TMEM179
geneOn this page
Also known as FLJ42486TMEM179A
Summary
TMEM179 (transmembrane protein 179, HGNC:20137) is a protein-coding gene on chromosome 14q32.33, encoding Transmembrane protein 179 (Q6ZVK1).
Predicted to be located in membrane.
Source: NCBI Gene 388021 — RefSeq curated summary.
At a glance
- GWAS associations: 4
- MANE Select transcript:
NM_001286389
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:20137 |
| Approved symbol | TMEM179 |
| Name | transmembrane protein 179 |
| Location | 14q32.33 |
| Locus type | gene with protein product |
| Status | Approved |
| Aliases | FLJ42486, TMEM179A |
| Ensembl gene | ENSG00000258986 |
| Ensembl biotype | protein_coding |
| OMIM | 621219 |
| Entrez | 388021 |
Gene structure
Transcript identifiers
Ensembl transcripts: 6 — 6 protein_coding
ENST00000341595, ENST00000415614, ENST00000556320, ENST00000556573, ENST00000615704, ENST00000616017
RefSeq mRNA: 2 — MANE Select: NM_001286389
NM_001286389, NM_001286390
CCDS: CCDS66723, CCDS73688
Canonical transcript exons
ENST00000556573 — 4 exons
| Exon | Start | End |
|---|---|---|
| ENSE00001648955 | 104590864 | 104593658 |
| ENSE00002521333 | 104604437 | 104604772 |
| ENSE00003066306 | 104596990 | 104597127 |
| ENSE00003068043 | 104595165 | 104595243 |
Expression profiles
Bgee: expression breadth ubiquitous, 117 present calls, max score 93.77.
FANTOM5 (CAGE): breadth broad, TPM avg 1.2806 / max 56.8086, expressed in 273 samples.
FANTOM5 promoters (1 alternative TSS)
| Promoter ID | TPM avg | Samples expressed |
|---|---|---|
| 145127 | 1.2806 | 273 |
Top tissues by expression
131 total, by Bgee expression score (0-100, higher = more expressed):
| Tissue | Anatomy ID | Expression score | Quality |
|---|---|---|---|
| hypothalamus | UBERON:0001898 | 93.77 | gold quality |
| pituitary gland | UBERON:0000007 | 93.67 | gold quality |
| nucleus accumbens | UBERON:0001882 | 93.56 | gold quality |
| putamen | UBERON:0001874 | 93.33 | gold quality |
| right frontal lobe | UBERON:0002810 | 92.86 | gold quality |
| dorsolateral prefrontal cortex | UBERON:0009834 | 92.69 | gold quality |
| Brodmann (1909) area 9 | UBERON:0013540 | 92.64 | gold quality |
| caudate nucleus | UBERON:0001873 | 92.16 | gold quality |
| anterior cingulate cortex | UBERON:0009835 | 92.02 | gold quality |
| adenohypophysis | UBERON:0002196 | 91.85 | gold quality |
| superior frontal gyrus | UBERON:0002661 | 91.71 | gold quality |
| primary visual cortex | UBERON:0002436 | 91.44 | gold quality |
| brain | UBERON:0000955 | 90.72 | gold quality |
| Ammon’s horn | UBERON:0001954 | 90.56 | gold quality |
| cerebral cortex | UBERON:0000956 | 90.42 | gold quality |
| temporal lobe | UBERON:0001871 | 90.17 | gold quality |
| substantia nigra | UBERON:0002038 | 90.09 | gold quality |
| amygdala | UBERON:0001876 | 90.04 | gold quality |
| right hemisphere of cerebellum | UBERON:0014890 | 89.15 | gold quality |
| frontal cortex | UBERON:0001870 | 88.88 | gold quality |
| cerebellar hemisphere | UBERON:0002245 | 87.73 | gold quality |
| cerebellum | UBERON:0002037 | 87.72 | gold quality |
| cerebellar cortex | UBERON:0002129 | 87.63 | gold quality |
| prefrontal cortex | UBERON:0000451 | 85.79 | gold quality |
| C1 segment of cervical spinal cord | UBERON:0006469 | 84.51 | gold quality |
| islet of Langerhans | UBERON:0000006 | 83.55 | gold quality |
| cortical plate | UBERON:0005343 | 83.22 | gold quality |
| ganglionic eminence | UBERON:0004023 | 80.10 | gold quality |
| male germ line stem cell (sensu Vertebrata) in testis | CL:0000089 ∩ UBERON:0000473 | 77.66 | gold quality |
| right adrenal gland | UBERON:0001233 | 75.63 | gold quality |
Single-cell (SCXA)
Detected in 1 experiment(s), a significant marker in 0.
