TPM3

Summary

TPM3 (tropomyosin 3, HGNC:12012) is a protein-coding gene on chromosome 1q21.3, encoding Tropomyosin alpha-3 chain (P06753). Binds to actin filaments in muscle and non-muscle cells.

This gene encodes a member of the tropomyosin family of actin-binding proteins. Tropomyosins are dimers of coiled-coil proteins that provide stability to actin filaments and regulate access of other actin-binding proteins. Mutations in this gene result in autosomal dominant nemaline myopathy and other muscle disorders. This locus is involved in translocations with other loci, including anaplastic lymphoma receptor tyrosine kinase (ALK) and neurotrophic tyrosine kinase receptor type 1 (NTRK1), which result in the formation of fusion proteins that act as oncogenes. There are numerous pseudogenes for this gene on different chromosomes. Alternative splicing results in multiple transcript variants.

Source: NCBI Gene 7170 — RefSeq curated summary.

At a glance

• Gene–disease (curated): TPM3-related myopathy (Definitive, ClinGen) — +7 more curated relationships
• GWAS associations: 18
• Clinical variants (ClinVar): 434 total — 15 pathogenic, 18 likely-pathogenic
• Phenotypes (HPO): 141
• Druggable target: yes
• MANE Select transcript: NM_152263

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:12012
Approved symbol	TPM3
Name	tropomyosin 3
Location	1q21.3
Locus type	gene with protein product
Status	Approved
Aliases	TRK
Ensembl gene	ENSG00000143549
Ensembl biotype	protein_coding
OMIM	191030
Entrez	7170

Gene structure

Transcript identifiers

Ensembl transcripts: 31 — 15 protein_coding, 7 nonsense_mediated_decay, 6 retained_intron, 3 protein_coding_CDS_not_defined

ENST00000271850, ENST00000302206, ENST00000312970, ENST00000323144, ENST00000328159, ENST00000330188, ENST00000341372, ENST00000341485, ENST00000368527, ENST00000368530, ENST00000368531, ENST00000368533, ENST00000368545, ENST00000466010, ENST00000469717, ENST00000473036, ENST00000504663, ENST00000505010, ENST00000509409, ENST00000509601, ENST00000513769, ENST00000515609, ENST00000611659, ENST00000651641, ENST00000651644, ENST00000651731, ENST00000651873, ENST00000960964, ENST00000960965, ENST00000960966, ENST00000960967

RefSeq mRNA: 15 — MANE Select: NM_152263 NM_001043351, NM_001043352, NM_001043353, NM_001278188, NM_001278189, NM_001278190, NM_001278191, NM_001349679, NM_001364679, NM_001364680, NM_001364681, NM_001364682, NM_001364683, NM_152263, NM_153649

CCDS: CCDS1060, CCDS41400, CCDS41401, CCDS41402, CCDS41403, CCDS60274, CCDS60275, CCDS72922, CCDS91060, CCDS91061

Canonical transcript exons

ENST00000651641 — 10 exons

Exon	Start	End
ENSE00001640091	154169305	154169383
ENSE00001701463	154171413	154171488
ENSE00003479884	154170400	154170469
ENSE00003527810	154176115	154176248
ENSE00003556024	154172908	154172978
ENSE00003651105	154191186	154191311
ENSE00003653874	154170649	154170711
ENSE00003675075	154173084	154173201
ENSE00003844798	154191902	154192100
ENSE00003846728	154161813	154167940

Expression profiles

Bgee: expression breadth ubiquitous, 243 present calls, max score 99.87.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 76.8847 / max 6780.5327, expressed in 1826 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
14783	32.4965	1817
14782	22.5802	1801
14785	20.8728	462
14777	0.4691	166
14778	0.4536	78
14786	0.0125	3

