TMEM266

Summary

TMEM266 (transmembrane protein 266, HGNC:26763) is a protein-coding gene on chromosome 15q24.2, encoding Transmembrane protein 266 (Q2M3C6). Voltage-sensor protein present on the post-synaptic side of glutamatergic mossy fibers and granule cells in the cerebellum.

Enables protein homodimerization activity. Predicted to be involved in transmembrane transport. Located in cytosol; dendrite; and plasma membrane.

Source: NCBI Gene 123591 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 93 total
• MANE Select transcript: NM_152335

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:26763
Approved symbol	TMEM266
Name	transmembrane protein 266
Location	15q24.2
Locus type	gene with protein product
Status	Approved
Aliases	FLJ38190
Ensembl gene	ENSG00000169758
Ensembl biotype	protein_coding
OMIM	618691
Entrez	123591

Gene structure

Transcript identifiers

Ensembl transcripts: 8 — 4 protein_coding, 2 nonsense_mediated_decay, 1 retained_intron, 1 protein_coding_CDS_not_defined

ENST00000388942, ENST00000484722, ENST00000558249, ENST00000559079, ENST00000561302, ENST00000902737, ENST00000902738, ENST00000902739

RefSeq mRNA: 1 — MANE Select: NM_152335 NM_152335

Canonical transcript exons

ENST00000388942 — 11 exons

Exon	Start	End
ENSE00001504452	76156604	76156758
ENSE00001881005	76203741	76204963
ENSE00002474091	76137707	76137895
ENSE00002538938	76059985	76060016
ENSE00002569427	76134168	76134301
ENSE00003470968	76169816	76169872
ENSE00003504310	76191968	76192157
ENSE00003531476	76170993	76171131
ENSE00003576205	76202202	76202264
ENSE00003635511	76160095	76160168
ENSE00003650456	76175559	76175674

Expression profiles

Bgee: expression breadth ubiquitous, 176 present calls, max score 93.91.

FANTOM5 (CAGE): breadth broad, TPM avg 0.6834 / max 149.4574, expressed in 228 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
147838	0.4295	137
147837	0.2539	132

Top tissues by expression

241 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right hemisphere of cerebellum	UBERON:0014890	93.91	gold quality
cerebellar hemisphere	UBERON:0002245	93.83	gold quality
cerebellar cortex	UBERON:0002129	93.81	gold quality
cerebellum	UBERON:0002037	93.24	gold quality
hindlimb stylopod muscle	UBERON:0004252	82.68	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	82.13	gold quality
muscle of leg	UBERON:0001383	78.90	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	78.56	gold quality
gastrocnemius	UBERON:0001388	78.33	gold quality
cerebellar vermis	UBERON:0004720	77.79	gold quality
right frontal lobe	UBERON:0002810	76.80	gold quality
body of pancreas	UBERON:0001150	76.17	gold quality
prefrontal cortex	UBERON:0000451	75.16	gold quality
vastus lateralis	UBERON:0001379	74.64	silver quality
right adrenal gland cortex	UBERON:0035827	74.40	gold quality
Brodmann (1909) area 9	UBERON:0013540	74.38	gold quality
quadriceps femoris	UBERON:0001377	74.32	silver quality
right adrenal gland	UBERON:0001233	73.68	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	73.00	gold quality
frontal cortex	UBERON:0001870	72.70	gold quality
primary visual cortex	UBERON:0002436	72.68	gold quality
adrenal tissue	UBERON:0018303	72.38	gold quality
pituitary gland	UBERON:0000007	72.15	gold quality
neocortex	UBERON:0001950	71.97	gold quality
adenohypophysis	UBERON:0002196	71.81	gold quality
left adrenal gland	UBERON:0001234	71.75	gold quality
skeletal muscle tissue	UBERON:0001134	71.71	gold quality
anterior cingulate cortex	UBERON:0009835	71.35	gold quality
muscle tissue	UBERON:0002385	70.55	gold quality
left adrenal gland cortex	UBERON:0035825	70.28	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-GEOD-111727	yes	141.54
E-ANND-3	yes	5.52

