TMSB15B

Summary

TMSB15B (thymosin beta 15B, HGNC:28612) is a protein-coding gene on chromosome Xq22.2, encoding Thymosin beta-15B (P0CG35). Plays an important role in the organization of the cytoskeleton.

Predicted to enable actin monomer binding activity. Involved in positive regulation of cell migration. Predicted to be located in cytoskeleton. Predicted to be active in cytoplasm.

Source: NCBI Gene 286527 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 12 total — 1 pathogenic
• MANE Select transcript: NM_194324

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:28612
Approved symbol	TMSB15B
Name	thymosin beta 15B
Location	Xq22.2
Locus type	gene with protein product
Status	Approved
Aliases	MGC39900
Ensembl gene	ENSG00000158427
Ensembl biotype	protein_coding
OMIM	301011
Entrez	286527

Gene structure

Transcript identifiers

Ensembl transcripts: 12 — 11 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000419165, ENST00000436583, ENST00000455723, ENST00000540220, ENST00000563257, ENST00000569577, ENST00000877058, ENST00000940745, ENST00000940746, ENST00000940747, ENST00000940748, ENST00000944681

RefSeq mRNA: 3 — MANE Select: NM_194324 NM_001350211, NM_001350212, NM_194324

CCDS: CCDS59172

Canonical transcript exons

ENST00000540220 — 3 exons

Exon	Start	End
ENSE00002284321	103962627	103962723
ENSE00002323640	103965539	103965976
ENSE00003892701	103964506	103964622

Expression profiles

Bgee: expression breadth ubiquitous, 134 present calls, max score 95.10.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 2.1526 / max 100.8505, expressed in 972 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
197122	0.4598	246
197124	0.3844	178
197123	0.3565	182
197121	0.3238	158
197125	0.3187	159
197120	0.3094	171

Top tissues by expression

134 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
ganglionic eminence	UBERON:0004023	95.10	gold quality
ventricular zone	UBERON:0003053	92.92	gold quality
cortical plate	UBERON:0005343	90.93	gold quality
left ovary	UBERON:0002119	85.76	gold quality
tibial artery	UBERON:0007610	85.58	gold quality
popliteal artery	UBERON:0002250	85.56	gold quality
ovary	UBERON:0000992	84.84	gold quality
right ovary	UBERON:0002118	84.70	gold quality
ascending aorta	UBERON:0001496	84.60	gold quality
thoracic aorta	UBERON:0001515	84.58	gold quality
descending thoracic aorta	UBERON:0002345	83.42	gold quality
right coronary artery	UBERON:0001625	83.33	gold quality
left coronary artery	UBERON:0001626	82.91	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	82.60	gold quality
body of uterus	UBERON:0009853	82.18	gold quality
endometrium	UBERON:0001295	81.42	gold quality
endocervix	UBERON:0000458	81.28	gold quality
ectocervix	UBERON:0012249	80.90	gold quality
smooth muscle tissue	UBERON:0001135	80.01	gold quality
mucosa of stomach	UBERON:0001199	79.91	gold quality
left uterine tube	UBERON:0001303	79.82	gold quality
myometrium	UBERON:0001296	79.69	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	79.45	gold quality
uterine cervix	UBERON:0000002	78.93	gold quality
cerebellar hemisphere	UBERON:0002245	78.81	gold quality
cerebellar cortex	UBERON:0002129	78.69	gold quality
stromal cell of endometrium	CL:0002255	78.64	gold quality
islet of Langerhans	UBERON:0000006	78.58	gold quality
cerebellum	UBERON:0002037	78.54	gold quality
right hemisphere of cerebellum	UBERON:0014890	78.14	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-MTAB-9388	yes	9.74
E-ANND-3	no	2.37

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

29 targeting TMSB15B, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-548AA	99.96	70.64	3753
HSA-MIR-548AP-3P	99.96	70.64	3753
HSA-MIR-548T-3P	99.96	70.64	3753
HSA-MIR-22-3P	99.93	68.13	917
HSA-MIR-4496	99.88	68.89	2236
HSA-MIR-137-3P	99.87	74.74	2401
HSA-MIR-221-3P	99.86	71.56	1329
HSA-MIR-222-3P	99.86	71.35	1337
HSA-MIR-7154-5P	99.69	70.52	1900
HSA-MIR-891B	99.59	69.81	1083
HSA-MIR-548G-3P	99.48	68.67	2159
HSA-MIR-6809-5P	99.13	68.45	1223
HSA-MIR-1253	99.12	67.08	1688
HSA-MIR-10524-5P	99.05	66.08	963
HSA-MIR-4699-5P	98.99	67.50	1210
HSA-MIR-8060	98.61	66.93	1187
HSA-MIR-299-5P	98.56	71.14	1140
HSA-MIR-4684-5P	98.29	67.99	1650
HSA-MIR-12120	98.05	68.44	1768
HSA-MIR-4769-3P	97.95	68.17	1002
HSA-MIR-6817-5P	97.95	67.86	1026
HSA-MIR-7113-5P	97.88	67.33	1735
HSA-MIR-3674	97.01	68.86	1171
HSA-MIR-6828-3P	96.06	67.61	1155
HSA-MIR-6821-3P	95.21	66.79	578
HSA-MIR-6753-5P	94.70	64.08	470
HSA-MIR-6800-5P	94.59	64.80	525