Top tissues by expression

293 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
diaphragm	UBERON:0001103	99.87	gold quality
hindlimb stylopod muscle	UBERON:0004252	99.87	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	99.87	gold quality
biceps brachii	UBERON:0001507	99.85	gold quality
gastrocnemius	UBERON:0001388	99.84	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	99.83	gold quality
muscle of leg	UBERON:0001383	99.82	gold quality
gluteal muscle	UBERON:0002000	99.77	gold quality
vastus lateralis	UBERON:0001379	99.75	gold quality
triceps brachii	UBERON:0001509	99.74	gold quality
muscle organ	UBERON:0001630	99.62	gold quality
skeletal muscle organ	UBERON:0014892	99.62	gold quality
skeletal muscle tissue	UBERON:0001134	99.59	gold quality
monocyte	CL:0000576	99.57	gold quality
granulocyte	CL:0000094	99.43	gold quality
deltoid	UBERON:0001476	99.42	gold quality
tibialis anterior	UBERON:0001385	99.27	gold quality
calcaneal tendon	UBERON:0003701	99.22	gold quality
body of tongue	UBERON:0011876	99.20	gold quality
rectum	UBERON:0001052	99.16	gold quality
right atrium auricular region	UBERON:0006631	99.16	gold quality
colonic epithelium	UBERON:0000397	99.11	gold quality
mucosa of transverse colon	UBERON:0004991	99.05	gold quality
gall bladder	UBERON:0002110	99.03	gold quality
right lung	UBERON:0002167	99.01	gold quality
upper lobe of left lung	UBERON:0008952	98.97	gold quality
apex of heart	UBERON:0002098	98.91	gold quality
quadriceps femoris	UBERON:0001377	98.83	gold quality
sural nerve	UBERON:0015488	98.72	gold quality
right adrenal gland cortex	UBERON:0035827	98.61	gold quality

Single-cell (SCXA)

Detected in 12 experiment(s), a significant marker in 9.

Experiment	Marker?	Max mean expression
E-HCAD-11	yes	45.52
E-HCAD-4	yes	35.54
E-CURD-112	yes	22.83
E-GEOD-130148	yes	21.78
E-CURD-122	yes	21.07
E-MTAB-10042	yes	17.68
E-GEOD-125970	yes	15.54
E-GEOD-137537	yes	5.89
E-GEOD-124858	no	539.05
E-HCAD-31	no	20.38
E-MTAB-9388	no	11.77
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

192 targeting TPM3, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-5193	100.00	67.26	1744
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-4768-5P	100.00	69.49	2861
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-3924	100.00	72.09	2394
HSA-MIR-3162-3P	100.00	65.37	363
HSA-MIR-4425	100.00	67.59	1049
HSA-MIR-4455	100.00	65.48	1587
HSA-MIR-6873-3P	100.00	71.42	2626
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-6077	99.99	68.04	2299
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-23B-5P	99.98	66.07	587
HSA-MIR-3692-3P	99.98	70.27	2139
HSA-MIR-4803	99.98	71.99	3117
HSA-MIR-302C-5P	99.97	72.56	3642
HSA-MIR-6778-3P	99.96	67.29	2693
HSA-MIR-3658	99.96	73.87	4379
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-559	99.95	72.28	3609
HSA-MIR-548AB	99.95	71.31	3488
HSA-MIR-767-5P	99.95	70.85	993
HSA-MIR-185-3P	99.95	67.01	1743
HSA-MIR-548A-5P	99.94	71.27	3482
HSA-MIR-548AD-5P	99.94	71.23	3502
HSA-MIR-548AE-5P	99.94	71.23	3502

Literature-anchored findings (GeneRIF, showing 40)

