TMEM200C

Summary

TMEM200C (transmembrane protein 200C, HGNC:37208) is a protein-coding gene on chromosome 18p11.31, encoding Transmembrane protein 200C (A6NKL6).

Predicted to be located in membrane.

Source: NCBI Gene 645369 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 1 total — 1 pathogenic
• MANE Select transcript: NM_001395400

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:37208
Approved symbol	TMEM200C
Name	transmembrane protein 200C
Location	18p11.31
Locus type	gene with protein product
Status	Approved
Aliases	TTMA
Ensembl gene	ENSG00000206432
Ensembl biotype	protein_coding
Entrez	645369

Gene structure

Transcript identifiers

Ensembl transcripts: 4 — 4 protein_coding

ENST00000383490, ENST00000581347, ENST00000930047, ENST00000957277

RefSeq mRNA: 2 — MANE Select: NM_001395400 NM_001080209, NM_001395400

CCDS: CCDS45825

Canonical transcript exons

ENST00000383490 — 2 exons

Exon	Start	End
ENSE00001497187	5882072	5892157
ENSE00003964597	5895030	5895522

Expression profiles

Bgee: expression breadth ubiquitous, 162 present calls, max score 92.75.

Top tissues by expression

242 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
endothelial cell	CL:0000115	92.75	gold quality
buccal mucosa cell	CL:0002336	80.20	gold quality
Brodmann (1909) area 23	UBERON:0013554	78.69	gold quality
oviduct epithelium	UBERON:0004804	78.62	gold quality
middle temporal gyrus	UBERON:0002771	77.22	gold quality
ventricular zone	UBERON:0003053	74.59	gold quality
caput epididymis	UBERON:0004358	74.54	gold quality
ganglionic eminence	UBERON:0004023	74.07	gold quality
ileal mucosa	UBERON:0000331	73.96	silver quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	72.68	gold quality
corpus epididymis	UBERON:0004359	72.25	gold quality
superior frontal gyrus	UBERON:0002661	71.81	gold quality
prefrontal cortex	UBERON:0000451	71.50	gold quality
left adrenal gland	UBERON:0001234	71.48	gold quality
Brodmann (1909) area 46	UBERON:0006483	71.29	gold quality
left adrenal gland cortex	UBERON:0035825	70.76	gold quality
right adrenal gland	UBERON:0001233	70.71	gold quality
right adrenal gland cortex	UBERON:0035827	70.58	gold quality
adrenal cortex	UBERON:0001235	69.98	gold quality
frontal cortex	UBERON:0001870	69.88	gold quality
primary visual cortex	UBERON:0002436	69.24	gold quality
neocortex	UBERON:0001950	69.00	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	68.86	gold quality
entorhinal cortex	UBERON:0002728	68.11	silver quality
cardiac muscle of right atrium	UBERON:0003379	68.04	gold quality
postcentral gyrus	UBERON:0002581	67.95	gold quality
cerebral cortex	UBERON:0000956	67.94	gold quality
adrenal gland	UBERON:0002369	67.75	gold quality
left ventricle myocardium	UBERON:0006566	67.67	gold quality
medial globus pallidus	UBERON:0002477	67.40	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	5.20

Regulation

Is transcription factor: no

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	TMEM200C	ENSDARG00000101172
danio_rerio		ENSDARG00000116727
mus_musculus	Tmem200c	ENSMUSG00000095407
rattus_norvegicus	Tmem200c	ENSRNOG00000049880
drosophila_melanogaster	CG12502	FBGN0035171
caenorhabditis_elegans	R05D7.3	WBGENE00011028

Paralogs (2): TMEM200A (ENSG00000164484), TMEM200B (ENSG00000253304)

Protein

Protein identifiers

Transmembrane protein 200C — A6NKL6 (reviewed: A6NKL6)

Alternative names: Transmembrane protein TTMA, Two transmembrane domain-containing family member A

All UniProt accessions (1): A6NKL6

UniProt curated annotations — full annotation on UniProt →

Subcellular location. Membrane.

Similarity. Belongs to the TMEM200 family.

