TNFSF13

Summary

TNFSF13 (TNF superfamily member 13, HGNC:11928) is a protein-coding gene on chromosome 17p13.1, encoding Tumor necrosis factor ligand superfamily member 13 (O75888). Cytokine that binds to TNFRSF13B/TACI and to TNFRSF17/BCMA.

The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF17/BCMA, a member of the TNF receptor family. This protein and its receptor are both found to be important for B cell development. In vitro experiments suggested that this protein may be able to induce apoptosis through its interaction with other TNF receptor family proteins such as TNFRSF6/FAS and TNFRSF14/HVEM. Alternative splicing results in multiple transcript variants. Some transcripts that skip the last exon of the upstream gene (TNFSF12) and continue into the second exon of this gene have been identified; such read-through transcripts are contained in GeneID 407977, TNFSF12-TNFSF13.

Source: NCBI Gene 8741 — RefSeq curated summary.

At a glance

• Gene–disease (curated): common variable immunodeficiency (Limited, ClinGen) — +1 more curated relationship
• GWAS associations: 23
• Clinical variants (ClinVar): 1 total
• Druggable target: yes
• MANE Select transcript: NM_003808

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:11928
Approved symbol	TNFSF13
Name	TNF superfamily member 13
Location	17p13.1
Locus type	gene with protein product
Status	Approved
Aliases	APRIL, CD256
Ensembl gene	ENSG00000161955
Ensembl biotype	protein_coding
OMIM	604472
Entrez	8741

Gene structure

Transcript identifiers

Ensembl transcripts: 9 — 9 protein_coding

ENST00000338784, ENST00000349228, ENST00000380535, ENST00000396542, ENST00000396545, ENST00000436057, ENST00000438470, ENST00000483039, ENST00000625791

RefSeq mRNA: 6 — MANE Select: NM_003808 NM_001198622, NM_001198623, NM_001198624, NM_003808, NM_172087, NM_172088

CCDS: CCDS11111, CCDS11112, CCDS42256, CCDS56018, CCDS56019, CCDS73957

Canonical transcript exons

ENST00000338784 — 6 exons

Exon	Start	End
ENSE00001892401	7558750	7559297
ENSE00003524569	7560350	7560488
ENSE00003570324	7560049	7560167
ENSE00003595737	7559846	7559893
ENSE00003641550	7559624	7559702
ENSE00003917105	7560724	7561601

Expression profiles

Bgee: expression breadth ubiquitous, 134 present calls, max score 98.25.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 20.8327 / max 534.2034, expressed in 1395 samples.

FANTOM5 promoters (15 alternative TSS)

Promoter ID	TPM avg	Samples expressed
159256	8.7230	442
159251	6.2874	725
159244	1.0710	548
159243	0.8532	493
159255	0.8520	248
159247	0.7286	355
159245	0.6078	297
159252	0.3473	174
159248	0.3204	139
159257	0.2986	143

Top tissues by expression

134 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
monocyte	CL:0000576	98.25	gold quality
leukocyte	CL:0000738	98.21	gold quality
granulocyte	CL:0000094	97.85	gold quality
duodenum	UBERON:0002114	96.20	gold quality
mucosa of transverse colon	UBERON:0004991	95.67	gold quality
gall bladder	UBERON:0002110	95.32	gold quality
metanephros cortex	UBERON:0010533	95.14	gold quality
blood	UBERON:0000178	94.74	gold quality
right lung	UBERON:0002167	94.65	gold quality
upper lobe of left lung	UBERON:0008952	94.52	gold quality
adult mammalian kidney	UBERON:0000082	94.25	gold quality
rectum	UBERON:0001052	93.33	gold quality
saliva-secreting gland	UBERON:0001044	93.29	gold quality
caudate nucleus	UBERON:0001873	93.11	gold quality
putamen	UBERON:0001874	92.99	gold quality
vermiform appendix	UBERON:0001154	92.90	gold quality
minor salivary gland	UBERON:0001830	92.80	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	92.80	gold quality
body of stomach	UBERON:0001161	92.75	gold quality
nucleus accumbens	UBERON:0001882	92.72	gold quality
lung	UBERON:0002048	92.38	gold quality
transverse colon	UBERON:0001157	91.91	gold quality
descending thoracic aorta	UBERON:0002345	91.22	gold quality
fallopian tube	UBERON:0003889	91.03	gold quality
amygdala	UBERON:0001876	90.94	gold quality
kidney	UBERON:0002113	90.94	gold quality
stomach	UBERON:0000945	90.93	gold quality
cortex of kidney	UBERON:0001225	90.93	gold quality
temporal lobe	UBERON:0001871	90.88	gold quality
thoracic aorta	UBERON:0001515	90.68	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-HCAD-1	yes	79.58
E-CURD-122	yes	65.87
E-ANND-3	yes	9.16