| Experiment | Marker? | Max mean expression |
|---|---|---|
| E-ANND-3 | no | 0.69 |
Regulation
Is transcription factor: no
Cross-species orthologs
5 orthologs
| Organism | Symbol | Gene ID |
|---|---|---|
| danio_rerio | tmem179aa | ENSDARG00000013292 |
| danio_rerio | TMEM179 | ENSDARG00000090064 |
| mus_musculus | Tmem179 | ENSMUSG00000054013 |
| rattus_norvegicus | Tmem179 | ENSRNOG00000013128 |
| drosophila_melanogaster | CG13603 | FBGN0039135 |
Protein
Protein identifiers
Transmembrane protein 179 — Q6ZVK1 (reviewed: Q6ZVK1)
Alternative names: Transmembrane protein 179A
All UniProt accessions (5): A0A087X0S3, Q6ZVK1, H0YJT8, I3L0F2, Q7Z4P9
UniProt curated annotations — full annotation on UniProt →
Subcellular location. Membrane.
Similarity. Belongs to the TMEM179 family.
Isoforms (2)
| UniProt ID | Names | Canonical? |
|---|---|---|
| Q6ZVK1-1 | 1 | yes |
| Q6ZVK1-2 | 2 |
RefSeq proteins (2): NP_001273318, NP_001273319 (=MANE)
Domains & families (InterPro)
| ID | Name | Type |
|---|---|---|
| IPR029673 | TMEM179 | Family |
| IPR059010 | TMEM179-179B | Family |
Pfam: PF26158
UniProt features (8 total): transmembrane region 4, splice variant 2, chain 1, glycosylation site 1
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
| Model | pLDDT | Fraction very-high |
|---|---|---|
| AF-Q6ZVK1-F1 | 88.99 | 0.64 |
Functional residue map
Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.
Glycosylation sites (1): 51
Function
Pathways and Gene Ontology
Reactome pathways
0 pathways
MSigDB gene sets: 50 (showing top):
TGCGCANK_UNKNOWN, LHX3_01, AML_Q6, chr14q32, NRSF_01, TAATTA_CHX10_01, YGCGYRCGC_UNKNOWN, GATA_C, MIKKELSEN_MEF_HCP_WITH_H3K27ME3, MARTENS_TRETINOIN_RESPONSE_UP, BILANGES_RAPAMYCIN_SENSITIVE_GENES, DELACROIX_RARG_BOUND_MEF, NRF1_Q6, CBX5_TARGET_GENES, E2F5_TARGET_GENES
GO Biological Process (0):
GO Molecular Function (0):
GO Cellular Component (1): membrane (GO:0016020)
GO top-level categories
Rollup of top GO terms by namespace:
| Category | Terms |
|---|---|
| cellular anatomical structure | 1 |
Protein interactions and networks
STRING
898 interactions, top by confidence (×1000):
| Protein A | Protein B | Partner UniProt | Score |
|---|---|---|---|
| TMEM179 | OR4F15 | Q8NGB8 | 570 |
| TMEM179 | KIF26A | Q9ULI4 | 496 |
| TMEM179 | OR4F6 | Q8NGB9 | 480 |
| TMEM179 | TMEM128 | Q5BJH2 | 479 |
| TMEM179 | COA8 | Q96IL0 | 479 |
| TMEM179 | TMEM278 | A6NKF7 | 476 |
| TMEM179 | BCCIP | Q9P287 | 473 |
| TMEM179 | EDRF1 | Q3B7T1 | 453 |
| TMEM179 | FAM81A | Q8TBF8 | 451 |
| TMEM179 | TMEM179B | Q7Z7N9 | 448 |
| TMEM179 | THSD7A | Q9UPZ6 | 448 |
| TMEM179 | OR4F4 | Q96R69 | 447 |
| TMEM179 | SRP14 | P37108 | 430 |
| TMEM179 | FAM204A | Q9H8W3 | 424 |
