NTPase	Homologous_superfamily
IPR035437	SNase_OB-fold_sf	Homologous_superfamily
IPR047384	Tudor_TDRD9	Domain

Pfam: PF00270, PF00271, PF00567, PF21010

Catalyzed reactions (Rhea), 1 shown:

• ATP + H2O = ADP + phosphate + H(+) (RHEA:13065)

UniProt features (12 total): domain 3, sequence conflict 3, chain 1, region of interest 1, short sequence motif 1, compositionally biased region 1, binding site 1, splice variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8NDG6-F1	80.45	0.32

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (1): 155–162

Function

Pathways and Gene Ontology

Reactome pathways

3 pathways

ID	Pathway
R-HSA-5601884	PIWI-interacting RNA (piRNA) biogenesis
R-HSA-211000	Gene Silencing by RNA
R-HSA-74160	Gene expression (Transcription)

MSigDB gene sets: 119 (showing top): GOBP_MALE_GAMETE_GENERATION, YOKOE_CANCER_TESTIS_ANTIGENS, GOBP_NEGATIVE_REGULATION_OF_GENE_EXPRESSION_EPIGENETIC, GOBP_DNA_METHYLATION_DEPENDENT_CONSTITUTIVE_HETEROCHROMATIN_FORMATION, GOBP_ORGANELLE_FISSION, TAKEDA_TARGETS_OF_NUP98_HOXA9_FUSION_10D_UP, GOBP_MALE_MEIOSIS_I, GOBP_PIRNA_PROCESSING, GOBP_DEVELOPMENTAL_PROCESS_INVOLVED_IN_REPRODUCTION, GOBP_MEIOTIC_CELL_CYCLE_PROCESS, GOBP_FERTILIZATION, TAKEDA_TARGETS_OF_NUP98_HOXA9_FUSION_16D_UP, GOBP_CHROMATIN_REMODELING, GOBP_HETEROCHROMATIN_ORGANIZATION, ACEVEDO_METHYLATED_IN_LIVER_CANCER_DN

GO Biological Process (11): male meiotic nuclear division (GO:0007140), male meiosis I (GO:0007141), spermatogenesis (GO:0007283), fertilization (GO:0009566), cell differentiation (GO:0030154), piRNA processing (GO:0034587), transposable element silencing by piRNA-mediated heterochromatin formation (GO:0141006), transposable element silencing by piRNA-mediated DNA methylation (GO:0141196), transposable element silencing (GO:0010526), regulatory ncRNA-mediated gene silencing (GO:0031047), meiotic cell cycle (GO:0051321)

GO Molecular Function (8): RNA binding (GO:0003723), RNA helicase activity (GO:0003724), helicase activity (GO:0004386), ATP binding (GO:0005524), ATP hydrolysis activity (GO:0016887), nucleotide binding (GO:0000166), nucleic acid binding (GO:0003676), hydrolase activity (GO:0016787)

GO Cellular Component (3): nucleus (GO:0005634), cytoplasm (GO:0005737), piP-body (GO:0071547)

Reactome top-level categories

Rollup of top-2 pathways:

Category	Pathways
Gene Silencing by RNA	1
Gene expression (Transcription)	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
male gamete generation	3
meiotic cell cycle	2
meiotic nuclear division	2
sexual reproduction	2
reproductive process	2
transposable element silencing by heterochromatin formation	2
negative regulation of gene expression	2
ATP-dependent activity	2
meiosis I	1
male meiotic nuclear division	1
developmental process involved in reproduction	1
cellular developmental process	1
regulatory ncRNA processing	1
piRNA-mediated heterochromatin formation	1
gene silencing by piRNA-directed DNA methylation	1
retrotransposition	1
cell cycle	1
nucleic acid binding	1
helicase activity	1
ATP-dependent activity, acting on RNA	1
catalytic activity, acting on RNA	1
nucleic acid conformation isomerase activity	1
catalytic activity, acting on a nucleic acid	1
adenyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
ribonucleoside triphosphate phosphatase activity	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
binding	1
catalytic activity	1
intracellular membrane-bounded organelle	1
intracellular anatomical structure	1
cellular anatomical structure	1
P granule	1