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): CREB1, HOXC4, NFKB, SMAD3, SP1, STAT6

miRNA regulators (miRDB)

30 targeting TNFSF13, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3925-3P	100.00	69.95	1237
HSA-MIR-4534	99.99	66.58	1907
HSA-MIR-6756-5P	99.82	67.97	2466
HSA-MIR-4306	99.72	70.50	3630
HSA-MIR-4446-5P	99.72	69.19	2544
HSA-MIR-6892-3P	99.68	66.40	1178
HSA-MIR-6766-5P	99.68	67.70	2325
HSA-MIR-6132	99.60	65.83	1554
HSA-MIR-6836-5P	99.60	65.62	1538
HSA-MIR-6716-5P	99.56	68.62	1244
HSA-MIR-5584-5P	99.49	68.22	2814
HSA-MIR-185-5P	99.35	68.60	2497
HSA-MIR-4644	99.35	69.12	2514
HSA-MIR-3191-5P	99.24	66.52	1722
HSA-MIR-4254	99.11	65.15	1315
HSA-MIR-4651	99.06	67.57	2002
HSA-MIR-608	98.93	67.83	2013
HSA-MIR-382-3P	98.83	67.10	1074
HSA-MIR-6840-3P	98.68	65.95	1923
HSA-MIR-518C-5P	98.53	69.20	1640
HSA-MIR-6827-5P	98.46	64.88	1256
HSA-MIR-4782-5P	98.35	69.33	1474
HSA-MIR-5706	98.35	69.33	1463
HSA-MIR-615-5P	98.10	63.76	591
HSA-MIR-3670	97.88	64.39	763
HSA-MIR-383-5P	96.86	67.55	820
HSA-MIR-6742-5P	96.32	64.01	869
HSA-MIR-644A	96.02	66.52	786
HSA-MIR-6796-5P	95.37	66.08	1120
HSA-MIR-6499-5P	87.01	61.21	38

Literature-anchored findings (GeneRIF, showing 40)

