TMEM260

Summary

TMEM260 (transmembrane protein 260, HGNC:20185) is a protein-coding gene on chromosome 14q22.3, encoding Protein O-mannosyl-transferase TMEM260 (Q9NX78). O-mannosyl-transferase that transfers mannosyl residues to the hydroxyl group of serine or threonine residues of proteins.

Enables dolichyl-phosphate-mannose-protein mannosyltransferase activity. Involved in protein maturation. Is active in endoplasmic reticulum membrane. Implicated in T-cell non-Hodgkin lymphoma; non-Hodgkin lymphoma; and stomach cancer.

Source: NCBI Gene 54916 — RefSeq curated summary.

At a glance

• Gene–disease (curated): structural heart defects and renal anomalies syndrome (Strong, GenCC)
• GWAS associations: 1
• Clinical variants (ClinVar): 198 total — 15 pathogenic, 12 likely-pathogenic
• Phenotypes (HPO): 25
• MANE Select transcript: NM_017799

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:20185
Approved symbol	TMEM260
Name	transmembrane protein 260
Location	14q22.3
Locus type	gene with protein product
Status	Approved
Aliases	FLJ20392
Ensembl gene	ENSG00000070269
Ensembl biotype	protein_coding
OMIM	617449
Entrez	54916

Gene structure

Transcript identifiers

Ensembl transcripts: 25 — 13 protein_coding, 5 nonsense_mediated_decay, 5 retained_intron, 2 protein_coding_CDS_not_defined

ENST00000261556, ENST00000538838, ENST00000539559, ENST00000553335, ENST00000554981, ENST00000555046, ENST00000555497, ENST00000555905, ENST00000556079, ENST00000556422, ENST00000556648, ENST00000556810, ENST00000556929, ENST00000556975, ENST00000557626, ENST00000557657, ENST00000885313, ENST00000885314, ENST00000885315, ENST00000885316, ENST00000885317, ENST00000885318, ENST00000931870, ENST00000965391, ENST00000965392

RefSeq mRNA: 1 — MANE Select: NM_017799 NM_017799

CCDS: CCDS9727

Canonical transcript exons

ENST00000261556 — 16 exons

Exon	Start	End
ENSE00001348927	56579798	56580074
ENSE00003482250	56605570	56605683
ENSE00003532501	56634899	56634952
ENSE00003538568	56617183	56617297
ENSE00003538691	56625382	56625530
ENSE00003543042	56585001	56585032
ENSE00003561603	56615944	56616027
ENSE00003601825	56621531	56621702
ENSE00003620396	56647243	56649515
ENSE00003624544	56632995	56633171
ENSE00003643501	56603815	56603992
ENSE00003653225	56612245	56612285
ENSE00003664409	56585761	56585912
ENSE00003672709	56636508	56636598
ENSE00003686388	56618594	56618763
ENSE00003694175	56609106	56609285

Expression profiles

Bgee: expression breadth ubiquitous, 269 present calls, max score 95.47.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 18.1391 / max 135.7699, expressed in 1812 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
139777	9.7353	1781
139776	8.3947	1772
139778	0.0091	1

Top tissues by expression

285 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
corpus epididymis	UBERON:0004359	95.47	gold quality
caput epididymis	UBERON:0004358	94.69	gold quality
cauda epididymis	UBERON:0004360	93.12	gold quality
sperm	CL:0000019	92.94	gold quality
endometrium	UBERON:0001295	89.37	gold quality
male germ cell	CL:0000015	89.23	gold quality
corpus callosum	UBERON:0002336	88.41	gold quality
mucosa of paranasal sinus	UBERON:0005030	88.28	gold quality
trabecular bone tissue	UBERON:0002483	88.20	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	88.08	gold quality
jejunal mucosa	UBERON:0000399	87.82	gold quality
calcaneal tendon	UBERON:0003701	87.32	gold quality
superficial temporal artery	UBERON:0001614	86.85	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	86.32	gold quality
colonic epithelium	UBERON:0000397	86.25	gold quality
blood	UBERON:0000178	86.17	gold quality
bronchial epithelial cell	CL:0002328	86.04	gold quality
endocervix	UBERON:0000458	85.73	gold quality
adrenal tissue	UBERON:0018303	85.11	gold quality
colonic mucosa	UBERON:0000317	84.70	gold quality
oral cavity	UBERON:0000167	84.55	gold quality
uterus	UBERON:0000995	84.53	gold quality
right ovary	UBERON:0002118	84.50	gold quality
mucosa of sigmoid colon	UBERON:0004993	84.48	gold quality
left ovary	UBERON:0002119	84.41	gold quality
lower lobe of lung	UBERON:0008949	84.36	gold quality
islet of Langerhans	UBERON:0000006	83.99	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	83.97	gold quality
epithelium of nasopharynx	UBERON:0001951	83.90	gold quality
right hemisphere of cerebellum	UBERON:0014890	83.83	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	5.51