| TMEM179 | ENTREP2 | O60320 | 420 |
IntAct
0 interactions, top by confidence:
ESM2 similar proteins: A4IFN5, A6NDV4, B1AWJ5, B1AZA5, B2LYG4, P59266, Q05B45, Q0VCJ8, Q3KRC4, Q3UMZ3, Q5EA70, Q5H8A4, Q5QJU3, Q5RBJ7, Q5U3C3, Q5VTY9, Q5ZMH6, Q6PHN7, Q6TCH4, Q6W5G4, Q6ZVK1, Q7Z7J7, Q865K8, Q86WK9, Q8BHH9, Q8BMT9, Q8BWB6, Q8C1E7, Q8K3J9, Q8N6M3, Q8NBT3, Q8NEB5, Q8NFT2, Q8VCW4, Q8VCY8, Q8VD53, Q8VDI9, Q96GM1, Q9BSA9, Q9BXJ8
Diamond homologs: Q6AZD1, Q6ZVK1, Q8BHH9
SIGNOR signaling
0 interactions.
Disease & clinical
Clinical variants and AI predictions
ClinVar
0 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 0 |
| Likely pathogenic | 0 |
| Uncertain significance | 0 |
| Likely benign | 0 |
| Benign | 0 |
Top pathogenic / likely-pathogenic (0)
SpliceAI
1765 predictions. Top by Δscore:
| Variant | Effect | Δscore |
|---|---|---|
| 14:104586538:GAGG:G | donor_gain | 1.0000 |
| 14:104586540:GG:G | donor_gain | 1.0000 |
| 14:104586541:GG:G | donor_gain | 1.0000 |
| 14:104587879:G:GG | donor_gain | 1.0000 |
| 14:104588269:CGCA:C | acceptor_loss | 1.0000 |
| 14:104588271:CA:C | acceptor_loss | 1.0000 |
| 14:104588272:A:AC | acceptor_loss | 1.0000 |
| 14:104588272:A:AG | acceptor_gain | 1.0000 |
| 14:104588273:G:GG | acceptor_gain | 1.0000 |
| 14:104588273:GA:G | acceptor_gain | 1.0000 |
| 14:104588273:GAC:G | acceptor_gain | 1.0000 |
| 14:104588273:GACA:G | acceptor_gain | 1.0000 |
| 14:104588307:GGG:G | donor_gain | 1.0000 |
| 14:104588307:GGGGT:G | donor_loss | 1.0000 |
| 14:104588308:GG:G | donor_gain | 1.0000 |
| 14:104588308:GGG:G | donor_gain | 1.0000 |
| 14:104588308:GGGTG:G | donor_loss | 1.0000 |
| 14:104588309:GG:G | donor_gain | 1.0000 |
| 14:104588309:GGT:G | donor_loss | 1.0000 |
| 14:104593654:CCAAA:C | acceptor_gain | 1.0000 |
| 14:104593655:CAAA:C | acceptor_gain | 1.0000 |
| 14:104593655:CAAAC:C | acceptor_gain | 1.0000 |
| 14:104593659:C:CC | acceptor_gain | 1.0000 |
| 14:104595159:CCCTA:C | donor_loss | 1.0000 |
| 14:104595160:CCTA:C | donor_loss | 1.0000 |
| 14:104595161:CTA:C | donor_loss | 1.0000 |
| 14:104595162:TACCT:T | donor_loss | 1.0000 |
| 14:104595163:A:T | donor_loss | 1.0000 |
| 14:104595239:CACAG:C | acceptor_gain | 1.0000 |
| 14:104595241:CAG:C | acceptor_gain | 1.0000 |
AlphaMissense
1531 scored. Top likely-pathogenic:
| Variant | Protein change | am_pathogenicity |
|---|---|---|
| 14:104597058:G:C | S125R | 0.995 |
| 14:104597058:G:T | S125R | 0.995 |
| 14:104597060:T:G | S125R | 0.995 |
| 14:104604547:C:A | W65C | 0.995 |
| 14:104604547:C:G | W65C | 0.995 |
| 14:104597030:A:G | W135R | 0.994 |
| 14:104597030:A:T | W135R | 0.994 |
| 14:104597042:C:G | G131R | 0.994 |
| 14:104597046:G:C | S129R | 0.994 |
| 14:104597046:G:T | S129R | 0.994 |