• APRIL is involved in the induction and/or maintenance of T and B cell response. (PMID:12070306)
• When coexpressed with BLYS, APRIL forms active heterotrimeric molecules that circulate in the serum of patients with systemic immune-based rheumatic diseases. (PMID:12370363)
• B-CLL cells can be rescued from apoptosis through an autocrine process involving BAFF, APRIL, and their receptors. (PMID:14504101)
• APRIL up-regulates activation-induced cytidine deaminase and enhances class-switch DNA recombination in Epstein-Barr virus-infected B cells. (PMID:14607922)
• production of APRIL and its ability to increase the proliferation of eight human glioblastoma cell lines (PMID:14691452)
• Exposure of non-Hodgkin’s lymphoma B cells to recombinant or myeloid cell-derived APRIL attenuates apoptosis, increases NF-kappa B activation, up-regulates Bcl-2 and Bcl-xL, and down-regulates Bax. (PMID:14978135)
• serum levels of BAFF and APRIL were increased about 5-fold in patients with multiple myeloma as compared with healthy donors (PMID:15070697)
• APRIL acts as a growth factor for terminal megakaryocytopoiesis and may promote physiologic platelet production. (PMID:15105291)
• significantly increased APRIL levels in sera of B cell chronic lymphoid leukemia (B-CLL) patients, indicating that APRIL promotes onset of B-1-associated neoplasms (PMID:15488762)
• another form of TACI exists wherein the N-terminal cysteine-rich domain (CRD) is removed by alternative splicing and is capable of ligand-induced cell signaling and that the second CRD alone (TACI_d2) contains full affinity for both APRIL and BAFF (PMID:15542592)
• show that the main site of production for BAFF and APRIL is the bone marrow (BM) environment, and that production is mainly by monocytes and neutrophils. In addition, osteoclasts produce very high levels of APRIL, unlike BM stromal cells (PMID:15827134)
• heparan sulfate proteoglycans (HSPG) serve as a receptor for APRIL or that HSPG binding allows APRIL to interact with a receptor that promotes tumor growth (PMID:15846369)
• APRIL binding to the extracellular matrix or to proteoglycan-positive cells induces APRIL oligomerization, which is the prerequisite for the triggering of TACI- and/or BCMA-mediated activation, migration, or survival signals. (PMID:15851487)
• conclude that BAFF and APRIL from NLCs can function in a paracrine manner to support leukemia cell survival via mechanisms that are distinct from those of SDF-1alpha (PMID:15860672)
• Serum levels of sBAFF and sAPRIL were increased in Sjogren’s syndrome, especially in anti-Ro/La+ patients (PMID:15981083)
• APRIL mRNA levels in monocytes and T cells were significantly higher in MS patients than in controls. (PMID:16087247)
• Functional expression of APRIL might contribute to neovascularization via an upregulation of VEGF in HCC. (PMID:16094704)
• APRIL regulates B cell as well as T cell function and has pro- and antiinflammatory activities in rheumatoid arthritis. (PMID:16239971)
• Detailed analysis revealed that APRIL dissociated from producing cells, and secreted APRIL was retained in the tumor lesions. (PMID:16793914)
• Review. The splice variants, binding specificities, structural determinants for ligand selectivity, and signaling pathways are reviewed. (PMID:16914324)
• Review. The role of APRIL in the pahtogenesis of human B cell disorders is reviewed. (PMID:16916610)
• Review. APRIL interactions with BCMA likely govern memory B cell populations. (PMID:16919470)
• Review. Direct BAFF/APRIL signalling in T cells and/or T cell modulation in response to a BAFF-modified B cell compartment may play an important role in inflammation and immunomodulation. (PMID:16931039)
• simultaneous binding of TACI and HSPG on B cells with APRIL is crucial for IgA production (PMID:17119122)
• the signal sequences in APRIL that mediate its intracellular trafficking and provide evidence that this protein ligand of HuR is an important player in the post-transcriptional regulation of CD83 expression (PMID:17178712)
• APRIL up-regulation was only seen in high-grade B-cell, diffuse large B-cell, & Burkitt lymphomas. APRIL produced by inflammatory cells infiltrating lymphoma lesions may increase tumor aggressiveness and affect disease outcome. (PMID:17190854)
• Results suggest that APRIL may play a role in the pathogenesis of brain glioblastoma multiforme. (PMID:17353162)
• findings show that the APRIL codon G67R polymorphism associated with systemic lupus erythematosus (SLE) in a Japanese population may also be associated with SLE in other populations (PMID:17569747)
• APRIL but not BLyS serum levels are increased in chronic lymphocytic leukemia (PMID:17768131)
• Results suggest that elevated serum APRIL and BAFF levels are differentially associated with disease severity in systemic sclerosis. (PMID:17896803)
• TACI supported survival of activated B cells and plasmablasts in vitro (PMID:17942754)
• rheumatoid arthritis fibroblast like synoviocytes are stimulated by APRIL and express the APRIL receptor BCMA. (PMID:17968879)
• APRIL plays an essential role in the survival of TACI(high) bone marrow-dependent myeloma cells and TACI gene expression may be a useful predictive marker for patients who could benefit from atacicept treatment (PMID:18046446)
• Elevated BAFF and APRIL expression levels might partially reflect the common immunological feature of primary antibody deficiency. (PMID:18204790)
• there was no significant difference of serum APRIL levels in alopecia areata (PMID:18328673)
• the decreased expression of APRIL in breast cancer, as compared to non-cancer breast structures, suggests a possible negative role of this factor in breast neoplasia progression. (PMID:18366696)
• there are potential autocrine and paracrine pathways for BAFF and APRIL signaling in human placentas suggest that lineage-specific regulation of placental cell viability, differentiation and/or other activities may be novel functions of these proteins (PMID:18403603)
• APRIL may promote the development of colorectal carcinoma. (PMID:18423122)
• APRIL secreted by neutrophils binds to heparan sulfate proteoglycans to create plasma cell niches in mucosa. (PMID:18618015)
• There are elevated levels of BAFF and APRIL in cerebrospinal fluid of systemic lupus erythematosus (SLE) patients. APRIL was augmented in neuropsychiatric SLE patients compared with SLE patients without central nervous system involvement. (PMID:18718031)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Tnfsf13	ENSMUSG00000089669
rattus_norvegicus	Tnfsf13	ENSRNOG00000014171

Paralogs (2): TNFSF13B (ENSG00000102524), TNFSF12 (ENSG00000239697)

Protein

Protein identifiers

Tumor necrosis factor ligand superfamily member 13 — O75888 (reviewed: O75888)

Alternative names: A proliferation-inducing ligand, TNF- and APOL-related leukocyte expressed ligand 2, TNF-related death ligand 1

All UniProt accessions (5): C9JF68, C9JFN2, O75888, K7EJ28, Q2QBA2

UniProt curated annotations — full annotation on UniProt →

Function. Cytokine that binds to TNFRSF13B/TACI and to TNFRSF17/BCMA. Plays a role in the regulation of tumor cell growth. May be involved in monocyte/macrophage-mediated immunological processes.

Subunit / interactions. Homotrimer.

Subcellular location. Secreted.

