TMEM143

Summary

TMEM143 (transmembrane protein 143, HGNC:25603) is a protein-coding gene on chromosome 19q13.32, encoding Transmembrane protein 143 (Q96AN5).

Predicted to act upstream of or within hematopoietic progenitor cell differentiation. Located in mitochondrion.

Source: NCBI Gene 55260 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 108 total
• MANE Select transcript: NM_018273

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:25603
Approved symbol	TMEM143
Name	transmembrane protein 143
Location	19q13.32
Locus type	gene with protein product
Status	Approved
Aliases	FLJ10922
Ensembl gene	ENSG00000161558
Ensembl biotype	protein_coding
Entrez	55260

Gene structure

Transcript identifiers

Ensembl transcripts: 20 — 12 protein_coding, 4 retained_intron, 2 nonsense_mediated_decay, 2 protein_coding_CDS_not_defined

ENST00000293261, ENST00000377431, ENST00000435956, ENST00000593914, ENST00000595720, ENST00000597370, ENST00000598012, ENST00000598258, ENST00000598926, ENST00000599220, ENST00000600816, ENST00000601332, ENST00000601522, ENST00000893974, ENST00000893975, ENST00000893976, ENST00000893977, ENST00000918864, ENST00000948722, ENST00000948723

RefSeq mRNA: 4 — MANE Select: NM_018273 NM_001303538, NM_001303539, NM_001303540, NM_018273

CCDS: CCDS12716, CCDS77325, CCDS77326

Canonical transcript exons

ENST00000293261 — 8 exons

Exon	Start	End
ENSE00001058749	48343321	48343451
ENSE00001116370	48342530	48342809
ENSE00001116371	48332356	48333433
ENSE00003224298	48363898	48363940
ENSE00003487348	48345160	48345354
ENSE00003517521	48363291	48363531
ENSE00003524788	48360072	48360176
ENSE00003654433	48334008	48334197

Expression profiles

Bgee: expression breadth ubiquitous, 230 present calls, max score 94.72.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 6.7875 / max 94.6892, expressed in 1731 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
181833	6.5312	1727
181834	0.2563	111

Top tissues by expression

276 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
hindlimb stylopod muscle	UBERON:0004252	94.72	gold quality
apex of heart	UBERON:0002098	94.57	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	93.88	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	93.47	gold quality
gastrocnemius	UBERON:0001388	92.99	gold quality
biceps brachii	UBERON:0001507	92.45	gold quality
muscle of leg	UBERON:0001383	92.12	gold quality
heart left ventricle	UBERON:0002084	91.39	gold quality
cardiac ventricle	UBERON:0002082	91.27	gold quality
skeletal muscle organ	UBERON:0014892	89.00	gold quality
muscle organ	UBERON:0001630	88.99	gold quality
heart right ventricle	UBERON:0002080	88.56	gold quality
right atrium auricular region	UBERON:0006631	88.20	gold quality
heart	UBERON:0000948	87.42	gold quality
right lobe of liver	UBERON:0001114	87.12	gold quality
cardiac atrium	UBERON:0002081	86.24	gold quality
skeletal muscle tissue	UBERON:0001134	83.62	gold quality
right adrenal gland	UBERON:0001233	83.27	gold quality
right adrenal gland cortex	UBERON:0035827	83.25	gold quality
oocyte	CL:0000023	82.39	gold quality
body of tongue	UBERON:0011876	82.39	gold quality
metanephros cortex	UBERON:0010533	82.24	gold quality
left adrenal gland cortex	UBERON:0035825	81.73	gold quality
right hemisphere of cerebellum	UBERON:0014890	81.57	gold quality
left adrenal gland	UBERON:0001234	81.45	gold quality
adrenal cortex	UBERON:0001235	81.18	gold quality
cerebellar hemisphere	UBERON:0002245	80.39	gold quality
cerebellar cortex	UBERON:0002129	80.29	gold quality
muscle tissue	UBERON:0002385	80.29	gold quality
muscle layer of sigmoid colon	UBERON:0035805	80.19	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	2.54