Protein interactions and networks

STRING

2000 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TDRD9	PIWIL4	Q7Z3Z4	972
TDRD9	PIWIL2	Q8TC59	909
TDRD9	PIWIL1	Q96J94	907
TDRD9	MAEL	Q96JY0	851
TDRD9	TDRD5	Q8NAT2	847
TDRD9	PLD6	Q8N2A8	807
TDRD9	MOV10L1	Q9BXT6	775
TDRD9	TDRD7	Q8NHU6	775
TDRD9	TDRD1	Q9BXT4	742
TDRD9	STK31	Q9BXU1	726
TDRD9	TDRD12	Q587J7	700
TDRD9	TDRD6	O60522	673
TDRD9	HENMT1	Q5T8I9	668
TDRD9	ASZ1	Q8WWH4	666
TDRD9	GTSF1	Q8WW33	662

IntAct

4 interactions, top by confidence:

A	B	Type	Score
CLOCK	BMAL1	psi-mi:“MI:0914”(association)	0.880
TDRD9	SEMA4B	psi-mi:“MI:0915”(physical association)	0.400
DNAJC7	HSPA8	psi-mi:“MI:0914”(association)	0.350

BioGRID (11): TDRD9 (Affinity Capture-MS), TDRD9 (Affinity Capture-RNA), TDRD9 (Affinity Capture-RNA), SEMA4B (Affinity Capture-MS), TDRD9 (Affinity Capture-MS), CLK1 (Two-hybrid), Sf3b2 (Two-hybrid), TDRD9 (Affinity Capture-MS), TDRD9 (Protein-RNA), TDRD9 (Affinity Capture-MS), TDRD9 (Affinity Capture-MS)

ESM2 similar proteins: A0A0G2K344, D3ZGS3, F1M386, F1MSG6, F1PBJ0, G5EF51, O00329, O02697, O35242, O35904, O70481, O88763, O94830, P32871, P42336, P42337, P42338, P42339, P42347, P42348, P48736, P50520, P54676, P70600, Q01968, Q14289, Q14BI7, Q16JS8, Q3MHU3, Q3UYK3, Q4KWH5, Q4KWH8, Q5D891, Q5ZI89, Q6AZN6, Q6GQ76, Q6NVF0, Q6PF93, Q7Z392, Q80Y98

Diamond homologs: A3KMI0, B0XDC4, B2RR83, B3M383, B3P3W1, B4GEU5, B4HLH4, B4JT42, B4K5R2, B4LX81, B4NBB0, B4PRJ9, B8A4F4, D4A2Z8, F4HYJ7, F4I9Q5, F4IDQ6, F4IJV4, F4ILR7, F4IM84, F4INY4, F4JMJ3, F4KGU4, O17438, O22243, O22899, O35286, O42643, O42945, O43143, O45244, O60114, O60231, O70133, O94536, P0C7L7, P24785, P34498, P36009, P43329

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

272 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	5
Likely pathogenic	6
Uncertain significance	202
Likely benign	24
Benign	11

Top pathogenic / likely-pathogenic (11)

Variant ID	HGVS	Classification
1328950	NM_153046.3(TDRD9):c.3483_3484dup (p.Ser1162fs)	Pathogenic
2054504	NM_153046.3(TDRD9):c.775C>T (p.Arg259Ter)	Pathogenic
2069250	NM_153046.3(TDRD9):c.3604del (p.Ser1202fs)	Pathogenic
2071661	NM_153046.3(TDRD9):c.2772_2773del (p.Glu924fs)	Pathogenic
560416	NM_153046.3(TDRD9):c.720_723del (p.Ser241fs)	Pathogenic
3024499	NM_153046.3(TDRD9):c.3148dup (p.Val1050fs)	Likely pathogenic
3024500	NM_153046.3(TDRD9):c.3716+3A>G	Likely pathogenic
3235186	NM_153046.3(TDRD9):c.2031_2032del (p.Glu679fs)	Likely pathogenic
3892622	NM_153046.3(TDRD9):c.1518C>G (p.Tyr506Ter)	Likely pathogenic
3892623	NM_153046.3(TDRD9):c.2314_2317del (p.Pro772fs)	Likely pathogenic
4845720	NM_153046.3(TDRD9):c.1495C>T (p.Arg499Ter)	Likely pathogenic

SpliceAI

6074 predictions. Top by Δscore:

Variant	Effect	Δscore
14:103928721:AAAGG:A	donor_loss	1.0000
14:103928726:T:A	donor_loss	1.0000
14:103941099:GAAAT:G	acceptor_gain	1.0000
14:103941101:AAT:A	acceptor_gain	1.0000
14:103941102:AT:A	acceptor_gain	1.0000
14:103941102:ATCTA:A	acceptor_loss	1.0000
14:103941104:C:CC	acceptor_gain	1.0000
14:103942087:CTTA:C	donor_loss	1.0000
14:103942088:TTACC:T	donor_loss	1.0000
14:103942089:TA:T	donor_loss	1.0000
14:103942090:A:AT	donor_loss	1.0000
14:103963171:G:GT	donor_gain	1.0000
14:103965332:GGTT:G	acceptor_gain	1.0000
14:103965487:C:T	donor_gain	1.0000
14:103965510:A:AG	donor_gain	1.0000
14:103965511:G:GG	donor_gain	1.0000
14:103966701:A:AG	acceptor_gain	1.0000
14:103966702:A:G	acceptor_gain	1.0000
14:103966705:TTA:T	acceptor_loss	1.0000
14:103966707:A:AG	acceptor_gain	1.0000
14:103966707:AG:A	acceptor_gain	1.0000
14:103966707:AGGT:A	acceptor_loss	1.0000
14:103966708:G:A	acceptor_loss	1.0000
14:103966708:G:GG	acceptor_gain	1.0000
14:103966708:GG:G	acceptor_gain	1.0000
14:103966708:GGT:G	acceptor_gain	1.0000
14:103966708:GGTA:G	acceptor_gain	1.0000
14:103966827:ATGAA:A	donor_gain	1.0000
14:103966828:TGAA:T	donor_gain	1.0000
14:103966829:GAA:G	donor_gain	1.0000

AlphaMissense

9111 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
14:103998724:A:C	R493S	0.998
14:103998724:A:T	R493S	0.998
14:103965396:A:C	S162R	0.997
14:103965398:C:A	S162R	0.997
14:103965398:C:G	S162R	0.997
14:103965499:C:A	A196D	0.997
14:103991215:T:C	F391L	0.997
14:103991217:T:A	F391L	0.997
14:103991217:T:G	F391L	0.997
14:103998723:G:C	R493T	0.997
14:103994536:T:C	L418P	0.996
14:103995777:A:C	S450R	0.996
14:103995779:T:A	S450R	0.996
14:103995779:T:G	S450R	0.996
14:103995790:T:A	V454D	0.996
14:104004241:G:C	R496P	0.996
14:104004274:G:C	R507P	0.996
14:103966827:A:T	D254V	0.995
14:103970593:T:C	L273P	0.995
14:103995757:T:C	L443P	0.995
14:103998624:T:A	V460D	0.995
14:103998695:T:A	W484R	0.995
14:103998695:T:C	W484R	0.995
14:104004240:C:A	R496S	0.995
14:103965391:G:A	G160D	0.994
14:103965475:G:C	R188P	0.994
14:103966827:A:C	D254A	0.994
14:103994600:A:C	R439S	0.994
14:103994600:A:T	R439S	0.994
14:103995757:T:A	L443Q	0.994

dbSNP variants (sampled 300 via entrez): RS1000010159 (14:103975094 T>A), RS1000027034 (14:104037924 A>G), RS1000038598 (14:103994784 A>G), RS1000094455 (14:104007424 A>T), RS1000122949 (14:104039997 C>T), RS1000130294 (14:103953391 G>A), RS1000139025 (14:104001990 C>A,T), RS1000197731 (14:103955033 C>T), RS1000199450 (14:104027272 ACTCCTGGGCTTAAGGGATC>A), RS1000209818 (14:104050017 G>T), RS1000222341 (14:104042261 G>C), RS1000239509 (14:104049678 C>T), RS1000239944 (14:104001633 G>A), RS1000251813 (14:103970178 A>C,G), RS1000253958 (14:104007468 G>T)

Disease associations

OMIM: gene MIM:617963 | disease phenotypes: MIM:618110

GenCC curated gene-disease

Disease	Classification	Inheritance
spermatogenic failure 30	Strong	Autosomal recessive
male infertility with azoospermia or oligozoospermia due to single gene mutation	Supportive	Autosomal dominant

Mondo (4): spermatogenic failure 30 (MONDO:0020851), azoospermia (MONDO:0100459), male infertility (MONDO:0005372), (MONDO:0018393)

