TLX1

Summary

TLX1 (T cell leukemia homeobox 1, HGNC:5056) is a protein-coding gene on chromosome 10q24.31, encoding T-cell leukemia homeobox protein 1 (P31314). Controls the genesis of the spleen.

This gene encodes a nuclear transcription factor that belongs to the NK-linked or NK-like (NKL) subfamily of homeobox genes. The encoded protein is required for normal development of the spleen during embryogenesis. This protein is also involved in specification of neuronal cell fates. Ectopic expression of this gene due to chromosomal translocations is associated with certain T-cell acute lymphoblastic leukemias. Alternate splicing results in multiple transcript variants.

Source: NCBI Gene 3195 — RefSeq curated summary.

At a glance

• GWAS associations: 3
• Clinical variants (ClinVar): 44 total
• Transcription factor: yes — 13 downstream targets (CollecTRI)
• MANE Select transcript: NM_005521

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:5056
Approved symbol	TLX1
Name	T cell leukemia homeobox 1
Location	10q24.31
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000107807
Ensembl biotype	protein_coding
OMIM	186770
Entrez	3195

Gene structure

Transcript identifiers

Ensembl transcripts: 5 — 3 protein_coding, 2 protein_coding_CDS_not_defined

ENST00000370196, ENST00000463716, ENST00000467928, ENST00000525019, ENST00000533319

RefSeq mRNA: 2 — MANE Select: NM_005521 NM_001195517, NM_005521

CCDS: CCDS55725, CCDS7510

Canonical transcript exons

ENST00000370196 — 3 exons

Exon	Start	End
ENSE00000721324	101134175	101134376
ENSE00001452043	101136691	101137789
ENSE00001452047	101131300	101132109

Expression profiles

Bgee: expression breadth broad, 74 present calls, max score 93.45.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.6691 / max 151.0443, expressed in 136 samples.

FANTOM5 promoters (7 alternative TSS)

Promoter ID	TPM avg	Samples expressed
106651	0.3943	95
106652	0.1628	69
106647	0.0596	8
106646	0.0249	7
106650	0.0143	4
106649	0.0106	4
106648	0.0026	1

Top tissues by expression

267 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
spleen	UBERON:0002106	93.45	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	86.24	silver quality
minor salivary gland	UBERON:0001830	80.29	gold quality
saliva-secreting gland	UBERON:0001044	76.57	gold quality
mouth mucosa	UBERON:0003729	75.98	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	72.62	gold quality
middle frontal gyrus	UBERON:0002702	69.62	gold quality
paraflocculus	UBERON:0005351	69.43	gold quality
frontal pole	UBERON:0002795	69.40	gold quality
endometrium epithelium	UBERON:0004811	66.95	gold quality
buccal mucosa cell	CL:0002336	65.85	gold quality
Brodmann (1909) area 10	UBERON:0013541	65.41	gold quality
cerebellar vermis	UBERON:0004720	63.86	gold quality
myocardium	UBERON:0002349	62.91	gold quality
triceps brachii	UBERON:0001509	62.64	gold quality
tendon of biceps brachii	UBERON:0008188	61.70	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	61.53	gold quality
right lobe of liver	UBERON:0001114	61.25	gold quality
vastus lateralis	UBERON:0001379	61.13	gold quality
quadriceps femoris	UBERON:0001377	61.10	gold quality
heart right ventricle	UBERON:0002080	60.69	gold quality
biceps brachii	UBERON:0001507	60.65	gold quality
Brodmann (1909) area 46	UBERON:0006483	60.53	gold quality
gluteal muscle	UBERON:0002000	59.66	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	59.65	gold quality
vena cava	UBERON:0004087	59.51	gold quality
cardiac muscle of right atrium	UBERON:0003379	59.40	gold quality
left ventricle myocardium	UBERON:0006566	59.10	gold quality
trachea	UBERON:0003126	58.73	gold quality
pons	UBERON:0000988	58.37	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	1.25

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

13 targets.