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

41 targeting TMEM143, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-223-3P	99.99	70.14	1140
HSA-MIR-32-5P	99.98	75.21	1964
HSA-MIR-92A-3P	99.98	75.21	1960
HSA-MIR-92B-3P	99.98	75.25	1955
HSA-MIR-6721-5P	99.93	68.92	2981
HSA-MIR-497-5P	99.92	71.83	2674
HSA-MIR-4648	99.91	67.00	710
HSA-MIR-15A-5P	99.90	72.80	2787
HSA-MIR-15B-5P	99.90	72.78	2798
HSA-MIR-16-5P	99.90	72.80	2780
HSA-MIR-195-5P	99.90	72.81	2805
HSA-MIR-6838-5P	99.89	71.94	2690
HSA-MIR-424-5P	99.89	71.90	2641
HSA-MIR-4503	99.85	71.45	1869
HSA-MIR-6756-5P	99.82	67.97	2466
HSA-MIR-3913-5P	99.78	67.26	968
HSA-MIR-92A-2-5P	99.75	67.01	2164
HSA-MIR-646	99.68	67.84	1645
HSA-MIR-6766-5P	99.68	67.70	2325
HSA-MIR-6762-3P	99.66	66.94	1188
HSA-MIR-1251-3P	99.64	67.21	1408
HSA-MIR-451B	99.55	68.28	1380
HSA-MIR-3122	99.50	66.33	821
HSA-MIR-3614-5P	99.30	65.25	837
HSA-MIR-5589-3P	99.29	68.30	1443
HSA-MIR-4477A	98.83	69.75	2952
HSA-MIR-4763-5P	98.75	63.89	854
HSA-MIR-3944-5P	98.50	67.55	997
HSA-MIR-6878-5P	98.49	67.91	2142
HSA-MIR-138-5P	98.43	70.49	1292

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Tmem143	ENSMUSG00000002781
rattus_norvegicus	Tmem143	ENSRNOG00000021096

Paralogs (1): PROSER2 (ENSG00000148426)

Protein

Protein identifiers

Transmembrane protein 143 — Q96AN5 (reviewed: Q96AN5)

All UniProt accessions (7): B4DMT0, B4DPF8, M0QZ02, M0R153, M0R1H7, M0R325, Q96AN5

UniProt curated annotations — full annotation on UniProt →

Subcellular location. Membrane.

Isoforms (3)

UniProt ID	Names	Canonical?
Q96AN5-1	1	yes
Q96AN5-2	2
Q96AN5-3	3

RefSeq proteins (4): NP_001290467, NP_001290468, NP_001290469, NP_060743* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR022227	DUF3754	Family

Pfam: PF12576

UniProt features (10 total): splice variant 3, transmembrane region 2, chain 1, region of interest 1, compositionally biased region 1, modified residue 1, sequence variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q96AN5-F1	81.42	0.52

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 332

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 107 (showing top): GSE45365_NK_CELL_VS_BCELL_DN, E2F_Q4, TGCGCANK_UNKNOWN, E2F4DP1_01, NKX62_Q2, E2F1DP1_01, E2F1DP2_01, MODULE_480, HELLER_HDAC_TARGETS_SILENCED_BY_METHYLATION_UP, E2F1_Q3, MARTORIATI_MDM4_TARGETS_FETAL_LIVER_UP, MODULE_427, BOYLAN_MULTIPLE_MYELOMA_C_D_UP, MODULE_192, MARSON_BOUND_BY_E2F4_UNSTIMULATED

GO Biological Process (1): biological_process (GO:0008150)

GO Molecular Function (2): molecular_function (GO:0003674), protein binding (GO:0005515)

GO Cellular Component (2): mitochondrion (GO:0005739), membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
binding	1
cytoplasm	1
intracellular membrane-bounded organelle	1
cellular anatomical structure	1

Protein interactions and networks

STRING

304 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TMEM143	IQCE	Q6IPM2	480
TMEM143	TMEM186	Q96B77	474
TMEM143	ODAD1	Q96M63	469
TMEM143	PHYHIPL	Q96FC7	447
TMEM143	SYNGR4	O95473	442
TMEM143	MYL10	Q9BUA6	401
TMEM143	PPTC7	Q8NI37	391
TMEM143	MRPL47	Q9HD33	368
TMEM143	RMND1	Q9NWS8	366
TMEM143	TMEM160	Q9NX00	361
TMEM143	EMP3	P54852	357
TMEM143	ODAD2	Q5T2S8	354
TMEM143	COLEC11	Q9BWP8	350
TMEM143	TMEM65	Q6PI78	345
TMEM143	NT5C3A	Q9H0P0	344