• cloned and sequenced a novel nonmuscle tropomyosin (hTM) isoform, TC22, which is strongly associated with colonic neoplasia and carcinoma (PMID:12105844)
• A mutation converting the stop codon to a serine and a second splicing mutation predicted to prevent inclusion of skeletal muscle exon IX were found associated with nemaline myopathy (PMID:12196661)
• De novo missense mutation in a constitutively expressed exon of the slow alpha-tropomyosin gene TPM3 associated with an atypical, sporadic case of nemaline myopathy. (PMID:12467750)
• tropomyosin isoforms regulate neuronal size and shape (PMID:15888546)
• The N-terminal “KRK ring” may participate in balancing electrostatic force with hydrophobic interaction in dimerization of TM and its binding to E-Tmod. (PMID:16297372)
• second pedigree with autosomal dominant nemaline myopathy caused by TPM3 mutation(Arg167His). (PMID:17376686)
• Mutation of TPM3 is the most common cause of congenital fiber type disproportion reported to date. (PMID:18300303)
• The mutation reported here is the first deletion to be identified in TPM3, and it is likely to be a founder mutation in the Turkish population. (PMID:18382475)
• TTC9A acts as a chaperone protein to facilitate the function of tropomyosins (including Tm5NM-1) in stabilizing microfilament and it may play a role in cancer cell invasion and metastasis (PMID:18699990)
• This protein has been found differentially expressed in the Wernicke’s Area from patients with schizophrenia. (PMID:19405953)
• We report a TPM3 mutation in one of the original cases of cap disease. (PMID:19487656)
• Mutations in TPM3 were identified in 6 out of 13 patients with Congenital fiber type disproportion, as well as in one case of nemaline myopathy. (PMID:19953533)
• the clinical, myopathological and muscle MRI findings in a German family with autosomal dominant nemaline myopathy due to a novel pathogenic TPM3 mutation (PMID:20012312)
• TPM3 mutations are involved in fiber size disproportion in congenital myotonic dystrophy (PMID:20179953)
• Conditional TPM3-ALK and NPM-ALK transgenic mice develop reversible ALK-positive early B-cell lymphoma/leukemia. (PMID:20223922)
• Overexpression of TPM3 activates Snail mediated EMT, which will repress E-cadherin expression and that it confers migration or invasion potentials to HCC cells during hepatocarcinogenesis. (PMID:20356415)
• This protein has been found differentially expressed in the anterior cingulate cortex from patients with schizophrenia (PMID:20381070)
• study reports clinico-pathological and electrophysiological features of 2 unrelated cases with heterozygous TPM3 mutation; cases highlight neuromuscular transmission defect in congenital myopathy with fibre type disproportion secondary to TPM3 mutations (PMID:20951040)
• variation in the tropomyosin isoform composition of microfilaments provides a mechanism to generate functionally distinct filament populations (PMID:21036167)
• High TPM3-PDGFRB fusion protein expression is associated with chronic eosinophilic leukemia. (PMID:21072821)
• investigation of biomarkers for early diagnosis of endometriosis: Data suggest that TPM3, stomatin-like protein 2, and tropomodulin 3 are autoantigens present in blood of women with endometriosis; immunodominant epitopes were identified. (PMID:22158085)
• Expression of low molecular weight isoforms from TPM1 and TPM3 genes is regulated very differently, which has a critical role in processes such as cancer metastasis. (PMID:22740512)
• TPM3 is an interacting partner of granulin-epithelin precursor and may play an important role in hepatocarcinogenesis. (PMID:22792281)