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

48 targeting TMEM266, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-126-5P	100.00	72.71	3180
HSA-MIR-512-3P	99.97	67.35	1049
HSA-MIR-9-3P	99.96	70.88	2068
HSA-MIR-128-3P	99.95	71.17	2484
HSA-MIR-216A-3P	99.95	71.19	2505
HSA-MIR-6783-3P	99.89	67.92	2059
HSA-MIR-1343-3P	99.89	66.78	1815
HSA-MIR-3681-3P	99.88	70.46	2254
HSA-MIR-605-3P	99.88	69.22	1833
HSA-MIR-6756-5P	99.82	67.97	2466
HSA-MIR-148A-3P	99.74	73.77	1700
HSA-MIR-148B-3P	99.74	73.75	1700
HSA-MIR-152-3P	99.74	73.75	1703
HSA-MIR-378G	99.71	64.90	1106
HSA-MIR-5004-5P	99.68	66.63	1294
HSA-MIR-6766-5P	99.68	67.70	2325
HSA-MIR-24-3P	99.59	69.97	1934
HSA-MIR-7844-5P	99.55	68.56	1428
HSA-MIR-1224-5P	99.48	65.59	803
HSA-MIR-1207-3P	98.99	66.22	1532
HSA-MIR-224-3P	98.91	68.42	1815
HSA-MIR-522-3P	98.91	68.56	1817
HSA-MIR-4709-3P	98.88	68.04	1594
HSA-MIR-29B-1-5P	98.86	68.35	1364
HSA-MIR-873-5P	98.84	66.90	1348
HSA-MIR-4635	98.74	67.63	1339
HSA-MIR-330-5P	98.73	67.63	1788
HSA-MIR-6840-3P	98.68	65.95	1923
HSA-MIR-323A-5P	98.59	65.13	651

Literature-anchored findings (GeneRIF, showing 2)

• Results identified HVRP1, a voltage sensing domains-containing protein primarily expressed in the central nervous system with high expression in cerebellar tissues particularly in the granule layer. (PMID:25165868)
• Here the authors show that hTMEM266 forms oligomers, undergoes both rapid (micros) and slow (ms) structural rearrangements in response to changes in voltage, and contains a Zn(2+) binding site that can regulate the slow conformational transition. Our results demonstrate that the S1-S4 domain in hTMEM266 is a functional voltage sensor. (PMID:30810529)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	tmem266	ENSDARG00000101297
mus_musculus	Tmem266	ENSMUSG00000032313
rattus_norvegicus	Tmem266	ENSRNOG00000015201

Paralogs (6): TNS1 (ENSG00000079308), HVCN1 (ENSG00000122986), TPTE2 (ENSG00000132958), TNS3 (ENSG00000136205), PTEN (ENSG00000171862), TPTE (ENSG00000274391)

Protein

Protein identifiers

Transmembrane protein 266 — Q2M3C6 (reviewed: Q2M3C6)

Alternative names: HV1-related protein 1

All UniProt accessions (3): Q2M3C6, H0YNC9, H3BM28

UniProt curated annotations — full annotation on UniProt →

Function. Voltage-sensor protein present on the post-synaptic side of glutamatergic mossy fibers and granule cells in the cerebellum. Despite the presence of a voltage-sensor segment, does not form a functional ion channel and its precise role remains unclear. Undergoes both rapid and slow structural rearrangements in response to changes in voltage. Contains a zinc-binding site that can regulate the slow conformational transition.

Subunit / interactions. Homodimer; disulfide-linked.

Subcellular location. Cell membrane. Cell projection. Dendrite. Perikaryon.

Tissue specificity. Mainly expressed in the cerebellum. Also expressed in cerebral cortex, skeletal muscle and thyroid, but at much lower levels.

Domain organisation. The transmembrane segment S4 functions as a voltage-sensor and is characterized by a series of positively charged amino acids at every third position. Transplantation of the transmembrane segment S4 into HVCN1, generates a functional voltage-activated proton channel. The coiled coil mediates homodimerization.

RefSeq proteins (1): NP_689548* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR005821	Ion_trans_dom	Domain
IPR027359	Volt_channel_dom_sf	Homologous_superfamily
IPR042857	TMEM266	Family

Pfam: PF00520

UniProt features (23 total): mutagenesis site 6, topological domain 5, transmembrane region 4, compositionally biased region 3, sequence variant 2, chain 1, region of interest 1, coiled-coil region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q2M3C6-F1	54.53	0.06

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Mutagenesis-validated functional residues (6):

Position	Phenotype
103–108	despite residues related to hvcn1 channel, does not show ion channel activity; when associated with 151-m–i-145, a-167,
143–145	despite residues related to hvcn1 channel, does not show ion channel activity; when associated with 111-d–l-108, a-167,
167	despite residues related to hvcn1 channel, does not show ion channel activity; when associated with 111-d–l-108, 151-m-
176–177	despite residues related to hvcn1 channel, does not show ion channel activity; when associated with 111-d–l-108, 151-m-
205	despite residues related to hvcn1 channel, does not show ion channel activity; when associated with 111-d–l-108, 151-m-
209–214	despite residues related to hvcn1 channel, does not show ion channel activity; when associated with 111-d–l-108, 151-m-