IntAct

68 interactions, top by confidence:

A	B	Type	Score
NIPAL1	ESYT2	psi-mi:“MI:0914”(association)	0.640
ADCY9	NEMP1	psi-mi:“MI:0914”(association)	0.640
GLMN	FKBP5	psi-mi:“MI:0914”(association)	0.640
TMEM143	ABHD16A	psi-mi:“MI:0915”(physical association)	0.560
SFT2D2	TMEM143	psi-mi:“MI:0915”(physical association)	0.560
YIPF2	TMEM143	psi-mi:“MI:0915”(physical association)	0.560
REEP6	TMEM143	psi-mi:“MI:0915”(physical association)	0.560
DGAT2L6	TMEM143	psi-mi:“MI:0915”(physical association)	0.560
TMEM143	AQP6	psi-mi:“MI:0915”(physical association)	0.560
LSMEM2	TMEM143	psi-mi:“MI:0915”(physical association)	0.560
TMEM143	ORMDL1	psi-mi:“MI:0915”(physical association)	0.560
ABHD16A	TMEM143	psi-mi:“MI:0915”(physical association)	0.560
TMEM120B	TMEM143	psi-mi:“MI:0915”(physical association)	0.560
SLC10A6	TMEM143	psi-mi:“MI:0915”(physical association)	0.560
TMEM143	NAT8	psi-mi:“MI:0915”(physical association)	0.560
CSGALNACT2	TMEM143	psi-mi:“MI:0915”(physical association)	0.560
DHRSX	TMEM143	psi-mi:“MI:0915”(physical association)	0.560
TMEM143	YIPF2	psi-mi:“MI:0915”(physical association)	0.560
TMEM143	REEP6	psi-mi:“MI:0915”(physical association)	0.560
AQP6	TMEM143	psi-mi:“MI:0915”(physical association)	0.560
TMEM143	LIME1	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (42): TMEM143 (Affinity Capture-MS), TMEM143 (Affinity Capture-MS), TMEM143 (Affinity Capture-MS), TMEM143 (Affinity Capture-MS), TMEM143 (Affinity Capture-MS), TMEM143 (Affinity Capture-MS), TMEM143 (Affinity Capture-RNA), TMEM143 (Affinity Capture-MS), TMEM143 (Two-hybrid), TMEM143 (Two-hybrid), TMEM143 (Two-hybrid), TMEM143 (Two-hybrid), TMEM143 (Two-hybrid), TMEM143 (Two-hybrid), DHRSX (Two-hybrid)

ESM2 similar proteins: A0PJW6, A5PJW2, B3DI94, B5DFG1, O00411, O95382, P49753, Q059A4, Q0V9C9, Q3SX05, Q4KLZ1, Q4KM93, Q4R5Q4, Q4VAE3, Q53S58, Q5EA71, Q5T1A1, Q5XIC2, Q643R3, Q66LN0, Q6DC58, Q6NVG1, Q76MJ5, Q7YS91, Q80YU0, Q863F8, Q8BPE4, Q8BWM0, Q8N159, Q8NFF5, Q8VCA6, Q8VD26, Q921N7, Q96AN5, Q96KR6, Q99MQ3, Q9BQ95, Q9BUB7, Q9BYK8, Q9CQE2

Diamond homologs: Q32PH2, Q8VD26, Q96AN5

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 45 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Transport of small molecules	8	7.2×	1e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

108 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	88
Likely benign	3
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1354 predictions. Top by Δscore:

Variant	Effect	Δscore
19:48342526:TCACC:T	donor_loss	1.0000
19:48342527:CA:C	donor_loss	1.0000
19:48342528:A:C	donor_loss	1.0000
19:48345157:TACCT:T	donor_loss	1.0000
19:48345158:AC:A	donor_loss	1.0000
19:48345170:T:TA	donor_gain	1.0000
19:48334002:TCCTA:T	donor_loss	0.9900
19:48334003:CCTA:C	donor_loss	0.9900
19:48334004:CTACC:C	donor_loss	0.9900
19:48334005:TAC:T	donor_loss	0.9900
19:48334006:A:G	donor_loss	0.9900
19:48334070:T:TA	donor_gain	0.9900
19:48334194:ACAT:A	acceptor_gain	0.9900
19:48334195:CAT:C	acceptor_gain	0.9900
19:48334195:CATC:C	acceptor_gain	0.9900
19:48342807:CTC:C	acceptor_gain	0.9900
19:48343449:CAC:C	acceptor_gain	0.9900
19:48343451:CCTG:C	acceptor_loss	0.9900
19:48343452:C:CA	acceptor_loss	0.9900
19:48343452:C:CC	acceptor_gain	0.9900
19:48343453:T:C	acceptor_loss	0.9900
19:48343456:C:CT	acceptor_gain	0.9900
19:48343457:G:T	acceptor_gain	0.9900
19:48345160:CTG:C	donor_gain	0.9900
19:48345161:TGG:T	donor_gain	0.9900
19:48345169:AT:A	donor_gain	0.9900
19:48345186:C:CT	donor_gain	0.9900
19:48345187:C:CT	donor_gain	0.9900
19:48345350:AAGGC:A	acceptor_gain	0.9900
19:48345355:C:CC	acceptor_gain	0.9900

AlphaMissense

2920 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
19:48342749:C:A	K252N	0.994
19:48342749:C:G	K252N	0.994
19:48342740:C:A	K255N	0.991
19:48342740:C:G	K255N	0.991
19:48342743:G:C	F254L	0.991
19:48342743:G:T	F254L	0.991
19:48342745:A:G	F254L	0.991
19:48342795:C:G	R237P	0.990
19:48345234:C:G	A164P	0.990
19:48334115:A:G	L353P	0.988
19:48342744:A:G	F254S	0.988
19:48342751:T:C	K252E	0.988
19:48342789:A:T	V239D	0.988
19:48334123:G:C	N350K	0.986
19:48334123:G:T	N350K	0.986
19:48334135:A:C	S346R	0.986
19:48334135:A:T	S346R	0.986
19:48334137:T:G	S346R	0.986
19:48342780:G:T	A242D	0.986
19:48345226:G:C	F166L	0.986
19:48345226:G:T	F166L	0.986
19:48345228:A:G	F166L	0.986
19:48342746:A:C	S253R	0.985
19:48342746:A:T	S253R	0.985
19:48342748:T:G	S253R	0.985
19:48342753:A:G	L251P	0.985
19:48342801:A:G	F235S	0.984
19:48333363:G:C	F412L	0.983
19:48333363:G:T	F412L	0.983
19:48333365:A:G	F412L	0.983

dbSNP variants (sampled 300 via entrez): RS1000014629 (19:48339136 G>A,C), RS1000033332 (19:48364869 C>T), RS1000188953 (19:48350547 G>A), RS1000288117 (19:48357550 G>T), RS1000465163 (19:48338332 GC>G), RS1000618099 (19:48332096 TCAGATCCTTCTAAGATCCTCTTCTATG>T), RS1000624159 (19:48342816 G>T), RS1000653401 (19:48355548 G>T), RS1000681916 (19:48332030 A>G), RS1000750493 (19:48337022 CAAA>C,CA,CAA,CAAAA), RS1000812758 (19:48349229 C>T), RS1000882943 (19:48342348 G>C), RS1000895150 (19:48350767 C>T), RS1000951329 (19:48348903 C>T), RS1000999847 (19:48353966 CTTTTTT>C,CTTTT,CTTTTT,CTTTTTTT,CTTTTTTTT)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

21 total (human), top 21 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, affects cotreatment, increases abundance	3
Benzo(a)pyrene	decreases expression, increases mutagenesis	2
dicrotophos	increases expression	1
pirinixic acid	affects binding, decreases expression, increases activity	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
butyraldehyde	decreases expression	1
abrine	decreases expression	1
jinfukang	affects cotreatment, increases expression	1
Sunitinib	increases expression	1
Leflunomide	decreases expression	1
Acetaminophen	increases expression	1
Arsenic	affects cotreatment, decreases expression, increases abundance	1
Cisplatin	affects cotreatment, increases expression	1
Doxorubicin	decreases expression	1
Thiram	decreases expression	1
Tobacco Smoke Pollution	decreases expression	1
Urethane	decreases expression	1
Valproic Acid	decreases expression	1
Aflatoxin B1	decreases expression	1
Cadmium Chloride	decreases expression	1
Okadaic Acid	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.