• TPM3-R167H mutations decreased cooperative thin filament activation in combination with reductions in the myosin cross-bridge number and force production. (PMID:22798622)
• In addition to CLIC1 and TPM1, which were the proteins initially discovered in a xenograft mouse model, CLIC4, TPM2, TPM3, and TPM4 were present in ovarian cancer patient sera at significantly elevated levels compared with controls. (PMID:23792823)
• study reports on a three-generation family with cap myopathy caused by a novel heterozygous mutation in TPM3 (PMID:24239060)
• in a cohort of 94 patients with congenital myopathy, 2 related female patients and 2 sporadic male patients were found to carry mutations in TPM2 and TPM3 genes respectively; clinical presentation and muscle morphological findings differed in the patients (PMID:24507666)
• Patients with TPM2 mutations tended to present with milder symptoms than those with TPM3 mutations, DA being present only in the TPM2 group. (PMID:24692096)
• DATA show that tropomyosin 3 protein (TPM3) plays a critical role in the progression of gliomas. (PMID:24913705)
• Western blot showed phosphorylation of ALK, ERK1/2, and STAT3 in cells transfected with TPM3-ALK. Coiled-coil structure of TPM3 contributes to the transforming ability of the TPM3-ALK fusion protein, and longer TPM3 region leads to higher dimer formation. (PMID:25596129)
• Dominant mutations in TPM3, encoding alpha-tropomyosinslow, cause a congenital myopathy characterized by generalized muscle weakness. Here, we used a multidisciplinary approach to investigate the mechanism of muscle dysfunction in 12 TPM3-myopathy patients. (PMID:26307083)
• This work expands the phenotypic spectrum of TPM3-related disease and provides insights into the pathophysiological mechanisms of the actin-tropomyosin complex (PMID:26418456)
• Analysis of the residual, resected tumor identified a chromoplectic TPM3-ALK rearrangement that involved many other known oncogenes and was confirmed by rtPCR. (PMID:27742657)
• expression levels of tropomyosin 3 (TPM3) were higher in stage III ESCC tissue compared with stage I (P<0.05). The findings of the present study identified twelve proteins, which are closely associated with ESCC invasion and metastasis, apoptosis and cell signal transduction. (PMID:28138712)
• Tropomyosin alpha mutation is associated with Hypertrophic cardiomyopathy. (PMID:29760186)
• the effect of the E173A, R90P, E150A, and A155T myopathy-causing substitutions in gamma-tropomyosin (Tpm3.12) on the position of tropomyosin in thin filaments and the conformational state of actin monomers and myosin heads at different stages of the ATPase cycle, was examined. (PMID:30544720)
• The influence of the congenital myopathy TPM3-related mutations on TPM3 tropomodulin binding and actin interaction. (PMID:30768849)
• It was shown that the Ala155Thr (A155T) mutation increased the Ca(2+)-sensitivity of thin filaments in solution. In the absence of myosin heads in muscle fibres, the mutation did not alter the ability of troponin to switch the thin filaments on and off at high and low Ca(2+), respectively. (PMID:31155291)
• perturbation of Tpm3.1/3.2 results in decreased myosin IIa in stress fibres, which is consistent with a role for Tpm3.1 in maintaining myosin IIa localisation in stress fibres. (PMID:31331962)
• actin’s D- and H-loop are the sites involved in regulation of cofilin activity by tropomyosin isoforms (PMID:31996302)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	tpm3	ENSDARG00000005162
mus_musculus	Tpm3	ENSMUSG00000027940
rattus_norvegicus	Tpm3	ENSRNOG00000017441
drosophila_melanogaster	Tm1	FBGN0003721
drosophila_melanogaster	Tm2	FBGN0004117
caenorhabditis_elegans	lev-11	WBGENE00002978