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

185 targeting TMEM260, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-9-5P	100.00	72.28	2361
HSA-MIR-3924	100.00	72.09	2394
HSA-MIR-1252-5P	100.00	69.80	2774
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-4673	100.00	66.64	1490
HSA-MIR-1184	99.99	68.19	1458
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-4803	99.98	71.99	3117
HSA-MIR-103A-3P	99.98	69.14	1595
HSA-MIR-107	99.98	69.14	1595
HSA-MIR-5696	99.98	72.36	4487
HSA-MIR-568	99.98	69.86	2084
HSA-MIR-4645-5P	99.98	65.81	1284
HSA-MIR-548N	99.98	71.94	4170
HSA-MIR-607	99.97	73.62	5593
HSA-MIR-507	99.97	70.11	1915
HSA-MIR-548AN	99.97	70.91	2817
HSA-MIR-7152-3P	99.97	67.47	849
HSA-MIR-3065-5P	99.97	71.56	3281
HSA-MIR-512-3P	99.97	67.35	1049
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-557	99.96	70.01	1640
HSA-MIR-4666A-3P	99.96	71.71	3434
HSA-MIR-1468-3P	99.96	72.74	3797
HSA-MIR-96-5P	99.95	72.80	2140
HSA-MIR-335-3P	99.93	73.36	4958
HSA-MIR-6753-3P	99.93	66.57	637
HSA-MIR-7107-3P	99.93	66.73	627

Literature-anchored findings (GeneRIF, showing 6)

• Data indicate that rs4901706, located in the 3’ UTR of C14orf101, was shown to be independently related to overall survival in non-Hodgkin lymphoma (NHL). (PMID:24831772)
• Study showed that truncating mutations in TMEM260 cause a syndrome characterized by central nervous sustem, cardiac, renal, and axial skeletal defects. Notably, the homozygous truncating mutations found in the two families affected specifically one of the two splice isoforms generated by this locus, arguing specificity in the phenotypic driver. (PMID:28318500)
• Biallelic TMEM260 variants cause truncus arteriosus, with or without renal defects. (PMID:34612517)
• The SHDRA syndrome-associated gene TMEM260 encodes a protein-specific O-mannosyltransferase. (PMID:37186866)
• Genetic etiology of truncus arteriosus excluding 22q11.2 deletion syndrome and identification of c.1617del, a prevalent variant in TMEM260, in the Japanese population. (PMID:38351237)
• The c.1617del variant of TMEM260 is identified as the most frequent single gene determinant for Japanese patients with a specific type of congenital heart disease. (PMID:38409496)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	tmem260	ENSDARG00000076362
mus_musculus	Tmem260	ENSMUSG00000036339
rattus_norvegicus	Tmem260	ENSRNOG00000013353

Protein

Protein identifiers

Protein O-mannosyl-transferase TMEM260 — Q9NX78 (reviewed: Q9NX78)

Alternative names: Transmembrane protein 260

All UniProt accessions (8): Q9NX78, F5H7D0, G3V320, G3V4A2, G3V4Y3, H0YJK2, H0YJX9, H0YK00

UniProt curated annotations — full annotation on UniProt →

Function. O-mannosyl-transferase that transfers mannosyl residues to the hydroxyl group of serine or threonine residues of proteins. Specifically glycosylates the IPT/TIG domain of target proteins, such as MET and MST1R/RON. TMEM260-mediated O-mannosylated residues are composed of single mannose glycans that are not elongated or modified.