Literature-anchored findings (GeneRIF, showing 2)

• TMSL8 is well conserved in many mammalian species. Two isoforms, thymosin beta15a and b, exist at different locations, 1.4Mb apart, on human chromosome X, with 98% identity across the coding sequences. (PMID:17567946)
• Our data show that the TMSB15A and TMSB15B isoforms have distinct expression patterns in different tumor cell lines and tissues. (PMID:19296525)

Cross-species orthologs

0 orthologs

Paralogs (2): TMSB15A (ENSG00000158164), TMSB15C (ENSG00000269226)

Protein

Protein identifiers

Thymosin beta-15B — P0CG35 (reviewed: P0CG35)

All UniProt accessions (2): P0CG35, H3BU88

UniProt curated annotations — full annotation on UniProt →

Function. Plays an important role in the organization of the cytoskeleton. Binds to and sequesters actin monomers (G actin) and therefore inhibits actin polymerization. May be involved in cell migration.

Subcellular location. Cytoplasm. Cytoskeleton.

Tissue specificity. Expressed in colon and colon cancer tissue.

Similarity. Belongs to the thymosin beta family.

RefSeq proteins (3): NP_001337140, NP_001337141, NP_919305* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001152	Beta-thymosin	Family
IPR038386	Beta-thymosin_sf	Homologous_superfamily

Pfam: PF01290

UniProt features (5 total): compositionally biased region 2, initiator methionine 1, chain 1, region of interest 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P0CG35-F1	72.25	0.00

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 82 (showing top): GSE18804_SPLEEN_MACROPHAGE_VS_TUMORAL_MACROPHAGE_UP, BUYTAERT_PHOTODYNAMIC_THERAPY_STRESS_DN, GOBP_ACTIN_FILAMENT_ORGANIZATION, GOMF_ACTIN_BINDING, CUI_TCF21_TARGETS_2_UP, GOCC_FILAMENTOUS_ACTIN, GOMF_CYTOSKELETAL_PROTEIN_BINDING, GOMF_ACTIN_MONOMER_BINDING, chrXq22, JOHNSTONE_PARVB_TARGETS_3_DN, GOBERT_OLIGODENDROCYTE_DIFFERENTIATION_DN, PEDERSEN_METASTASIS_BY_ERBB2_ISOFORM_7, KRIEG_HYPOXIA_NOT_VIA_KDM3A, GOBP_SUPRAMOLECULAR_FIBER_ORGANIZATION, GOCC_SUPRAMOLECULAR_COMPLEX

GO Biological Process (3): actin filament organization (GO:0007015), regulation of cell migration (GO:0030334), positive regulation of cell migration (GO:0030335)

GO Molecular Function (3): actin monomer binding (GO:0003785), protein sequestering activity (GO:0140311), actin binding (GO:0003779)

GO Cellular Component (3): filamentous actin (GO:0031941), cytoplasm (GO:0005737), cytoskeleton (GO:0005856)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cell migration	2
actin cytoskeleton organization	1
supramolecular fiber organization	1
regulation of cell motility	1
regulation of cell migration	1
positive regulation of cell motility	1
actin binding	1
protein binding	1
molecular sequestering activity	1
cytoskeletal protein binding	1
actin filament	1
protein-containing complex	1
intracellular anatomical structure	1
cellular anatomical structure	1
intracellular membraneless organelle	1

Protein interactions and networks

STRING

0 interactions, top by confidence (×1000):

IntAct

0 interactions, top by confidence:

BioGRID (3): TMSB15B (Affinity Capture-RNA), TMSB15A (Affinity Capture-MS), TMSB15A (Cross-Linking-MS (XL-MS))

ESM2 similar proteins: A0A097SRV6, A0A0J1BDH3, O41801, P04605, P0C1K3, P0C766, P0CG34, P0CG35, P0DX04, P12692, P15633, P15835, P18758, P20065, P21113, P21117, P21752, P21753, P26351, P26352, P33248, P33735, P33736, P33737, P34338, P34493, P53768, P60743, P75605, Q12026, Q4UKT5, Q54CC7, Q55GR5, Q5MJ07, Q5MJ08, Q5VSR9, Q66H17, Q6I7R5, Q6SJ84, Q6SJ91