Tissue specificity. Expressed at high levels in transformed cell lines, cancers of colon, thyroid, lymphoid tissues and specifically expressed in monocytes and macrophages.

Post-translational modifications. The precursor is cleaved by furin.

Induction. Down-regulated by phorbol myristate acetate/ionomycin treatment.

Similarity. Belongs to the tumor necrosis factor family.

Isoforms (6)

UniProt ID	Names	Canonical?
O75888-1	Alpha	yes
O75888-2	Beta
O75888-3	Gamma
O75888-4	4
O43508-2	TWE-PRIL, TNFSF12-TNFSF13
O75888-5	5

RefSeq proteins (6): NP_001185551, NP_001185552, NP_001185553, NP_003799, NP_742084, NP_742085 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR006052	TNF_dom	Domain
IPR008983	Tumour_necrosis_fac-like_dom	Homologous_superfamily
IPR021184	TNF_CS	Conserved_site
IPR051748	TNF_Ligand_Superfamily	Family

Pfam: PF00229

UniProt features (26 total): strand 9, splice variant 5, sequence variant 2, region of interest 2, propeptide 1, chain 1, mutagenesis site 1, domain 1, turn 1, site 1, glycosylation site 1, disulfide bond 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
4ZCH	X-RAY DIFFRACTION	2.43

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O75888-F1	81.49	0.56

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 104–105 (cleavage; by furin)

Disulfide bonds (1): 196–211

Glycosylation sites (1): 124

Mutagenesis-validated functional residues (1):

Position	Phenotype
101–104	abolishes proteolytic processing.

Function

Pathways and Gene Ontology

Reactome pathways

2 pathways

ID	Pathway
R-HSA-450520	HuR (ELAVL1) binds and stabilizes mRNA
R-HSA-5669034	TNFs bind their physiological receptors

MSigDB gene sets: 224 (showing top): GOBP_REGULATION_OF_CELL_ACTIVATION, GOBP_REGULATION_OF_DNA_RECOMBINATION, GOBP_REGULATION_OF_LEUKOCYTE_PROLIFERATION, GOBP_POSITIVE_REGULATION_OF_ADAPTIVE_IMMUNE_RESPONSE, REACTOME_CYTOKINE_SIGNALING_IN_IMMUNE_SYSTEM, GOBP_B_CELL_ACTIVATION, GOBP_REGULATION_OF_ADAPTIVE_IMMUNE_RESPONSE, GCANCTGNY_MYOD_Q6, KAAB_HEART_ATRIUM_VS_VENTRICLE_UP, GOBP_LYMPHOCYTE_HOMEOSTASIS, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, DACOSTA_UV_RESPONSE_VIA_ERCC3_UP, MODULE_128, GOBP_B_CELL_PROLIFERATION, GOBP_POSITIVE_REGULATION_OF_B_CELL_PROLIFERATION

GO Biological Process (9): lymphocyte homeostasis (GO:0002260), immune response (GO:0006955), signal transduction (GO:0007165), positive regulation of cell population proliferation (GO:0008284), positive regulation of B cell proliferation (GO:0030890), positive regulation of isotype switching to IgA isotypes (GO:0048298), immune system process (GO:0002376), cell communication (GO:0007154), signaling (GO:0023052)

GO Molecular Function (4): signaling receptor binding (GO:0005102), cytokine activity (GO:0005125), tumor necrosis factor receptor binding (GO:0005164), protein binding (GO:0005515)

GO Cellular Component (7): extracellular region (GO:0005576), obsolete extracellular space (GO:0005615), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), cytosol (GO:0005829), membrane (GO:0016020), extracellular exosome (GO:0070062)

Reactome top-level categories

Rollup of top-2 pathways:

Category	Pathways
Regulation of mRNA stability by proteins that bind AU-rich elements	1
TNFR2 non-canonical NF-kB pathway	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	5
cellular process	2
leukocyte homeostasis	1
immune system process	1
response to stimulus	1
cell communication	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
cell population proliferation	1
regulation of cell population proliferation	1
positive regulation of cellular process	1
regulation of B cell proliferation	1
B cell proliferation	1
positive regulation of lymphocyte proliferation	1
positive regulation of B cell activation	1
positive regulation of isotype switching	1
isotype switching to IgA isotypes	1
regulation of isotype switching to IgA isotypes	1
biological_process	1
regulation of biological process	1
protein binding	1
receptor ligand activity	1
tumor necrosis factor receptor superfamily binding	1
binding	1
nuclear lumen	1
intracellular anatomical structure	1
cytoplasm	1
extracellular vesicle	1