Subcellular location. Endoplasmic reticulum membrane Membrane.

Tissue specificity. Expressed in brain, heart, kidney, liver, lung, pancreas and placenta but are not detected in skeletal muscle. Expressed in brain, heart, kidney, liver, lung, pancreas and placenta but are not detected in skeletal muscle.

Disease relevance. Structural heart defects and renal anomalies syndrome (SHDRA) [MIM:617478] An autosomal recessive syndrome characterized by central nervous system, cardiac, renal, and digit abnormalities. Clinical features include ventricular and atrial septal defects, truncus arteriosus, tetralogy of Fallot, partial anomalous pulmonary venous return, renal cysts, renal failure, and generalized edema. Some patients show partial agenesis of corpus callosum. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the glycosyltransferase 117 (GT117) family.

Isoforms (3)

UniProt ID	Names	Canonical?
Q9NX78-1	1, Long	yes
Q9NX78-2	2
Q9NX78-3	3, Short

RefSeq proteins (1): NP_060269* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR021280	TMEM260_N	Domain
IPR052724	GT117_domain-containing	Family

Pfam: PF11028

Catalyzed reactions (Rhea), 2 shown:

• a di-trans,poly-cis-dolichyl beta-D-mannosyl phosphate + L-seryl-[protein] = 3-O-(alpha-D-mannosyl)-L-seryl-[protein] + a di-trans,poly-cis-dolichyl phosphate + H(+) (RHEA:17377)
• a di-trans,poly-cis-dolichyl beta-D-mannosyl phosphate + L-threonyl-[protein] = 3-O-(alpha-D-mannosyl)-L-threonyl-[protein] + a di-trans,poly-cis-dolichyl phosphate + H(+) (RHEA:53396)

UniProt features (29 total): transmembrane region 8, sequence variant 8, sequence conflict 4, glycosylation site 3, splice variant 3, chain 1, mutagenesis site 1, topological domain 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9NX78-F1	92.65	0.85

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Glycosylation sites (3): 407, 535, 568

Mutagenesis-validated functional residues (1):

Position	Phenotype
52	abolished o-mannosyltransferase activity.

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 202 (showing top): GSE45365_HEALTHY_VS_MCMV_INFECTION_CD8_TCELL_IFNAR_KO_UP, GOBP_CARBOHYDRATE_DERIVATIVE_METABOLIC_PROCESS, GOBP_PROTEIN_MATURATION, GOBP_CARBOHYDRATE_DERIVATIVE_BIOSYNTHETIC_PROCESS, CCTGTGA_MIR513, BOYAULT_LIVER_CANCER_SUBCLASS_G12_UP, GOBP_PROTEIN_O_LINKED_GLYCOSYLATION, GOBP_GLYCOPROTEIN_METABOLIC_PROCESS, NUYTTEN_EZH2_TARGETS_DN, GOCC_NUCLEAR_OUTER_MEMBRANE_ENDOPLASMIC_RETICULUM_MEMBRANE_NETWORK, GOCC_ORGANELLE_SUBCOMPARTMENT, GOMF_HEXOSYLTRANSFERASE_ACTIVITY, GOMF_MANNOSYLTRANSFERASE_ACTIVITY, GOMF_GLYCOSYLTRANSFERASE_ACTIVITY, ATGAAGG_MIR205

GO Biological Process (2): protein maturation (GO:0051604), protein O-linked glycosylation via mannose (GO:0035269)

GO Molecular Function (3): dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169), transferase activity (GO:0016740), glycosyltransferase activity (GO:0016757)

GO Cellular Component (3): endoplasmic reticulum membrane (GO:0005789), endoplasmic reticulum (GO:0005783), membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
gene expression	1
protein metabolic process	1
protein O-linked glycosylation	1
mannosyltransferase activity	1
protein O-linked glycosylation via mannose	1
catalytic activity, acting on a protein	1
catalytic activity	1
transferase activity	1
organelle membrane	1
nuclear outer membrane-endoplasmic reticulum membrane network	1
endoplasmic reticulum subcompartment	1
cytoplasm	1
endomembrane system	1
intracellular membrane-bounded organelle	1
cellular anatomical structure	1