Diamond homologs: O14604, P0CG34, P0CG35, P0DX04, P18758, P20065, P21752, P21753, P26351, P26352, P33248, P34032, P62326, P62327, P62328, P62329, P63312, P63313, P63314, Q5R7H8, Q6S9C5, Q6ZWY8, Q7YRC3, Q8T697, Q95274, Q9DET5, Q9DFJ9, Q9I954, Q9I955, Q9I980, Q9W7M8

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

12 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	6
Likely benign	1
Benign	1

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
564879	GRCh37/hg19 Xq22.2(chrX:102984836-103329001)x2	Pathogenic

SpliceAI

974 predictions. Top by Δscore:

Variant	Effect	Δscore
X:103919293:G:GG	donor_gain	1.0000
X:103919290:TCT:T	donor_gain	0.9900
X:103919290:TCTGT:T	donor_loss	0.9900
X:103919292:TGT:T	donor_loss	0.9900
X:103919293:G:GA	donor_loss	0.9900
X:103919294:TGAG:T	donor_loss	0.9900
X:103919295:GAGT:G	donor_loss	0.9900
X:103928162:A:T	donor_gain	0.9900
X:103928184:GCC:G	donor_gain	0.9900
X:103947974:G:GG	donor_gain	0.9900
X:103964618:GGAAA:G	donor_gain	0.9900
X:103964619:GAAAG:G	donor_gain	0.9900
X:103919296:AGTT:A	donor_loss	0.9800
X:103919297:G:C	donor_loss	0.9800
X:103931208:G:GT	donor_gain	0.9800
X:103964620:A:T	donor_gain	0.9800
X:103919288:CATCT:C	donor_gain	0.9700
X:103919291:CT:C	donor_gain	0.9700
X:103964623:G:GG	donor_gain	0.9700
X:103919289:ATCT:A	donor_gain	0.9600
X:103947973:A:AG	donor_gain	0.9600
X:103919413:A:T	donor_gain	0.9500
X:103928161:G:GT	donor_gain	0.9400
X:103962721:CAGG:C	donor_loss	0.9400
X:103962722:AGG:A	donor_loss	0.9400
X:103962724:GTGA:G	donor_loss	0.9400
X:103962725:T:A	donor_loss	0.9400
X:103931236:A:T	donor_gain	0.9200
X:103947970:A:AG	donor_gain	0.9200
X:103964619:GAAA:G	donor_gain	0.9200

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS10046954 (X:103939406 A>C,T), RS1008559233 (X:103917759 G>A), RS10127145 (X:103942294 A>G), RS1024386530 (X:103918031 T>C), RS1027742681 (X:103917364 A>T), RS1027881848 (X:103917908 T>C), RS1050168713 (X:103917721 A>C), RS1053716173 (X:103917580 T>C), RS10681462 (X:103930725 GATAATAATAATAATAATAATA>G,GATA,GATAATA,GATAATAATA,GATAATAATAATA,GATAATAATAATAATA,GATAATAATAATAATAATA,GATAATAATAATAATAATAATAATA,GATAATAATAATAATAATAATAATAATA,GATAATAATAATAATAATAATAATAATAATA,GATAATAATAATAATAATAATAATAATAATAATA), RS11092466 (X:103944008 C>G,T), RS11092467 (X:103955544 A>C,G,T), RS111305533 (X:103962328 T>C), RS111481418 (X:103918598 C>G), RS111506375 (X:103964184 GT>G), RS111755550 (X:103928177 C>T)

Disease associations

OMIM: gene MIM:301011 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

31 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation, increases expression	3
Valproic Acid	decreases expression, increases expression	3
Estradiol	decreases expression, increases expression, affects cotreatment	2
beta-lapachone	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
sodium arsenite	decreases expression	1
butyraldehyde	increases expression	1
potassium chromate(VI)	decreases expression	1
nickel sulfate	decreases expression	1
pentanal	increases expression	1
entinostat	decreases expression	1
ICG 001	decreases expression	1
Resveratrol	affects cotreatment, increases expression	1
Zoledronic Acid	decreases expression	1
Air Pollutants	increases abundance, decreases expression	1
Cytarabine	increases expression	1
Dichlorodiphenyl Dichloroethylene	decreases expression	1
Plant Extracts	affects cotreatment, increases expression	1
Progesterone	affects cotreatment, decreases expression	1
Selenium	decreases expression	1
Silicon Dioxide	decreases expression	1
Tobacco Smoke Pollution	decreases expression	1
Tunicamycin	decreases expression	1
Vitamin E	decreases expression	1
Cyclosporine	decreases expression	1
Aflatoxin B1	decreases methylation	1
Antirheumatic Agents	increases expression	1
Thapsigargin	decreases expression	1
Okadaic Acid	increases expression	1
beta-Naphthoflavone	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.