TMEM269-DT
gene geneOn this page
Summary
TMEM269-DT (TMEM269 divergent transcript, HGNC:54423) is a long non-coding RNA gene on chromosome 1p34.2.
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:54423 |
| Approved symbol | TMEM269-DT |
| Name | TMEM269 divergent transcript |
| Location | 1p34.2 |
| Locus type | RNA, long non-coding |
| Status | Approved |
| Entrez | 105378683 |
| RNAcentral | URS00028539CC — lncRNA, 852 nt, 1 organism(s) |
Gene structure
Transcript identifiers
Ensembl transcripts: 0
RefSeq mRNA: 0 — MANE Select: None
Canonical transcript exons
None — 0 exons
Expression profiles
Top tissues by expression
0 total, by Bgee expression score (0-100, higher = more expressed):
Regulation
Is transcription factor: no
Cross-species orthologs
0 orthologs
Protein
Protein identifiers
Canonical reviewed UniProt: None (reviewed: )
All UniProt accessions (0):
RefSeq proteins (0): (*=MANE)
Domains & families (InterPro)
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
Function
Pathways and Gene Ontology
Reactome pathways
0 pathways
MSigDB gene sets: 1 (showing top):
chr1p34
GO Biological Process (0):
GO Molecular Function (0):
GO Cellular Component (0):
Protein interactions and networks
STRING
0 interactions, top by confidence (×1000):
IntAct
0 interactions, top by confidence:
SIGNOR signaling
0 interactions.
Disease & clinical
Clinical variants and AI predictions
ClinVar
0 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 0 |
| Likely pathogenic | 0 |
| Uncertain significance | 0 |
| Likely benign | 0 |
| Benign | 0 |
Top pathogenic / likely-pathogenic (0)
SpliceAI
0 predictions. Top by Δscore:
AlphaMissense
0 scored. Top likely-pathogenic:
dbSNP variants (sampled 300 via entrez): RS1000260002 (1:42786555 C>T), RS1000418913 (1:42786627 G>A,T), RS1000661304 (1:42782330 C>G,T), RS1000713395 (1:42782509 C>G), RS1001742224 (1:42781463 G>A), RS1001866536 (1:42781125 G>T), RS1002194308 (1:42781308 G>A,T), RS1002593046 (1:42776431 T>C), RS1002777390 (1:42779267 C>CTCGGGAGGCTGAGGCAGGAGAATG), RS1003255859 (1:42782223 G>A,C), RS1003698096 (1:42777382 T>G), RS1003708838 (1:42777426 C>A,T), RS1004179104 (1:42780768 T>C), RS1004252250 (1:42779775 G>A,C), RS1004347539 (1:42785785 C>T)
Disease associations
OMIM: gene `` | disease phenotypes:
GenCC curated gene-disease
Mondo (0):
Orphanet (0):
HPO phenotypes
0 total (0 of 0 shown, HPO-id order):
GWAS associations
0 associations (top):
Drugs & pharmacology
Drug and pharmacology data
Is drug target: no
PharmGKB: 0 entries
Clinical trials (associated diseases)
0 trials via MONDO — disease-level, not drug-specific.
Related Atlas pages
No linked Atlas pages yet — the cross-entity mesh grows as the corpus expands.