Protein interactions and networks

STRING

442 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TMEM260	TOGARAM1	Q9Y4F4	601
TMEM260	GOLGA7	Q7Z5G4	505
TMEM260	FAM111A	Q96PZ2	499
TMEM260	TMEM70	Q9BUB7	491
TMEM260	ALKBH8	Q96BT7	478
TMEM260	ARHGAP31	Q2M1Z3	476
TMEM260	TCTN1	Q2MV58	475
TMEM260	QDPR	P09417	456
TMEM260	CTC1	Q2NKJ3	453
TMEM260	FAM149B1	Q96BN6	451
TMEM260	RNF135	Q8IUD6	447
TMEM260	KRT81	Q14533	445
TMEM260	AHI1	Q8N157	444
TMEM260	KIF2A	O00139	443
TMEM260	TBX6	O95947	438

IntAct

7 interactions, top by confidence:

A	B	Type	Score
CANX	HLA-A	psi-mi:“MI:0914”(association)	0.350
DNAJB4	HSPA8	psi-mi:“MI:0914”(association)	0.350
ATG16L1	ESYT2	psi-mi:“MI:0914”(association)	0.350
CXCL16	SCAMP1	psi-mi:“MI:0914”(association)	0.350
TMEM260	MYH3	psi-mi:“MI:0914”(association)	0.350
SLC24A5	NBAS	psi-mi:“MI:0914”(association)	0.350

BioGRID (27): MYH3 (Affinity Capture-MS), MYH1 (Affinity Capture-MS), MYH7 (Affinity Capture-MS), MYH4 (Affinity Capture-MS), MYLK2 (Affinity Capture-MS), CYP2C18 (Affinity Capture-MS), MYL1 (Affinity Capture-MS), CYP2C18 (Affinity Capture-MS), MYH1 (Affinity Capture-MS), MYH3 (Affinity Capture-MS), MYH4 (Affinity Capture-MS), MYLK2 (Affinity Capture-MS), MYH7 (Affinity Capture-MS), TMEM260 (Affinity Capture-MS), MYH1 (Affinity Capture-MS)

ESM2 similar proteins: A4IF87, A9JRL3, E9PYK3, F1ND48, G1SPE9, O15228, O93479, O94952, O95870, P50747, P59764, P98192, Q08CZ0, Q09M05, Q1HAQ0, Q1JPD2, Q1LWG4, Q2KIX2, Q3TFD2, Q4R6Y8, Q4R8P0, Q4U2V3, Q5R5S1, Q5R6S0, Q5XGM5, Q641K1, Q6MG55, Q6PBN5, Q7L5N7, Q7ZU92, Q80U95, Q80V94, Q8BMD6, Q8BYI6, Q8K2I9, Q8N1I0, Q8NEC7, Q8NF37, Q8NFZ0, Q8NHU2

Diamond homologs: Q8BMD6, Q8MXQ3, Q9NX78

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

198 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	15
Likely pathogenic	12
Uncertain significance	120
Likely benign	18
Benign	8

Top pathogenic / likely-pathogenic (27)