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 75 (showing top): TGGTGCT_MIR29A_MIR29B_MIR29C, TAATAAT_MIR126, CAGCAGG_MIR370, GOCC_NEURON_PROJECTION, CAGCCTC_MIR4855P, LEIN_CEREBELLUM_MARKERS, GOCC_CELL_BODY, GOCC_SOMATODENDRITIC_COMPARTMENT, GOCC_PERIKARYON, GOMF_PROTEIN_DIMERIZATION_ACTIVITY, GOMF_GATED_CHANNEL_ACTIVITY, GOMF_PROTEIN_HOMODIMERIZATION_ACTIVITY, GOMF_PASSIVE_TRANSMEMBRANE_TRANSPORTER_ACTIVITY, GOMF_TRANSPORTER_ACTIVITY, DURAND_STROMA_NS_UP

GO Biological Process (1): transmembrane transport (GO:0055085)

GO Molecular Function (3): protein homodimerization activity (GO:0042803), protein binding (GO:0005515), voltage-gated channel activity (GO:0022832)

GO Cellular Component (6): cytosol (GO:0005829), plasma membrane (GO:0005886), dendrite (GO:0030425), perikaryon (GO:0043204), membrane (GO:0016020), cell projection (GO:0042995)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	4
transport	1
cellular process	1
identical protein binding	1
protein dimerization activity	1
binding	1
gated channel activity	1
cytoplasm	1
membrane	1
cell periphery	1
neuron projection	1
dendritic tree	1
neuronal cell body	1

Protein interactions and networks

STRING

406 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TMEM266	TMEM268	Q5VZI3	618
TMEM266	SLC35F4	A4IF30	591
TMEM266	TPTE2	Q6XPS3	489
TMEM266	ESPNL	Q6ZVH7	475
TMEM266	ETF1	P46055	439
TMEM266	SPATA24	Q86W54	436
TMEM266	ETFA	P13804	428
TMEM266	ISL2	Q96A47	425
TMEM266	TPTE	P56180	416
TMEM266	DNAJC18	Q9H819	415
TMEM266	YEATS4	O95619	413
TMEM266	ATP6V1C1	P21283	408
TMEM266	C2CD2	Q9Y426	405
TMEM266	AKNAD1	Q5T1N1	397
TMEM266	ZNF780A	O75290	395

IntAct

11 interactions, top by confidence:

A	B	Type	Score
KDM1A	TMEM266	psi-mi:“MI:0915”(physical association)	0.670
TMEM266	KDM1A	psi-mi:“MI:0914”(association)	0.670
MEOX2	TMEM266	psi-mi:“MI:0915”(physical association)	0.560
WDR5B	TCP1	psi-mi:“MI:0914”(association)	0.530
ESR1	ESYT2	psi-mi:“MI:0914”(association)	0.350
KDM1A	TMEM266	psi-mi:“MI:0915”(physical association)	0.000
MEOX2	TMEM266	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (25): RABEP1 (Affinity Capture-MS), VPS11 (Affinity Capture-MS), TGFBRAP1 (Affinity Capture-MS), STX5 (Affinity Capture-MS), FBXO28 (Affinity Capture-MS), EDRF1 (Affinity Capture-MS), WDR20 (Affinity Capture-MS), HM13 (Affinity Capture-MS), KCMF1 (Affinity Capture-MS), KDM1A (Affinity Capture-MS), C15orf27 (Two-hybrid), C15orf27 (Two-hybrid), C15orf27 (Affinity Capture-MS), WDR20 (Affinity Capture-MS), C15orf27 (Affinity Capture-MS)

ESM2 similar proteins: A0JNG6, A2AKB4, A7YWL5, B0BN13, O35181, O43734, O70142, O70240, O88286, O88566, P0DPB3, P0DPB4, P56975, P70298, P86174, P97303, Q00IB7, Q1LY51, Q2M3C6, Q2T9L4, Q3TY60, Q498S6, Q4V7B1, Q568Z1, Q5HZN9, Q5JTD0, Q5SYB0, Q5U5E5, Q5VT97, Q69ZB8, Q6PG95, Q6UXB0, Q6ZU67, Q76N89, Q80YE4, Q86XD5, Q8BWU3, Q8BZB3, Q8CD60, Q8N365

Diamond homologs: Q1JV40, Q2M3C6, Q3U2S8, Q5F4C0, Q5M7E9, Q5M8L8, Q6DHQ1, Q96D96, Q9N0B5, Q8BZB3, Q4R6N0, Q6XPS3

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

93 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	80
Likely benign	3
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

3057 predictions. Top by Δscore:

Variant	Effect	Δscore
15:76060013:GCAG:G	donor_gain	1.0000
15:76060014:CAGG:C	donor_loss	1.0000
15:76060015:AGGT:A	donor_loss	1.0000
15:76060017:G:C	donor_loss	1.0000
15:76060018:T:A	donor_loss	1.0000
15:76077367:T:G	acceptor_gain	1.0000
15:76134302:G:GG	donor_gain	1.0000
15:76137700:A:AG	acceptor_gain	1.0000
15:76137701:A:G	acceptor_gain	1.0000
15:76137705:A:AG	acceptor_gain	1.0000
15:76137705:AG:A	acceptor_gain	1.0000
15:76137706:G:GC	acceptor_gain	1.0000
15:76137706:GG:G	acceptor_gain	1.0000
15:76137706:GGC:G	acceptor_gain	1.0000
15:76137706:GGCC:G	acceptor_gain	1.0000
15:76137706:GGCCT:G	acceptor_gain	1.0000
15:76137891:GAAGG:G	donor_gain	1.0000
15:76137893:AGG:A	donor_gain	1.0000
15:76137894:GG:G	donor_gain	1.0000
15:76137894:GGG:G	donor_gain	1.0000
15:76137895:GG:G	donor_gain	1.0000
15:76137896:G:GG	donor_gain	1.0000
15:76156757:GT:G	donor_gain	1.0000
15:76169812:TCAGA:T	acceptor_loss	1.0000
15:76169813:CAG:C	acceptor_loss	1.0000
15:76169814:A:AG	acceptor_gain	1.0000
15:76169814:A:T	acceptor_loss	1.0000
15:76169815:G:GG	acceptor_gain	1.0000
15:76169815:GACT:G	acceptor_gain	1.0000
15:76169869:AGAGG:A	donor_loss	1.0000

AlphaMissense

3493 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
15:76160136:A:C	S142R	0.999
15:76160138:C:A	S142R	0.999
15:76160138:C:G	S142R	0.999
15:76191984:T:C	L262P	0.999
15:76171083:A:C	S202R	0.998
15:76171085:C:A	S202R	0.998
15:76171085:C:G	S202R	0.998
15:76171030:C:G	P184R	0.997
15:76156732:T:C	L119P	0.996
15:76171000:A:T	D174V	0.996
15:76171027:C:A	A183D	0.996
15:76171030:C:A	P184Q	0.996
15:76171065:A:C	S196R	0.996
15:76171067:C:A	S196R	0.996
15:76171067:C:G	S196R	0.996
15:76171071:T:A	W198R	0.996
15:76171071:T:C	W198R	0.996
15:76175649:T:C	L248P	0.996
15:76191996:T:C	L266P	0.996
15:76169826:G:C	R156P	0.995
15:76171002:G:A	G175R	0.995
15:76171002:G:C	G175R	0.995
15:76171107:T:A	W210R	0.995
15:76171107:T:C	W210R	0.995
15:76171000:A:C	D174A	0.994
15:76171003:G:A	G175E	0.994
15:76191968:T:C	F257L	0.994
15:76191970:T:A	F257L	0.994
15:76191970:T:G	F257L	0.994
15:76156720:T:C	L115P	0.993

dbSNP variants (sampled 300 via entrez): RS1000026071 (15:76067632 C>A,G,T), RS1000026396 (15:76174636 A>G), RS1000058104 (15:76167738 C>A,T), RS1000072277 (15:76069422 A>G), RS1000098177 (15:76133247 A>G), RS1000117433 (15:76140910 A>G), RS1000124591 (15:76109576 C>T), RS1000131496 (15:76076374 C>T), RS1000149913 (15:76090973 C>G), RS1000169386 (15:76067276 C>G,T), RS1000217643 (15:76190858 C>A,T), RS1000219031 (15:76092643 C>G), RS1000220283 (15:76176828 TGGCCTCAGGGTTGAGGTCTCATGTGGCGTACA>T), RS1000232989 (15:76158529 C>T), RS1000248379 (15:76184725 C>T)

Disease associations

OMIM: gene MIM:618691 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST007876_30	Estimated glomerular filtration rate	3.000000e-25

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

20 total (human), top 20 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation, decreases expression, increases expression	5
Tobacco Smoke Pollution	decreases expression, decreases methylation	2
FR900359	increases phosphorylation	1
bufotalin	decreases expression	1
lasiocarpine	decreases expression	1
methyleugenol	decreases expression	1
propionaldehyde	increases expression	1
benzo(e)pyrene	affects methylation	1
aflatoxin B2	decreases methylation	1
abrine	decreases expression	1
jinfukang	affects cotreatment, decreases expression	1
Fulvestrant	increases methylation	1
Cisplatin	decreases expression, affects cotreatment	1
Dimethyl Sulfoxide	affects expression	1
Lead	affects expression	1
Methapyrilene	affects methylation	1
Nickel	decreases expression	1
Valproic Acid	increases methylation	1
Aflatoxin B1	decreases expression	1
Okadaic Acid	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.