Protein interactions and networks

STRING

1026 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TNFSF13	TNFRSF13B	O14836	996
TNFSF13	TNFRSF17	Q02223	977
TNFSF13	TNFRSF13C	Q96RJ3	951
TNFSF13	TNFSF12	O43508	841
TNFSF13	TNFRSF1A	P19438	759
TNFSF13	CD68	P34810	623
TNFSF13	TNF	P01375	596
TNFSF13	CD83	Q01151	584
TNFSF13	IL10	P22301	566
TNFSF13	TNFSF14	O43557	543
TNFSF13	IL1B	P01584	527
TNFSF13	IFNG	P01579	514
TNFSF13	IL1A	P01583	490
TNFSF13	TNFRSF25	P78507	482
TNFSF13	TNFRSF11A	Q9Y6Q6	477

IntAct

10 interactions, top by confidence:

A	B	Type	Score
TNFRSF13B	TNFSF13	psi-mi:“MI:0915”(physical association)	0.610
TNFRSF13B	TNFSF13	psi-mi:“MI:0407”(direct interaction)	0.610
TNFSF13	TNFRSF17	psi-mi:“MI:0407”(direct interaction)	0.440
TNFSF13	CAMK1D	psi-mi:“MI:0915”(physical association)	0.370
TNFSF13	KRAS	psi-mi:“MI:0915”(physical association)	0.370
TNFSF13	PIK3CA	psi-mi:“MI:0915”(physical association)	0.370
TNFSF13	HSPA5	psi-mi:“MI:0914”(association)	0.350
TNFSF13	AGPAT2	psi-mi:“MI:0914”(association)	0.350
TNFSF13	FADS1	psi-mi:“MI:0914”(association)	0.350

BioGRID (31): TNFSF13 (Two-hybrid), TNFSF13 (Two-hybrid), SGTB (Two-hybrid), TNFSF13 (Affinity Capture-Western), TNFSF13 (Affinity Capture-Western), TNFSF13B (Affinity Capture-Western), FASTKD3 (Affinity Capture-MS), FKBP14 (Affinity Capture-MS), DPCD (Affinity Capture-MS), TNFSF13 (Affinity Capture-Western), TNFSF13 (Reconstituted Complex), RUVBL1 (Affinity Capture-MS), HSPA5 (Affinity Capture-MS), RUVBL2 (Affinity Capture-MS), VSIG8 (Affinity Capture-MS)

ESM2 similar proteins: A1L1C2, A2RRU4, A6QM06, A6QP75, E1BE10, E2RD63, G5E872, O75888, P29376, P70295, P97260, Q12770, Q1LZ97, Q28DT3, Q2M2I3, Q3TAA7, Q3U5Q7, Q3ZCA1, Q4FZD7, Q5EBM0, Q5MNU5, Q5SWZ9, Q60I26, Q60I27, Q69Z89, Q6AZ51, Q6GQT6, Q6IN84, Q6NUI2, Q6P9U1, Q7Z6J9, Q8BH06, Q8BTM9, Q8C0R7, Q8IYL2, Q8N1F8, Q8N2A8, Q8NAC3, Q8NFR9, Q8TDF6

Diamond homologs: O75888, Q92838, Q9BEG5, Q9D777, Q9WU72, Q9Y275, O54693

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
TNFSF13	up-regulates	TNFRSF13B	binding
TNFSF13	up-regulates	TNFRSF17	binding

Disease & clinical

Clinical variants and AI predictions

ClinVar

1 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	1
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1287 predictions. Top by Δscore:

Variant	Effect	Δscore
17:7559698:GAAGA:G	donor_gain	1.0000
17:7559701:GA:G	donor_gain	1.0000
17:7559703:G:GG	donor_gain	1.0000
17:7559892:GG:G	donor_gain	1.0000
17:7559893:GG:G	donor_gain	1.0000
17:7560438:G:GT	donor_gain	1.0000
17:7560486:CAG:C	donor_loss	1.0000
17:7560486:CAGGT:C	donor_loss	1.0000
17:7560488:GG:G	donor_loss	1.0000
17:7560489:G:T	donor_loss	1.0000
17:7560489:GT:G	donor_loss	1.0000
17:7560490:T:A	donor_loss	1.0000
17:7559675:A:T	donor_gain	0.9900
17:7559716:G:GT	donor_gain	0.9900
17:7559844:A:AG	acceptor_gain	0.9900
17:7559845:G:GG	acceptor_gain	0.9900
17:7559845:GAGCA:G	acceptor_gain	0.9900
17:7560045:CCA:C	acceptor_loss	0.9900
17:7560045:CCAG:C	acceptor_loss	0.9900
17:7560047:A:AG	acceptor_gain	0.9900
17:7560047:A:T	acceptor_loss	0.9900
17:7560047:AGA:A	acceptor_loss	0.9900
17:7560047:AGAT:A	acceptor_gain	0.9900
17:7560048:G:GG	acceptor_gain	0.9900
17:7560048:GAT:G	acceptor_gain	0.9900
17:7560048:GATG:G	acceptor_gain	0.9900
17:7560138:G:GT	donor_gain	0.9900
17:7560164:CCAGG:C	donor_loss	0.9900
17:7560165:CAGGT:C	donor_loss	0.9900
17:7560166:AGGTA:A	donor_loss	0.9900