Paralogs (3): TPM1 (ENSG00000140416), TPM4 (ENSG00000167460), TPM2 (ENSG00000198467)

Protein

Protein identifiers

Tropomyosin alpha-3 chain — P06753 (reviewed: P06753)

Alternative names: Gamma-tropomyosin, Tropomyosin-3, Tropomyosin-5

All UniProt accessions (12): P06753, A0A087WWU8, A0A0S2Z4G4, A0A0S2Z4I4, A0A2R2Y2Q3, A0A494C034, A0A494C0G0, A0A494C0P6, D6R904, D6RGJ6, J3KN67, Q5VU61

UniProt curated annotations — full annotation on UniProt →

Function. Binds to actin filaments in muscle and non-muscle cells. Plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction. Smooth muscle contraction is regulated by interaction with caldesmon. In non-muscle cells is implicated in stabilizing cytoskeleton actin filaments.

Subunit / interactions. Homodimer. Heterodimer of an alpha (TPM1, TPM3 or TPM4) and a beta (TPM2) chain. Interacts with TMOD1. Interacts with TNNT1.

Subcellular location. Cytoplasm. Cytoskeleton.

Disease relevance. Congenital myopathy 4A, autosomal dominant (CMYO4A) [MIM:255310] A muscular disorder characterized by onset of muscle weakness in infancy or childhood. Most affected individuals show mildly delayed motor development, hypotonia, generalized muscle weakness, and weakness of the proximal limb muscles and neck muscles, resulting in difficulty running and easy fatigability. Many patients have respiratory insufficiency with reduced vital capacity. Skeletal muscle biopsy shows nemaline rod inclusions, subsarcolemmal ‘cap’ structures, and fiber-type disproportion. The disease is caused by variants affecting the gene represented in this entry. Congenital myopathy 4B, autosomal recessive (CMYO4B) [MIM:609284] A muscular disorder characterized by muscle weakness appearing in infancy or early childhood. Most affected individuals show congenital contractures, delayed motor development, hypotonia, respiratory insufficiency, generalized muscle weakness, and weakness of the proximal limb muscles and neck muscles, resulting in difficulty walking or inability to walk. Skeletal muscle biopsy shows variable histologic findings, including nemaline rods, type 1 fiber predomination, and centralized nuclei. The disease is caused by variants affecting the gene represented in this entry. A chromosomal aberration involving TPM3 is found in papillary thyroid carcinomas (PTCs). A rearrangement with NTRK1 generates the TRK fusion transcript by fusing the amino end of isoform 2 of TPM3 to the 3’-end of NTRK1.

Domain organisation. The molecule is in a coiled coil structure that is formed by 2 polypeptide chains. The sequence exhibits a prominent seven-residues periodicity.

Miscellaneous. Peptides 2-27, 41-55, 132-153, 163-169, 216-225 and 237-248 have been identified and sequenced by MS. PubMed:16201836 (ABC40673) sequence corresponds to a TPM3 retrocopy (rcTPM3) on chromosome 16 that is generated by retroposition of reversed transcribed mRNA back to the genome. rcTPM3 functionality is uncertain. It has been detected by MS in primary breast cancer tissues. Peptides 2-27, 41-55, 132-153 and 163-169 have been identified and sequenced by MS.

Similarity. Belongs to the tropomyosin family.

Isoforms (7)

UniProt ID	Names	Canonical?
P06753-1	1, Skeletal muscle	yes
P06753-2	2, Cytoskeletal, TM30nm
P06753-3	3
P06753-4	4
P06753-5	5
P06753-6	6
P06753-7	7

RefSeq proteins (15): NP_001036816, NP_001036817, NP_001036818, NP_001265117, NP_001265118, NP_001265119, NP_001265120, NP_001336608, NP_001351608, NP_001351609, NP_001351610, NP_001351611, NP_001351612, NP_689476, NP_705935 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000533	Tropomyosin	Family

Pfam: PF00261

UniProt features (67 total): modified residue 20, sequence variant 18, sequence conflict 11, splice variant 10, initiator methionine 3, chain 1, region of interest 1, coiled-coil region 1, compositionally biased region 1, helix 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
6OTN	X-RAY DIFFRACTION	2.4

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P06753-F1	91.69	0.73

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (20): 207, 216, 253, 262, 272, 283, 284, 2, 177, 2, 215, 54, 2, 177, 215, 177, 125, 62, 88, 109

Function

Pathways and Gene Ontology

Reactome pathways

4 pathways

ID	Pathway
R-HSA-390522	Striated Muscle Contraction
R-HSA-445355	Smooth Muscle Contraction
R-HSA-9013424	RHOV GTPase cycle
R-HSA-9725370	Signaling by ALK fusions and activated point mutants

MSigDB gene sets: 565 (showing top): GSE45365_NK_CELL_VS_CD11B_DC_DN, CREL_01, RORA1_01, CMYB_01, GRAESSMANN_APOPTOSIS_BY_SERUM_DEPRIVATION_DN, GRAESSMANN_RESPONSE_TO_MC_AND_SERUM_DEPRIVATION_DN, MAZ_Q6, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_DN, DARWICHE_SKIN_TUMOR_PROMOTER_DN, DARWICHE_PAPILLOMA_RISK_LOW_DN, AP4_Q6, DARWICHE_PAPILLOMA_RISK_HIGH_DN, TGACCTY_ERR1_Q2, DARWICHE_SQUAMOUS_CELL_CARCINOMA_DN