Target	Regulation
ALDH1A1	Unknown
CD44
CHEK1	Repression
FHL1	Unknown
GDNF	Activation
MEIS1
MYC	Activation
NR4A3	Activation
SLU7
TBXT
TLX1	Activation
TSC1
WT1

JASPAR motifs

Motif	Name	Family
MA0119.1	NFIC::TLX1	Nuclear factor 1::NK

JASPAR matrix evidence (PMIDs): PMID:10327073

Upstream regulators (CollecTRI, top): MYC, PBX1, PITX2, PRDM13, PTF1A, RBPJ, TBX1, TLX1

miRNA regulators (miRDB)

51 targeting TLX1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-10401-5P	99.99	65.79	948
HSA-MIR-570-3P	99.96	72.41	4910
HSA-MIR-3119	99.92	71.34	2390
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-3941	99.86	70.54	2735
HSA-MIR-6764-5P	99.75	67.89	2304
HSA-MIR-519A-3P	99.67	71.67	1868
HSA-MIR-519B-3P	99.67	71.67	1868
HSA-MIR-519C-3P	99.67	71.67	1870
HSA-MIR-466	99.67	70.85	2863
HSA-MIR-762	99.58	66.61	1994
HSA-MIR-1915-3P	99.58	66.79	1988
HSA-MIR-516B-5P	99.56	66.33	1495
HSA-MIR-12122	99.56	69.33	1672
HSA-MIR-4649-3P	99.56	66.90	1783
HSA-MIR-4672	99.50	71.58	2893
HSA-MIR-4687-3P	99.48	66.41	968
HSA-MIR-4498	99.47	67.42	2360
HSA-MIR-3911	99.38	66.95	1087
HSA-MIR-4505	99.27	67.81	2678
HSA-MIR-5787	99.22	67.86	2628
HSA-MIR-6852-5P	99.17	66.69	2073
HSA-MIR-5001-5P	99.05	66.76	1972
HSA-MIR-4801	98.96	69.42	2096
HSA-MIR-6829-5P	98.86	65.12	1480
HSA-MIR-4656	98.79	66.22	1306

Literature-anchored findings (GeneRIF, showing 29)

• A PBX2 Regulatory Element PRE-1048 has been identified which contains a novel DNA-binding sequence and mediates significant activation of the HOX11 gene in K562 cells. (PMID:12054735)
• Seven conserved Cdx binding sites were found in the Hoxa 11 promoter, suggesting regulatory sites. (PMID:12180349)
• Hox11 expression is linked to chromosomes 5 and 14 in T-cell malignancies in children. (PMID:14504110)
• HOX11 manifests its regulatory function via its action as a transcription factor (PMID:15384172)
• transcriptional deregulation of G1/S growth-control genes, mediated in large part through blockade of PP1/PP2A phosphatase activity, plays an important role in HOX11 pathobiology (PMID:15897879)
• HOX11 overexpression leads to a heightened predisposition for development of aneuploidy, contributing to oncogenesis (PMID:16407851)
• TLX1/HOX11 overexpression and Ubr1 inactivation in promoting chromosome missegregation, permitting the accrual of additional chromosome losses and cytogenic abnormalities en route to malignancy. (PMID:16862188)
• TLX1-mediated differentiation arrest may be achieved in part through a mechanism that involves redirection of CBP and/or its sequestration in repressive chromatin domains (PMID:17213805)
• TLX1(+) T-cell acute lymphoblastic leukemias be defined as cases expressing TLX1/ABL ratios greater than 1 and/or demonstrating TLX1 rearrangement (PMID:17609427)
• Hox11 is expressed in spleen and may have a role in acute lymphocytic leukemia (PMID:17713543)
• These results characterize TLX1 as a dual function regulator whose activity in respect to FHL1 is critically dependent upon its cellular concentration, as well as cell type and promoter context. (PMID:18073142)
• LMO2, TAL1, Ttg-1, and SIL support levels of V(D)J recombination above background levels in cell culture and are also cleaved by the RAG proteins, while Hox11 and SCL are nicked but not cleaved efficiently in vitro (PMID:18187418)
• Application of expression of HOX 11 allows the prospective evaluation of prognostic effects within pediatric and adult protocols of patients with T cell lymphoblastic lymphoma. (PMID:18245528)
• HOX11/TLX1 stem cells are uniquely and abundantly expressed throughout adulthood in the human spleen. (PMID:18283632)
• Aberrant HOX11 expression is associated with thymic adult T-cell acute lymphoblastic leukemia (PMID:18368072)
• TLX1 interacts with TLE1 via an Eh1-like motif. (PMID:19250647)
• co-operation between TLX1 and MEIS proteins may have a significant role in T-cell leukemogenesis. (PMID:19559479)
• conclude that the TLX1/NOTCH/MYC network is a central determinant promoting the growth and survival of TLX1+ T-ALL cells. In addition, the TLX1/NOTCH/MYC transcriptional network coregulates genes involved in T cell development (PMID:20618946)
• Transgenic expression of human TLX1 in mice induces T cell acute lymphoblastic leukemia with frequent deletions and mutations in Bcl11b. (PMID:20972433)
• Suppression of TLX1 expression slowed the growth of TLX1 tumor cell lines. Suppression of TLX1 in vivo also transiently delayed leukemia progression. (PMID:21326611)
• these results place TLX1 and TLX3 at the top of an oncogenic transcriptional network controlling leukemia development, and identify RUNX1 as a tumor-suppressor gene in T-ALL (PMID:22366949)
• The cortical thymic maturation arrest in T-lineage Acute lymphoblastic leukemias (ALLs) that overexpress TLX1 or TLX3 is due to binding of TLX1/TLX3 to ETS1. (PMID:22516263)
• The occurrence of G-quadruplex structures at the HOX11 breakpoint region explain its fragility during the t(10;14) translocation. (PMID:24001773)
• TLX1 hypermethylation is associated with colorectal cancer. (PMID:28351398)
• Our data suggest that loss of DLX5, TLX1 and HOXA10 expression in late gestation is required for proper placental differentiation and function. (PMID:28674422)
• High TLX (NR2E1) expression is associated with castration-resistant prostate cancer. (PMID:29555975)
• Data show that among all long non-coding RNAs (lncRNAs), 82 are differentially regulated upon T cell leukemia homeobox 1 protein (TLX1) knockdown, of which 30 are directly bound by TLX1. (PMID:29954933)
• oncogenic kinase NUP214-ABL1, through its downstream effector STAT5, directly cooperates with TLX1 at the transcriptional level. (PMID:30107177)
• Association of TLX1 gene polymorphisms with the risk of acute lymphoblastic leukemia and B lineage acute lymphoblastic leukemia in Han Chinese children. (PMID:32488880)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	tlx1	ENSDARG00000003965
mus_musculus	Tlx1	ENSMUSG00000025215
rattus_norvegicus	Tlx1	ENSRNOG00000016120