Orphanet (0):

HPO phenotypes

13 total (13 of 13 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000027	Azoospermia
HP:0000028	Cryptorchidism
HP:0000118	Phenotypic abnormality
HP:0000837	Increased circulating gonadotropin level
HP:0003251	Male infertility
HP:0008669	Abnormal spermatogenesis
HP:0008734	Decreased testicular size
HP:0011462	Young adult onset
HP:0011961	Non-obstructive azoospermia
HP:0011962	Obstructive azoospermia
HP:0030974	Cryptozoospermia
HP:0031038	Spermatogenesis maturation arrest

GWAS associations

6 associations (top):

Study	Trait	p-value
GCST004521_262	Autism spectrum disorder or schizophrenia	6.000000e-09
GCST005951_9	Body mass index	4.000000e-09
GCST006803_15	Schizophrenia	3.000000e-14
GCST007382_6	Plasma free amino acid levels (adjusted for twenty other PFAAs)	2.000000e-08
GCST010002_161	Refractive error	1.000000e-20
GCST010922_9	Hip bone mineral density and total body fat mass (bivariate analysis)	3.000000e-09

EFO canonical traits (4, from GWAS)

EFO ID	Trait name
EFO:0004340	body mass index
EFO:0005134	amino acid measurement
EFO:0009766	asparagine measurement
EFO:0007702	hip bone mineral density

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D053713	Azoospermia	C12.100.500.430.380; C12.100.750.700.380; C12.200.294.430.380
D007248	Infertility, Male	C12.100.500.430; C12.100.750.700; C12.200.294.430

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

22 total (human), top 22 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation, decreases expression, decreases methylation	3
bisphenol A	decreases methylation	1
2,5,2’,5’-tetrachlorobiphenyl	increases expression	1
sodium arsenite	decreases expression	1
benzo(e)pyrene	increases methylation	1
aflatoxin B2	increases methylation	1
S-(1,2-dichlorovinyl)cysteine	affects cotreatment, decreases expression	1
CGP 52608	affects binding, increases reaction	1
abrine	increases expression	1
Arsenic	affects methylation	1
Demecolcine	increases expression	1
Dexamethasone	increases expression	1
Ethyl Methanesulfonate	decreases expression	1
Formaldehyde	increases expression	1
Lipopolysaccharides	affects cotreatment, decreases expression	1
Methapyrilene	increases methylation	1
Methyl Methanesulfonate	decreases expression	1
Phthalic Acids	decreases methylation	1
Silicon Dioxide	increases expression	1
Valproic Acid	increases methylation	1
Vincristine	increases expression	1
Okadaic Acid	increases expression	1

Clinical trials (associated diseases)