RefSeq proteins (2): NP_001073678, NP_001382329* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR018787	DUF2371_TMEM200	Family

Pfam: PF10177

UniProt features (16 total): compositionally biased region 8, region of interest 5, transmembrane region 2, chain 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-A6NKL6-F1	50.25	0.02

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 31 (showing top): GSE37336_LY6C_POS_VS_NEG_NAIVE_CD4_TCELL_UP, GSE18804_SPLEEN_MACROPHAGE_VS_TUMORAL_MACROPHAGE_UP, GSE45365_NK_CELL_VS_CD8A_DC_DN, SENESE_HDAC1_AND_HDAC2_TARGETS_DN, DODD_NASOPHARYNGEAL_CARCINOMA_UP, LEE_BMP2_TARGETS_UP, SIX1_TARGET_GENES, ZBTB18_TARGET_GENES, ZNF596_TARGET_GENES, GSE13229_IMM_VS_MATURE_NKCELL_DN, GSE13229_MATURE_VS_INTMATURE_NKCELL_UP, DESCARTES_MAIN_FETAL_SLC24A4_PEX5L_POSITIVE_CELLS, DESCARTES_FETAL_KIDNEY_METANEPHRIC_CELLS, TET1_TARGET_GENES, GSE17974_IL4_AND_ANTI_IL12_VS_UNTREATED_1H_ACT_CD4_TCELL_UP

GO Biological Process (0):

GO Molecular Function (0):

GO Cellular Component (1): membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	1

Protein interactions and networks

STRING

264 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TMEM200C	MTHFSD	Q2M296	547
TMEM200C	SYCP2L	Q5T4T6	541
TMEM200C	ALB	P02768	532
TMEM200C	ARK2N	Q96B23	479
TMEM200C	SYCP2	Q9BX26	461
TMEM200C	ARK2C	Q6ZSG1	439
TMEM200C	L3MBTL4	Q8NA19	418
TMEM200C	TMEM174	Q8WUU8	399
TMEM200C	ADCY1	Q08828	384
TMEM200C	TMEM217	Q8N7C4	370
TMEM200C	PRELID3A	Q96N28	370
TMEM200C	PTCHD4	Q6ZW05	351
TMEM200C	KRTAP8-1	Q8IUC2	348
TMEM200C	INHA	P05111	344
TMEM200C	HS6ST3	Q8IZP7	316

IntAct

2 interactions, top by confidence:

A	B	Type	Score
NEK4	E2F8	psi-mi:“MI:0914”(association)	0.350

BioGRID (5): TMEM200C (Affinity Capture-MS), TMEM200C (Affinity Capture-MS), TMEM200C (Positive Genetic), TMEM200C (Affinity Capture-MS), TMEM200C (Affinity Capture-MS)

ESM2 similar proteins: A0A0U1RQ45, A0A0U1RQS6, A0A2R8YCJ5, A2A699, A2AEV7, A6NGB7, A6NJG2, A6NKF7, A6NKL6, A6NL88, A8MVW0, A9JSM3, B2RU40, B8ZZ34, C9JH25, D4A9R4, J3QNX5, P0CG09, P98077, Q0VD38, Q14761, Q17QH7, Q29RK8, Q2KJ18, Q2M3V2, Q3SX20, Q5BJT1, Q5HZJ5, Q5RKR3, Q5T442, Q64697, Q69YZ2, Q6PB97, Q6PCT2, Q6UXK2, Q6ZMQ8, Q6ZVH7, Q6ZW31, Q80XF7, Q8BLS7

Diamond homologs: A6NKL6, Q5RGQ8, Q69YZ2, Q86VY9, Q8C817

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

1 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	0
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
815978	GRCh37/hg19 18p11.32-11.21(chr18:971295-11250447)x1	Pathogenic

SpliceAI

736 predictions. Top by Δscore:

Variant	Effect	Δscore
18:5894322:C:CA	donor_gain	1.0000
18:5892155:CTG:C	acceptor_gain	0.9900
18:5892158:C:CC	acceptor_gain	0.9900
18:5894363:C:CA	donor_gain	0.9900
18:5894715:A:AC	donor_gain	0.9900
18:5894716:C:CC	donor_gain	0.9900
18:5895028:AC:A	donor_gain	0.9900
18:5895029:CC:C	donor_gain	0.9900
18:5892156:TG:T	acceptor_gain	0.9800
18:5892158:C:A	acceptor_loss	0.9800
18:5894318:AACTC:A	donor_gain	0.9800
18:5894733:C:CA	donor_gain	0.9800
18:5895024:ACTT:A	donor_loss	0.9800
18:5895026:TTA:T	donor_loss	0.9800
18:5895027:TA:T	donor_loss	0.9800
18:5895028:A:AC	donor_gain	0.9800
18:5895028:ACCC:A	donor_loss	0.9800
18:5895029:C:CC	donor_gain	0.9800
18:5895029:C:CG	donor_loss	0.9800
18:5890214:T:A	donor_gain	0.9700
18:5892153:TCCTG:T	acceptor_gain	0.9700
18:5892154:CCTGC:C	acceptor_gain	0.9700
18:5894323:C:A	donor_gain	0.9700
18:5892166:C:CT	acceptor_gain	0.9600
18:5892167:A:T	acceptor_gain	0.9500
18:5895029:CCCA:C	donor_gain	0.9500
18:5892161:C:CT	acceptor_gain	0.9400
18:5892547:C:A	donor_gain	0.9400
18:5895028:ACC:A	donor_gain	0.9400
18:5895029:CCC:C	donor_gain	0.9400