Paralogs (42): HOXA11 (ENSG00000005073), HOXC8 (ENSG00000037965), HOXA1 (ENSG00000105991), HOXA2 (ENSG00000105996), HOXA3 (ENSG00000105997), HOXA5 (ENSG00000106004), HOXA6 (ENSG00000106006), HOXA13 (ENSG00000106031), HOXB6 (ENSG00000108511), TLX2 (ENSG00000115297), HOXB8 (ENSG00000120068), HOXB5 (ENSG00000120075), HOXB3 (ENSG00000120093), HOXB1 (ENSG00000120094), HOXA7 (ENSG00000122592), HOXC13 (ENSG00000123364), HOXC11 (ENSG00000123388), HOXC12 (ENSG00000123407), HOXD1 (ENSG00000128645), HOXD3 (ENSG00000128652), HOXD9 (ENSG00000128709), HOXD10 (ENSG00000128710), HOXD11 (ENSG00000128713), HOXD13 (ENSG00000128714), PDX1 (ENSG00000139515), HOXB13 (ENSG00000159184), TLX3 (ENSG00000164438), HOXD4 (ENSG00000170166), HOXD12 (ENSG00000170178), HOXB9 (ENSG00000170689), HOXC5 (ENSG00000172789), HOXB2 (ENSG00000173917), HOXD8 (ENSG00000175879), GSX2 (ENSG00000180613), HOXC9 (ENSG00000180806), HOXC10 (ENSG00000180818), HOXB4 (ENSG00000182742), HOXA4 (ENSG00000197576), HOXC6 (ENSG00000197757), HOXC4 (ENSG00000198353)

Protein

Protein identifiers

T-cell leukemia homeobox protein 1 — P31314 (reviewed: P31314)

Alternative names: Homeobox protein Hox-11, Proto-oncogene TCL-3, T-cell leukemia/lymphoma protein 3

All UniProt accessions (2): P31314, G3V1B7

UniProt curated annotations — full annotation on UniProt →

Function. Controls the genesis of the spleen. Binds to the DNA sequence 5’-GGCGGTAAGTGG-3'.