AlphaMissense

1604 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
17:7560077:G:C	W138C	0.998
17:7560077:G:T	W138C	0.998
17:7560810:T:C	F244L	0.998
17:7560812:C:A	F244L	0.998
17:7560812:C:G	F244L	0.998
17:7560075:T:A	W138R	0.997
17:7560075:T:C	W138R	0.997
17:7560357:T:G	F171C	0.997
17:7560356:T:C	F171L	0.996
17:7560357:T:C	F171S	0.996
17:7560358:T:A	F171L	0.996
17:7560358:T:G	F171L	0.996
17:7560162:A:C	S167R	0.995
17:7560164:C:A	S167R	0.995
17:7560164:C:G	S167R	0.995
17:7560371:T:C	F176L	0.995
17:7560373:C:A	F176L	0.995
17:7560373:C:G	F176L	0.995
17:7560473:A:C	S210R	0.995
17:7560475:C:A	S210R	0.995
17:7560475:C:G	S210R	0.995
17:7560477:G:A	C211Y	0.994
17:7560431:T:A	C196S	0.993
17:7560432:G:C	C196S	0.993
17:7560478:C:G	C211W	0.993
17:7560431:T:C	C196R	0.992
17:7560811:T:G	F244C	0.992
17:7560817:G:A	G246E	0.992
17:7560433:T:G	C196W	0.991
17:7560482:A:C	S213R	0.991

dbSNP variants (sampled 300 via entrez): RS1000265250 (17:7557960 C>T), RS1000403047 (17:7557654 G>A), RS1000612281 (17:7556607 T>C), RS1000715734 (17:7556625 C>T), RS1000775375 (17:7561826 G>A), RS1001145102 (17:7560714 C>A,T), RS1001278704 (17:7558872 C>G,T), RS1001312228 (17:7561698 T>C), RS1002143987 (17:7559518 G>A,C,T), RS1002286481 (17:7562001 CGGCGGCGGTGGCGCTGGT>C,CGGCGGCGGTGGCGCTGGTGGCGGCGGTGGCGCTGGT), RS1004813371 (17:7561203 G>T), RS1005148940 (17:7558247 A>G), RS1005165032 (17:7561349 G>A), RS1005180208 (17:7558431 G>A), RS1005859480 (17:7559993 A>C)

Disease associations

OMIM: gene MIM:604472 | disease phenotypes:

GenCC curated gene-disease

Disease	Classification	Inheritance
common variable immunodeficiency	Limited	Autosomal recessive
agammaglobulinemia	Limited	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
common variable immunodeficiency	Limited	AR

Mondo (2): common variable immunodeficiency (MONDO:0015517), agammaglobulinemia (MONDO:0015977)

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

23 associations (top):

Study	Trait	p-value
GCST001364_2	IgA nephropathy	9.000000e-11
GCST001496_4	Non-albumin protein levels	7.000000e-15
GCST001626_1	IgA levels	3.000000e-07
GCST001724_3	IgM levels	4.000000e-09
GCST002655_11	IgA nephropathy	9.000000e-06
GCST002943_10	IgA nephropathy	2.000000e-06
GCST003989_34	Chin dimples	1.000000e-11
GCST003997_1	Myopia	8.000000e-15
GCST005987_4	Albumin-globulin ratio	3.000000e-69
GCST005989_29	Serum total protein levels	4.000000e-38
GCST005990_3	Non-albumin protein levels	3.000000e-76
GCST006190_4	Diastolic blood pressure x smoking status (ever vs never) interaction (2df test)	3.000000e-10
GCST006190_54	Diastolic blood pressure x smoking status (ever vs never) interaction (2df test)	3.000000e-08
GCST006192_52	Systolic blood pressure x smoking status (ever vs never) interaction (2df test)	8.000000e-11
GCST006192_75	Systolic blood pressure x smoking status (ever vs never) interaction (2df test)	2.000000e-12
GCST006193_37	Diastolic blood pressure x smoking status (current vs non-current) interaction (2df test)	9.000000e-11
GCST006193_75	Diastolic blood pressure x smoking status (current vs non-current) interaction (2df test)	9.000000e-09
GCST006195_19	Systolic blood pressure x smoking status (current vs non-current) interaction (2df test)	3.000000e-11
GCST006195_69	Systolic blood pressure x smoking status (current vs non-current) interaction (2df test)	1.000000e-12
GCST008522_2	Bitter alcoholic beverage consumption	3.000000e-08
GCST008568_15	IgA levels	7.000000e-06
GCST008569_1	Composite immunoglobulin trait (IgA x IgG x IgM)	1.000000e-09
GCST010703_158	Brain morphology (MOSTest)	3.000000e-09