| 14:104597048:T:G | S129R | 0.994 |
| 14:104604616:G:C | F42L | 0.994 |
| 14:104604616:G:T | F42L | 0.994 |
| 14:104604618:A:G | F42L | 0.994 |
| 14:104604627:A:G | C39R | 0.994 |
| 14:104597026:C:G | C136S | 0.992 |
| 14:104597027:A:T | C136S | 0.992 |
| 14:104597041:C:T | G131D | 0.992 |
| 14:104604563:A:G | F60S | 0.992 |
| 14:104593631:A:G | W184R | 0.991 |
| 14:104593631:A:T | W184R | 0.991 |
| 14:104604601:C:A | W47C | 0.991 |
| 14:104604601:C:G | W47C | 0.991 |
| 14:104604679:G:C | S21R | 0.991 |
| 14:104604679:G:T | S21R | 0.991 |
| 14:104604681:T:G | S21R | 0.991 |
| 14:104595241:C:T | C149Y | 0.990 |
| 14:104597026:C:T | C136Y | 0.990 |
| 14:104604546:C:G | G66R | 0.990 |
| 14:104593640:A:G | W181R | 0.989 |
dbSNP variants (sampled 300 via entrez): RS1000041353 (14:104603303 G>A,C), RS1000280815 (14:104597981 A>G), RS1000455392 (14:104606453 C>T), RS1000487995 (14:104593124 C>A,T), RS1000503109 (14:104599208 G>A,T), RS1000569150 (14:104598167 T>C), RS1000824939 (14:104594237 A>G), RS1000994329 (14:104591321 G>A,C), RS1001021633 (14:104598934 G>A,C,T), RS1001148773 (14:104600611 TACTCATTCATTCATTCATTCATTCATTC>T), RS1001540897 (14:104602588 G>A), RS1001965733 (14:104598599 A>T), RS1001985725 (14:104604078 T>C), RS1002001905 (14:104598897 C>T), RS1002116321 (14:104598694 G>A)
Disease associations
OMIM: gene MIM:621219 | disease phenotypes:
GenCC curated gene-disease
Mondo (0):
Orphanet (0):
HPO phenotypes
0 total (0 of 0 shown, HPO-id order):
GWAS associations
4 associations (top):
| Study | Trait | p-value |
|---|---|---|
| GCST004746_41 | Small cell lung carcinoma | 5.000000e-06 |
| GCST007637_52 | Diffusing capacity of carbon monoxide | 9.000000e-06 |
| GCST008103_137 | Bipolar disorder | 2.000000e-06 |
| GCST008115_19 | Bipolar I disorder | 2.000000e-07 |
EFO canonical traits (2, from GWAS)
| EFO ID | Trait name |
|---|---|
| EFO:0009369 | diffusing capacity of the lung for carbon monoxide |
| EFO:0009963 | bipolar I disorder |
Drugs & pharmacology
Drug and pharmacology data
Is drug target: no
PharmGKB: 1 entry (VIP=true, CPIC=false)
CTD chemical–gene interactions
4 total (human), top 4 by PubMed support.
| Chemical | Actions (top 5) | PubMed papers |
|---|---|---|
| ethyl-p-hydroxybenzoate | decreases expression | 1 |
| tebuconazole | decreases expression | 1 |
| Benzo(a)pyrene | increases methylation | 1 |
| Acrylamide | decreases expression | 1 |
Clinical trials (associated diseases)
0 trials via MONDO — disease-level, not drug-specific.
Related Atlas pages
- Disease cohort memberships (association, not causation — diseases whose associated-gene cohort lists this gene; a subset are also under Associated diseases): small cell lung carcinoma