Subunit / interactions. Interacts with MEIS1, MEIS2, PBX1, PBX2 and PBX3.

Subcellular location. Nucleus.

Disease relevance. A chromosomal aberration involving TLX1 may be a cause of a form of T-cell acute lymphoblastic leukemia (T-ALL). Translocation t(10;14)(q24;q11) with TCRD.

Miscellaneous. TLX1 is oriented in a head-to-head manner with TDI. Both genes share the same promoter with robust bidirectional activity.

Isoforms (2)

UniProt ID	Names	Canonical?
P31314-1	1	yes
P31314-2	2

RefSeq proteins (2): NP_001182446, NP_005512* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001356	HD	Domain
IPR009057	Homeodomain-like_sf	Homologous_superfamily
IPR017970	Homeobox_CS	Conserved_site
IPR020479	HD_metazoa	Domain
IPR042247	TLX1/2/3	Family

Pfam: PF00046

UniProt features (7 total): sequence conflict 2, chain 1, DNA-binding region 1, region of interest 1, modified residue 1, splice variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P31314-F1	64.70	0.25

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 236

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 122 (showing top): GSE45365_NK_CELL_VS_CD11B_DC_UP, CREL_01, BENPORATH_ES_WITH_H3K27ME3, MAZ_Q6, HALMOS_CEBPA_TARGETS_UP, WANG_RESPONSE_TO_BEXAROTENE_UP, MODULE_99, GGGNNTTTCC_NFKB_Q6_01, MODULE_123, SHIN_B_CELL_LYMPHOMA_CLUSTER_9, MAGRANGEAS_MULTIPLE_MYELOMA_IGLL_VS_IGLK_UP, NKX25_01, MAF_Q6, FREAC4_01, CDPCR3HD_01

GO Biological Process (4): regulation of transcription by RNA polymerase II (GO:0006357), animal organ development (GO:0048513), regulation of DNA-templated transcription (GO:0006355), positive regulation of transcription by RNA polymerase II (GO:0045944)

GO Molecular Function (6): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), DNA-binding transcription activator activity, RNA polymerase II-specific (GO:0001228), DNA binding (GO:0003677), DNA-binding transcription factor activity (GO:0003700), protein binding (GO:0005515)

GO Cellular Component (2): chromatin (GO:0000785), nucleus (GO:0005634)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
RNA polymerase II transcription regulatory region sequence-specific DNA binding	3
regulation of DNA-templated transcription	2
transcription by RNA polymerase II	2
regulation of transcription by RNA polymerase II	2
anatomical structure development	1
DNA-templated transcription	1
regulation of gene expression	1
regulation of RNA biosynthetic process	1
positive regulation of DNA-templated transcription	1
cis-regulatory region sequence-specific DNA binding	1
chromatin	1
DNA-binding transcription factor activity	1
DNA-binding transcription factor activity, RNA polymerase II-specific	1
DNA-binding transcription activator activity	1
positive regulation of transcription by RNA polymerase II	1
nucleic acid binding	1
transcription cis-regulatory region binding	1
transcription regulator activity	1
binding	1
chromosome	1
cellular anatomical structure	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

1034 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TLX1	PAX2	Q02962	953
TLX1	EYA1	Q99502	948
TLX1	TAL1	P17542	860
TLX1	NUP214	P35658	855
TLX1	PHF6	Q8IWS0	841
TLX1	LYL1	P12980	829
TLX1	LMO1	P25800	817
TLX1	LMO2	P25791	808
TLX1	ABL1	P00519	755
TLX1	TCF21	O43680	735
TLX1	TAL2	Q16559	672
TLX1	BCL11B	Q9C0K0	668
TLX1	PTPN2	P17706	659
TLX1	CYP2C9	P11712	649
TLX1	MSC	O60682	633

IntAct

29 interactions, top by confidence:

A	B	Type	Score
PBX2	TLX1	psi-mi:“MI:0915”(physical association)	0.550
TLX1	Ets1	psi-mi:“MI:0407”(direct interaction)	0.540
TLX1	Ets1	psi-mi:“MI:0915”(physical association)	0.540
	ETS1	psi-mi:“MI:0915”(physical association)	0.540
TLX1	MEIS1	psi-mi:“MI:0915”(physical association)	0.510
MEIS2	TLX1	psi-mi:“MI:0915”(physical association)	0.510
TLX1	PBX1	psi-mi:“MI:0915”(physical association)	0.510
MEIS1	TLX1	psi-mi:“MI:0915”(physical association)	0.510
TLX1	ETS1	psi-mi:“MI:0915”(physical association)	0.460
ETS1	TLX1	psi-mi:“MI:0403”(colocalization)	0.460
TLX1	PBX1	psi-mi:“MI:0915”(physical association)	0.370
TLX1	PBX3	psi-mi:“MI:0915”(physical association)	0.370
PBX3	TLX1	psi-mi:“MI:0915”(physical association)	0.370
TLX1	IGF2BP3	psi-mi:“MI:0914”(association)	0.350
TLX1		psi-mi:“MI:0914”(association)	0.350
TLX1	BCL9	psi-mi:“MI:2364”(proximity)	0.270
asnO3	TLX1	psi-mi:“MI:0915”(physical association)	0.000
ftsS	TLX1	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (180): PPP2CA (Two-hybrid), PPP2CB (Two-hybrid), PPP2CA (Reconstituted Complex), PPP2CB (Reconstituted Complex), PPP1CC (Reconstituted Complex), PPP1CC (Affinity Capture-Western), PPP2CA (Affinity Capture-Western), PPP2CB (Affinity Capture-Western), TLE1 (Proximity Label-MS), NFIC (Proximity Label-MS), HOXB9 (Proximity Label-MS), TLE4 (Proximity Label-MS), AES (Proximity Label-MS), CREBBP (Proximity Label-MS), EYA3 (Proximity Label-MS)

ESM2 similar proteins: A4L7N3, A6NJ46, O09113, O35160, O35690, O35762, O42115, O42567, O75364, O93385, P09027, P31249, P31314, P31316, P32443, P43120, P43241, P43345, P48031, P50222, P52951, P56673, P70314, P78337, P78426, P81062, P97474, Q04649, Q04742, Q06453, Q2NKI2, Q566X8, Q5XKR4, Q60554, Q6DGH9, Q8IVH2, Q8JI10, Q8K3Q3, Q8NFW5, Q91ZK4

Diamond homologs: A0JPN1, A1YG85, A5PKG8, A6NJ46, A6NMT0, A7MB54, A9L937, B0VXK3, D2KQB0, E7FDX5, M0R6D8, O08686, O13023, O35762, O42365, O43364, O43711, O55144, O88181, O93366, O93367, O93590, P0C1T1, P10035, P14652, P14837, P20009, P28468, P31245, P31246, P31261, P31314, P42583, P42584, P43120, P43345, P43688, P50219, P52945, P52950

SIGNOR signaling

4 interactions.

A	Effect	B	Mechanism
TLX1	“down-regulates activity”	PPP2CA	binding
TLX1	“down-regulates activity”	PPP2CB	binding
TLX1	“down-regulates activity”	RB1	binding
TLX1	“down-regulates activity”	ETS1	binding

Disease & clinical

Clinical variants and AI predictions

ClinVar

44 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	42
Likely benign	2
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

676 predictions. Top by Δscore:

Variant	Effect	Δscore
10:101134377:G:GA	donor_loss	1.0000
10:101134378:T:A	donor_loss	1.0000
10:101134373:GGAG:G	donor_gain	0.9900
10:101134374:GAGG:G	donor_gain	0.9900
10:101134377:G:GG	donor_gain	0.9900
10:101135484:G:GT	donor_gain	0.9900
10:101134374:GAG:G	donor_gain	0.9800
10:101136689:A:AG	acceptor_gain	0.9800
10:101136690:G:GG	acceptor_gain	0.9800
10:101136690:GAC:G	acceptor_gain	0.9800
10:101134170:TATA:T	acceptor_loss	0.9700
10:101134173:A:G	acceptor_loss	0.9700
10:101135440:A:T	donor_gain	0.9700
10:101134172:TAG:T	acceptor_gain	0.9600
10:101134173:AGG:A	acceptor_gain	0.9600
10:101134174:G:T	acceptor_gain	0.9600
10:101136689:AGAC:A	acceptor_gain	0.9600
10:101136690:GACG:G	acceptor_gain	0.9600
10:101134170:TATAG:T	acceptor_gain	0.9500
10:101134171:ATAGG:A	acceptor_gain	0.9500
10:101134372:TGGAG:T	donor_gain	0.9500
10:101134373:GGAGG:G	donor_gain	0.9500
10:101132505:G:GT	donor_gain	0.9400
10:101132103:TTCAC:T	donor_gain	0.9300
10:101132107:CAGG:C	donor_loss	0.9300
10:101132109:GGTG:G	donor_loss	0.9300
10:101132110:G:A	donor_loss	0.9300
10:101132111:T:G	donor_loss	0.9300
10:101134340:TC:T	donor_gain	0.9300
10:101134341:C:A	donor_gain	0.9300

AlphaMissense

2115 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
10:101131596:T:C	F19L	1.000
10:101131598:C:A	F19L	1.000
10:101131598:C:G	F19L	1.000
10:101131603:T:A	I21N	1.000
10:101131603:T:G	I21S	1.000
10:101131612:T:C	I24T	1.000
10:101131612:T:G	I24S	1.000
10:101132067:T:A	W176R	1.000
10:101132067:T:C	W176R	1.000
10:101132069:G:C	W176C	1.000
10:101132069:G:T	W176C	1.000
10:101134213:A:G	K203E	1.000
10:101134219:C:A	R205S	1.000
10:101134219:C:G	R205G	1.000
10:101134219:C:T	R205C	1.000
10:101134220:G:A	R205H	1.000
10:101134228:T:A	F208I	1.000
10:101134228:T:C	F208L	1.000
10:101134228:T:G	F208V	1.000
10:101134229:T:C	F208S	1.000
10:101134229:T:G	F208C	1.000
10:101134230:C:A	F208L	1.000
10:101134230:C:G	F208L	1.000
10:101134232:C:T	T209I	1.000
10:101134240:C:A	Q212K	1.000
10:101134241:A:G	Q212R	1.000
10:101134242:G:C	Q212H	1.000
10:101134242:G:T	Q212H	1.000
10:101134243:A:T	I213F	1.000
10:101134244:T:A	I213N	1.000

dbSNP variants (sampled 300 via entrez): RS1000384061 (10:101138128 T>C), RS1000789480 (10:101130678 G>A), RS1000905633 (10:101130454 T>C), RS1000986355 (10:101136684 G>A,C,T), RS1001418939 (10:101136423 T>C), RS1001784890 (10:101129315 A>G), RS1002463719 (10:101135052 G>T), RS1002842486 (10:101134861 C>A,T), RS1002932105 (10:101131887 GGCGGCGGCAGCA>G,GGCGGCGGCAGCAGCGGCGGCAGCA), RS1003026900 (10:101131644 G>A), RS1003357682 (10:101130388 C>A,G,T), RS1003425742 (10:101133930 T>G), RS1003436652 (10:101136004 A>C), RS1003520775 (10:101138235 G>A), RS1004885639 (10:101136980 C>T)

Disease associations

OMIM: gene MIM:186770 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

3 associations (top):

Study	Trait	p-value
GCST006921_7	Regular attendance at a pub or social club	1.000000e-08
GCST010002_298	Refractive error	3.000000e-22
GCST90002397_548	Mean spheric corpuscular volume	1.000000e-10

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0009592	social interaction measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

13 total (human), top 13 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
mono-(2-ethylhexyl)phthalate	increases abundance, decreases expression, decreases methylation	2
Benzo(a)pyrene	decreases expression, affects methylation	2
methyleugenol	decreases expression	1
bisphenol A	decreases methylation	1
bisphenol S	decreases methylation	1
(+)-JQ1 compound	decreases expression	1
Air Pollutants	increases abundance, increases expression	1
Diethylhexyl Phthalate	increases abundance, decreases methylation	1
N-Nitrosopyrrolidine	decreases expression	1
Tobacco Smoke Pollution	decreases expression	1
Aflatoxin B1	decreases methylation	1
Okadaic Acid	decreases expression	1
Particulate Matter	increases abundance, increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.