EFO canonical traits (6, from GWAS)

EFO ID	Trait name
EFO:0005128	albumin:globulin ratio measurement
EFO:0006336	diastolic blood pressure
EFO:0006527	smoking status measurement
EFO:0006335	systolic blood pressure
EFO:0010092	bitter alcoholic beverage consumption measurement
EFO:0004346	neuroimaging measurement

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D000361	Agammaglobulinemia	C15.378.147.142; C15.604.515.032; C20.673.088
D017074	Common Variable Immunodeficiency	C20.673.330

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL3713436 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB variants

1 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs11552708	TNFSF12-TNFSF13, TNFSF13	3	0.00	1	methylphenidate

CTD chemical–gene interactions

29 total (human), top 29 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Acetaminophen	increases expression, affects cotreatment, decreases expression	2
Benzo(a)pyrene	affects methylation, decreases methylation, increases expression, decreases reaction	2
Fluorouracil	increases expression	2
Silicon Dioxide	decreases expression	2
aristolochic acid I	increases expression	1
triphenyl phosphate	affects expression	1
chlorophyllin	decreases reaction, increases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
cobaltous chloride	decreases expression	1
butyraldehyde	decreases expression	1
cetrorelix	decreases expression	1
usnic acid	increases expression	1
CGP 52608	affects binding, increases reaction	1
abrine	decreases expression	1
Decitabine	affects expression	1
Arsenic Trioxide	increases expression	1
Cadmium	decreases expression	1
Calcitriol	affects cotreatment, increases expression	1
Cisplatin	decreases expression	1
Dietary Carbohydrates	affects cotreatment, increases expression	1
Lead	decreases expression	1
Lipopolysaccharides	affects cotreatment, decreases expression, increases expression	1
Menthol	decreases expression	1
Mustard Gas	increases expression	1
Testosterone	affects cotreatment, increases expression	1
Thiram	decreases expression	1
Paclitaxel	increases expression	1
Antirheumatic Agents	decreases expression	1
Okadaic Acid	decreases expression	1

Cellosaurus cell lines

4 cell lines: 4 spontaneously immortalized cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_F0XQ	NIH-AP2	Spontaneously immortalized cell line	Male
CVCL_F0XR	NIH-AP4	Spontaneously immortalized cell line	Male
CVCL_F0XS	NIH-AP16	Spontaneously immortalized cell line	Male
CVCL_F0XT	NIH-AP18	Spontaneously immortalized cell line	Male

Clinical trials (associated diseases)