Variant ID	HGVS	Classification
1070500	NM_017799.4(TMEM260):c.766dup (p.Gln256fs)	Pathogenic
1076778	NM_017799.4(TMEM260):c.1070G>A (p.Trp357Ter)	Pathogenic
1202596	NM_017799.4(TMEM260):c.193-2A>G	Pathogenic
1264353	NM_017799.4(TMEM260):c.1644del (p.Pro549fs)	Pathogenic
1319994	NM_017799.4(TMEM260):c.344G>A (p.Arg115Lys)	Pathogenic
1319995	NM_017799.4(TMEM260):c.160+2159_344+1212del	Pathogenic
1805962	NM_017799.4(TMEM260):c.1783_1795dup (p.Phe599Ter)	Pathogenic
1992344	NM_017799.4(TMEM260):c.862del (p.Gln288fs)	Pathogenic
1992345	NM_017799.4(TMEM260):c.1410C>A (p.Tyr470Ter)	Pathogenic
3242582	NM_017799.4(TMEM260):c.1519_1522dup (p.Tyr508fs)	Pathogenic
3382584	NM_017799.4(TMEM260):c.344+1dup	Pathogenic
3895544	NC_000014.8:g.(57088421_57092099)_(57092249_57099712)del	Pathogenic
426076	NM_017799.4(TMEM260):c.1698_1701del (p.Tyr567fs)	Pathogenic
4819795	NM_017799.4(TMEM260):c.1617del (p.Trp539fs)	Pathogenic
987334	NM_017799.4(TMEM260):c.721dup (p.Tyr241fs)	Pathogenic
1202597	NM_017799.4(TMEM260):c.1744G>C (p.Glu582Gln)	Likely pathogenic
1202618	NM_017799.4(TMEM260):c.1869+1G>T	Likely pathogenic
1325201	NM_017799.4(TMEM260):c.1694_1698delinsA (p.Ser565fs)	Likely pathogenic
1678358	NM_017799.4(TMEM260):c.733G>A (p.Ala245Thr)	Likely pathogenic
2582624	NM_017799.4(TMEM260):c.257del (p.Pro86fs)	Likely pathogenic
3233416	NM_017799.4(TMEM260):c.1472G>A (p.Trp491Ter)	Likely pathogenic
3251958	NM_017799.4(TMEM260):c.1966dup (p.Arg656fs)	Likely pathogenic
3337701	NM_017799.4(TMEM260):c.170_171del (p.Ile57fs)	Likely pathogenic
3383049	NM_017799.4(TMEM260):c.814del (p.Leu272fs)	Likely pathogenic
3899331	NM_017799.4(TMEM260):c.417G>A (p.Trp139Ter)	Likely pathogenic
4077697	NM_017799.4(TMEM260):c.1360G>T (p.Glu454Ter)	Likely pathogenic
974872	NM_017799.4(TMEM260):c.1688del (p.Thr563fs)	Likely pathogenic

SpliceAI

3216 predictions. Top by Δscore:

Variant	Effect	Δscore
14:56585029:TGGA:T	donor_gain	1.0000
14:56585030:GGA:G	donor_gain	1.0000
14:56585030:GGAG:G	donor_gain	1.0000
14:56585031:GA:G	donor_gain	1.0000
14:56585031:GAG:G	donor_gain	1.0000
14:56585032:AG:A	donor_loss	1.0000
14:56585033:G:GG	donor_gain	1.0000
14:56585033:GTA:G	donor_loss	1.0000
14:56585034:T:A	donor_loss	1.0000
14:56585756:CGTAG:C	acceptor_loss	1.0000
14:56585757:GTAGG:G	acceptor_loss	1.0000
14:56585758:TAGG:T	acceptor_loss	1.0000
14:56585760:G:A	acceptor_loss	1.0000
14:56618697:GGCT:G	donor_gain	1.0000
14:56618698:GCT:G	donor_gain	1.0000
14:56618711:G:GT	donor_gain	1.0000
14:56618712:A:T	donor_gain	1.0000
14:56618736:T:TA	donor_gain	1.0000
14:56618737:A:AA	donor_gain	1.0000
14:56621529:A:AG	acceptor_gain	1.0000
14:56621530:G:GG	acceptor_gain	1.0000
14:56621530:GT:G	acceptor_gain	1.0000
14:56621699:GGAA:G	donor_gain	1.0000
14:56621700:G:GT	donor_gain	1.0000
14:56621700:GAA:G	donor_gain	1.0000
14:56621703:G:GG	donor_gain	1.0000
14:56625470:G:GT	donor_gain	1.0000
14:56625517:G:GT	donor_gain	1.0000
14:56625531:G:GG	donor_gain	1.0000
14:56632993:A:AG	acceptor_gain	1.0000