150 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT02307994	PHASE4	UNKNOWN	Clinical Research on Effectiveness and Safety of Treatment of Severe Oligospermia or Azoospermia With uFSH
NCT02202382	PHASE4	COMPLETED	Effects of Korean Red Ginseng on Male Infertility
NCT02204826	PHASE4	COMPLETED	Effects of Korean Red Ginseng on Semen Parameters in Male Infertility Patients: a Randomized, Placebo-controlled, Double-blind Clinical Study
NCT03802864	PHASE4	COMPLETED	Post-operative Pain Control of Testicular Sperm Extraction Using Liposomal Bupivacaine
NCT06100432	PHASE4	ACTIVE_NOT_RECRUITING	Effect of Eurycoma Longifolia (DLBS5055) and Multivitamins (Vitamin C+Vitamin E+ β-carotene) for Infertile Males
NCT07523022	PHASE4	ENROLLING_BY_INVITATION	Comparison of the Effect of Gonadotropin and Clomiphene Citrate Treatment on Sperm Parameters and the Outcome of Assisted Reproductive Procedures in Subfertile Men Based on the APHRODITE Groups
NCT02275169	PHASE3	UNKNOWN	FSH Treatment for Non-obstructive Azoospermic Patients
NCT00975117	PHASE3	COMPLETED	Spermotrend in the Treatment of Male Infertility
NCT01407432	PHASE3	COMPLETED	Impact of Folates in the Care of the Male Infertility
NCT01895816	PHASE3	COMPLETED	Herbal Tonic Fertile Supplement(ZO2C5)
NCT02605070	PHASE3	TERMINATED	Pilot Study on the Effects of FSH Treatment on the Epigenetic Characteristics of Spermatozoa in Infertile Patients With Severe Oligozoospermia
NCT07402759	PHASE3	ACTIVE_NOT_RECRUITING	Impact of tdrd9 Gene Mutations in the Therapeutic Response to L-carnitine in Oligoasthenozoospermic Men
NCT02544191	PHASE2	UNKNOWN	GnRHa Combined With hCG and hMG for Treatment of Patients With Non-obstructive Azoospermia
NCT03762967	PHASE2	UNKNOWN	Autologous Adipose-Derived Adult Stromal Vascular Cell Administration for Male Patients With Infertility
NCT01880086	PHASE2	COMPLETED	Clomiphene Citrate for the Treatment of Low Testosterone Associated With Chronic Opioid Pain Medication Administration
NCT02061384	PHASE2	COMPLETED	RA-2 13-cis Retinoic Acid (Isotretinoin)
NCT02421887	PHASE2	COMPLETED	Males, Antioxidants, and Infertility Trial
NCT05200663	PHASE2	UNKNOWN	Efficacy Comparison of Tamoxifen and Tamoxifen With Antioxidants on Semen Quality of Male With Idiopathic Infertility
NCT05290558	PHASE2	ACTIVE_NOT_RECRUITING	The Therapeutic Effects of Bu Shen Yi Jing Pill on Semen Quality in Sub Fertile Males: a Randomized Controlled Trial
NCT06091969	PHASE2	NOT_YET_RECRUITING	Supplementation for Male Subfertility
NCT01595308	PHASE1	COMPLETED	A Pilot Study to Evaluate the Effect of Pomegranate Juice on Semen Parameters in Healthy Male Volunteers
NCT02122211	PHASE1	COMPLETED	Choline Dehydrogenase and Sperm Function: Effects of Betaine
NCT02575924	PHASE1	UNKNOWN	Influence of Culture Media on Clinical Outcomes in Poor Responders or Severe Male Infertility
NCT02041910	PHASE1/PHASE2	UNKNOWN	Testicular Injection of Autologous Stem Cells for Treatment of Patients With Azoospermia
NCT00282477	Not specified	UNKNOWN	Trial to Evaluate Erectile Function, Fertility and Sperm Count in Male Cyclists Compared to Age Matched Controls
NCT00484081	Not specified	COMPLETED	Microdissection Testicular Sperm Extraction (MicroTESE) and IVF-ICSI Outcome in Non-Obstructive Azoospermia (NOA)
NCT00548977	Not specified	COMPLETED	Genetic Studies Spermatogenic Failure
NCT01375062	Not specified	COMPLETED	Obtaining Undifferentiated Cells From Testis Biopsy
NCT01509482	Not specified	COMPLETED	Insulin Resistance in Idiopathic Oligospermia and Azoospermia
NCT02008799	Not specified	UNKNOWN	Intra Testicular Artery Injection of Bone Marrow Stem Cell in Management of Azoospermia
NCT02339272	Not specified	COMPLETED	Study of Synapsis and Recombination in Male Meiosis and the Implications in Infertility
NCT02414295	Not specified	COMPLETED	Sperm Production in Kleinfelter Syndrome Patients After Mesenchymal Stem Cell Injection
NCT02418832	Not specified	RECRUITING	Testis Needle Aspiration of Sperm in Men With Azoospermia
NCT02617173	Not specified	UNKNOWN	The Effect of Low Electrical Current on Testicular Spermatocyte Count
NCT02773498	Not specified	TERMINATED	Comparison of Medical Results of Testicular Sperm Extraction by Conventional Surgery and Microsurgical Track
NCT03497728	Not specified	TERMINATED	Detection of Microdeletions in the Azoospermia Factor (AZF) Regions in Infertile Male Patients
NCT04675164	Not specified	COMPLETED	Laser Assisted Sperm Selection of Viable Immotile Testicular Sperm in Azoospermic Infertile Men
NCT05479474	Not specified	RECRUITING	Platelet Rich Plasma Testis Treatment for Infertile Men
NCT05628987	Not specified	RECRUITING	The Association of Gut Microbiota and Spermatogenic Dysfunction
NCT05866484	Not specified	COMPLETED	Testicular Sperm Aspiration (TESA) vs. Microfluidic Sperm Separation (MSS)