50 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00520494	PHASE4	COMPLETED	Efficacy and Safety of Vivaglobin® in Previously Untreated Patients With Primary Immunodeficiency
NCT01289847	PHASE4	COMPLETED	A Study to Find Out How Safe and Effective Gammaplex® is in Young People With Primary Immunodeficiency
NCT01946906	PHASE4	COMPLETED	The Rifaximin Study in CVID
NCT05193552	PHASE4	RECRUITING	Usage of Spirometry in Managing IgG Therapy in CVID With Airway Disease
NCT05612607	PHASE4	UNKNOWN	Switched Memory B-cells as a Marker for Humoral Immune System Recovery in Patients With Secondary Antibody Deficiency Due to Hematological Malignancies
NCT07135427	PHASE4	RECRUITING	Genetic Variation in IgG in Alpha 1 Antitrypsin Deficiency
NCT00168012	PHASE3	COMPLETED	Efficacy and Safety of Intravenous Immunoglobulin IVIG-F10 in Patients With Primary Immunodeficiencies (PID)
NCT00168025	PHASE3	COMPLETED	Efficacy and Safety of Intravenous Immunoglobulin IgPro10 in Patients With Primary Immunodeficiencies (PID)
NCT00220766	PHASE3	COMPLETED	Rapid Infusion of Immune Globulin Intravenous (Human) In Primary Immunodeficiency Patients
NCT00322556	PHASE3	COMPLETED	Safety and Efficacy of Intravenous Immunoglobulin IgPro10 in Patients With Primary Immunodeficiencies (PID)
NCT00542997	PHASE3	COMPLETED	Study of Subcutaneous Immune Globulin in Patients Requiring IgG Replacement Therapy
NCT01884311	PHASE3	COMPLETED	Pharmacokinetics (PK) and Safety of Subgam-VF in Primary Immunodeficiency Diseases
NCT01963143	PHASE3	COMPLETED	Bioequivalence Study to Evaluate the Pharmacokinetics, Safety, and Tolerability of Gammaplex® 10 and Gammaplex® 5% in Primary Immunodeficiency Diseases
NCT02247141	PHASE3	COMPLETED	A Multi-centre Open Study to Assess the Safety and Efficacy of Subgam®
NCT01581593	PHASE3	COMPLETED	Efficacy and Safety Study of Kedrion IVIG 10% to Treat Subjects With Primary Immunodeficiency (PID)
NCT03578341	PHASE3	UNKNOWN	Oral Colostrum and Its Effect on Immune System
NCT06954441	PHASE3	RECRUITING	V-IMMUNE: A Novel Immunoglobulin Therapy for Immunodeficiency
NCT01489618	PHASE2	TERMINATED	Prime Boost Vaccination Strategy Combining Conjugated Anti- Pneumococcal Vaccine (s0) and Polysaccharide Anti- Pneumococcal Vaccine (s4) Compared to Polysaccharide Anti- Pneumococcal Vaccine Alone (s4) In Patients With Common Variable Immunodeficiency
NCT01821781	PHASE2	ACTIVE_NOT_RECRUITING	Immune Disorder HSCT Protocol
NCT02579967	PHASE2	RECRUITING	Pilot Trial of Allogeneic Blood or Marrow Transplantation for Primary Immunodeficiencies
NCT03663933	PHASE2	ACTIVE_NOT_RECRUITING	Allogeneic Hematopoietic Cell Transplantation for Disorders of T-cell Proliferation and/or Dysregulation
NCT04339777	PHASE2	RECRUITING	Allogeneic Hematopoietic Stem Cell Transplant for Patients With Inborn Errors of Immunity
NCT04925375	PHASE2	RECRUITING	Abatacept for the Treatment of Common Variable Immunodeficiency With Interstitial Lung Disease
NCT05593588	PHASE2	ENROLLING_BY_INVITATION	Senolytics Treatment of Interstitial Lung Disease in Common Variable Immunodeficiency
NCT06897358	PHASE2	ACTIVE_NOT_RECRUITING	Leniolisib for Immune Dysregulation in CVID
NCT07284641	PHASE2	RECRUITING	Hematopoietic Stem Cell Transplantation (HSCT) for Common Variable Immunodeficiency (CVID) and Other Autoimmune Manifestations of Primary Immune Regulatory Disorders (PIRD)
NCT00161993	PHASE2	COMPLETED	Safety, Pharmacokinetic and Efficacy Study of a 10% Triple Virally Reduced Intravenous Immune Globulin Solution in Patients With Primary Immunodeficiency (Hypo- or Agammaglobulinemia)
NCT00263237	PHASE1	COMPLETED	STA-5326 Meslylate to Treat Gut Inflammation Associated With Common Variable Immunodeficiency
NCT05584631	PHASE1	RECRUITING	IVIG vs SCIG in CIDP
NCT01852370	PHASE1/PHASE2	ENROLLING_BY_INVITATION	Sequential Cadaveric Lung and Bone Marrow Transplant for Immune Deficiency Diseases
NCT03513328	PHASE1/PHASE2	COMPLETED	Conditioning Regimen for Allogeneic Hematopoietic Stem-Cell Transplantation
NCT00004695	Not specified	COMPLETED	Randomized Study of Polyethylene-Glycol-Conjugated Interleukin 2 in Patients With Common Variable Immunodeficiency
NCT00006054	Not specified	TERMINATED	Allogeneic Bone Marrow Transplantation in Patients With Primary Immunodeficiencies
NCT00015431	Not specified	COMPLETED	Immune System and Gut Abnormalities in Patients With Common Variable Immunodeficiency With and Without Gastrointestinal Symptoms
NCT00661401	Not specified	COMPLETED	Specific IgG Antibody in Patients With Primary Antibody Deficiencies Treated With Subcutaneous Immunoglobulin
NCT00943514	Not specified	RECRUITING	Natural History of Bronchiectasis
NCT01196702	Not specified	COMPLETED	Lymphocyte Immunophenotyping in Common Variable Immunodeficiency
NCT01652092	Not specified	ACTIVE_NOT_RECRUITING	Allogeneic Hematopoietic Stem Cell Transplant for Patients With Primary Immune Deficiencies
NCT01981785	Not specified	UNKNOWN	Investigation of Immune Disorders and Deficiencies
NCT02960399	Not specified	TERMINATED	Assessment of Immunogenicity of Zostavax® in Patients With Antibody Deficiency 60 Years of Age and Older