AlphaMissense

3978 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
18:5891444:A:T	V207D	0.999
18:5891522:A:T	I181N	0.999
18:5891537:C:T	G176D	0.999
18:5891538:C:G	G176R	0.999
18:5891544:C:G	G174R	0.999
18:5891868:C:G	G66R	0.999
18:5892035:A:G	I10T	0.999
18:5892050:C:T	G5D	0.999
18:5892056:G:T	A3D	0.999
18:5892059:A:C	I2S	0.999
18:5892059:A:T	I2N	0.999
18:5891465:A:G	L200P	0.998
18:5891520:A:G	C182R	0.998
18:5891524:G:C	F180L	0.998
18:5891524:G:T	F180L	0.998
18:5891525:A:G	F180S	0.998
18:5891526:A:G	F180L	0.998
18:5891528:A:G	L179P	0.998
18:5891530:G:C	F178L	0.998
18:5891530:G:T	F178L	0.998
18:5891532:A:G	F178L	0.998
18:5891534:A:T	I177N	0.998
18:5891543:C:T	G174D	0.998
18:5891546:A:C	M173R	0.998
18:5891546:A:T	M173K	0.998
18:5891552:A:T	L171H	0.998
18:5891558:C:T	G169E	0.998
18:5891867:C:T	G66D	0.998
18:5891888:C:T	G59E	0.998
18:5891889:C:G	G59R	0.998

dbSNP variants (sampled 300 via entrez): RS1000043870 (18:5892388 T>C,G), RS1000074413 (18:5884883 A>G), RS1000147607 (18:5885168 T>C), RS1000419096 (18:5891344 CGCCGCGGCGGGGGCAGACGACGACGAAGAGGCGGCGGCG>C,CGCCGCGGCGGGGGCAGACGACGACGAAGAGGCGGCGGCGGCCGCGGCGGGGGCAGACGACGACGAAGAGGCGGCGGCG), RS1000565051 (18:5890568 G>A), RS1000625738 (18:5897556 A>G), RS1000637031 (18:5890721 G>A,T), RS1000657092 (18:5897881 C>A,T), RS1001131272 (18:5896138 C>T), RS1001153194 (18:5883809 T>C), RS1001500734 (18:5895841 T>C,G), RS1001712430 (18:5896387 G>A,C), RS1001772045 (18:5896184 G>A), RS1002105428 (18:5897268 T>G), RS1002146937 (18:5885853 T>C)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

23 total (human), top 23 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Phenylmercuric Acetate	affects cotreatment, increases expression	2
Aflatoxin B1	decreases methylation, increases methylation	2
bisphenol F	affects cotreatment, increases expression	1
methylmercuric chloride	increases expression	1
propionaldehyde	decreases expression	1
bisphenol A	increases expression, affects cotreatment	1
sodium arsenite	decreases expression	1
ferrous chloride	decreases expression	1
S-(1,2-dichlorovinyl)cysteine	affects response to substance, increases expression, decreases expression	1
CGP 52608	affects binding, increases reaction	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
abrine	increases expression	1
dorsomorphin	affects cotreatment, increases expression	1
Sunitinib	increases expression	1
Benzo(a)pyrene	affects methylation	1
Dexamethasone	affects cotreatment, increases expression	1
Doxorubicin	decreases expression	1
Indomethacin	affects cotreatment, increases expression	1
Lipopolysaccharides	affects response to substance, increases expression	1
Tobacco Smoke Pollution	decreases expression	1
Valproic Acid	decreases methylation	1
1-Methyl-3-isobutylxanthine	affects cotreatment, increases expression	1
Cadmium Chloride	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.