AlphaMissense

4605 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
14:56585767:C:G	H67D	0.999
14:56609214:T:A	W249R	0.999
14:56609214:T:C	W249R	0.999
14:56609260:G:C	R264T	0.999
14:56634915:T:A	W581R	0.999
14:56634915:T:C	W581R	0.999
14:56634917:G:C	W581C	0.999
14:56634917:G:T	W581C	0.999
14:56580068:G:C	D52H	0.998
14:56580069:A:T	D52V	0.998
14:56585007:T:C	L56P	0.998
14:56585769:T:A	H67Q	0.998
14:56585769:T:G	H67Q	0.998
14:56603906:T:C	F146L	0.998
14:56603908:T:A	F146L	0.998
14:56603908:T:G	F146L	0.998
14:56605603:A:C	S186R	0.998
14:56605605:T:A	S186R	0.998
14:56605605:T:G	S186R	0.998
14:56609216:G:C	W249C	0.998
14:56609216:G:T	W249C	0.998
14:56609260:G:T	R264M	0.998
14:56609261:G:C	R264S	0.998
14:56609261:G:T	R264S	0.998
14:56618603:T:C	F356L	0.998
14:56618605:C:A	F356L	0.998
14:56618605:C:G	F356L	0.998
14:56621626:A:C	D441A	0.998
14:56621626:A:G	D441G	0.998
14:56621626:A:T	D441V	0.998

dbSNP variants (sampled 300 via entrez): RS1000000539 (14:56617633 C>T), RS1000013854 (14:56639254 CAGGGTAACTACAGCCAACA>C), RS1000047379 (14:56577603 T>C), RS1000077251 (14:56616772 A>G), RS1000160551 (14:56593624 T>C,G), RS1000207296 (14:56635406 C>T), RS1000222088 (14:56661218 C>A,T), RS1000239277 (14:56639077 G>A), RS1000255766 (14:56593516 T>C), RS1000395585 (14:56650371 G>A), RS1000450515 (14:56605587 T>A), RS1000454575 (14:56658752 A>G), RS1000499959 (14:56621348 A>G,T), RS1000538579 (14:56622376 A>G), RS1000548879 (14:56662793 T>C)

Disease associations

OMIM: gene MIM:617449 | disease phenotypes: MIM:617478

GenCC curated gene-disease

Disease	Classification	Inheritance
structural heart defects and renal anomalies syndrome	Strong	Autosomal recessive

Mondo (1): structural heart defects and renal anomalies syndrome (MONDO:0044321)

Orphanet (1): Structural heart defects-renal anomalies syndrome (Orphanet:689822)

HPO phenotypes

25 total (25 of 25 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000083	Renal insufficiency
HP:0000107	Renal cyst
HP:0000252	Microcephaly
HP:0000369	Low-set ears
HP:0000384	Preauricular skin tag
HP:0000465	Webbed neck
HP:0000961	Cyanosis
HP:0001319	Neonatal hypotonia
HP:0001338	Partial agenesis of the corpus callosum
HP:0001522	Death in infancy
HP:0001629	Ventricular septal defect
HP:0001631	Atrial septal defect
HP:0001636	Tetralogy of Fallot
HP:0001660	Truncus arteriosus
HP:0001845	Overlapping toe
HP:0001999	Abnormal facial shape
HP:0003259	Elevated circulating creatinine concentration
HP:0005301	Persistent left superior vena cava
HP:0007430	Generalized edema
HP:0010773	Partial anomalous pulmonary venous return
HP:0011611	Interrupted aortic arch
HP:0011662	Tricuspid atresia
HP:0012020	Right aortic arch
HP:0031664	Systolic heart murmur

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST004639_25	Prudent dietary pattern	5.000000e-06

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0008111	diet measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

19 total (human), top 19 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, increases expression, decreases methylation	4
bisphenol A	decreases methylation, increases expression	2
sodium arsenite	decreases expression	2
triphenyl phosphate	affects expression	1
beta-lapachone	decreases expression, increases expression	1
perfluoro-n-nonanoic acid	affects methylation	1
Sunitinib	increases expression	1
Air Pollutants	decreases expression, increases abundance	1
Dichlorodiphenyl Dichloroethylene	decreases expression	1
Hydralazine	affects cotreatment, increases expression	1
Hydrogen Peroxide	affects cotreatment, decreases expression	1
Silicon Dioxide	decreases expression	1
Theophylline	affects cotreatment, decreases expression	1
Tobacco Smoke Pollution	affects expression	1
Vitamin E	decreases expression	1
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression	1
Okadaic Acid	decreases expression	1
Copper Sulfate	decreases expression	1
Particulate Matter	decreases expression, increases abundance	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.