GO Biological Process (2): muscle contraction (GO:0006936), actin filament organization (GO:0007015)

GO Molecular Function (3): actin filament binding (GO:0051015), actin binding (GO:0003779), protein binding (GO:0005515)

GO Cellular Component (9): stress fiber (GO:0001725), mitochondrion (GO:0005739), cytosol (GO:0005829), cytoskeleton (GO:0005856), muscle thin filament tropomyosin (GO:0005862), actin filament (GO:0005884), actin cytoskeleton (GO:0015629), extracellular exosome (GO:0070062), cytoplasm (GO:0005737)

Reactome top-level categories

Rollup of top-3 pathways:

Category	Pathways
Muscle contraction	2
RHO GTPase cycle	1
Signaling by ALK in cancer	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cytoplasm	2
cellular anatomical structure	2
muscle system process	1
actin cytoskeleton organization	1
supramolecular fiber organization	1
actin binding	1
protein-containing complex binding	1
cytoskeletal protein binding	1
binding	1
actomyosin	1
contractile actin filament bundle	1
intracellular membrane-bounded organelle	1
intracellular membraneless organelle	1
striated muscle thin filament	1
protein-containing complex	1
actin cytoskeleton	1
polymeric cytoskeletal fiber	1
cytoskeleton	1
extracellular vesicle	1
intracellular anatomical structure	1

Protein interactions and networks

STRING

3224 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TPM3	TSPAN16	Q9UKR8	997
TPM3	KBTBD13	C9JR72	884
TPM3	NTRK1	P04629	864
TPM3	RET	P07949	831
TPM3	TNNT1	P13805	824
TPM3	ADRB2	P07550	822
TPM3	ACTA1	P02568	818
TPM3	ALK	Q9UM73	816
TPM3	TPM1	P09493	806
TPM3	IL2	P01585	805
TPM3	RHO	P08100	787
TPM3	ROS1	P08922	766
TPM3	SPTB	P11277	753
TPM3	TNNI1	P19237	749
TPM3	SLC34A2	O95436	747

IntAct

338 interactions, top by confidence:

A	B	Type	Score
KXD1	TPM3	psi-mi:“MI:0915”(physical association)	0.920
TPM3	KXD1	psi-mi:“MI:0915”(physical association)	0.920
TPM3	OIP5	psi-mi:“MI:0915”(physical association)	0.850
HSF2	TPM3	psi-mi:“MI:0915”(physical association)	0.850
TPM3	MAD1L1	psi-mi:“MI:0915”(physical association)	0.850
TPM3	HSF2	psi-mi:“MI:0915”(physical association)	0.850
MAD1L1	TPM3	psi-mi:“MI:0915”(physical association)	0.850
TFPT	TPM3	psi-mi:“MI:0915”(physical association)	0.850
TPM3	TFPT	psi-mi:“MI:0915”(physical association)	0.850

BioGRID (537): TPM3 (Affinity Capture-MS), TPM3 (Two-hybrid), TPM3 (Two-hybrid), TPM3 (Two-hybrid), TPM3 (Two-hybrid), TPM3 (Two-hybrid), TPM3 (Two-hybrid), TPM3 (Two-hybrid), TPM3 (Two-hybrid), TPM3 (Two-hybrid), TPM3 (Two-hybrid), TRIP6 (Two-hybrid), MAD1L1 (Two-hybrid), TLK1 (Two-hybrid), OIP5 (Two-hybrid)

ESM2 similar proteins: A1XQV4, A2V735, C5J049, O18416, O96764, O97192, P02561, P04268, P04692, P06753, P07951, P09491, P09493, P09495, P0DSM6, P0DSM7, P13104, P13105, P15846, P19352, P21107, P31816, P42637, P42639, P58771, P58772, P58773, P58774, P58775, P58776, P67936, P67937, P84335, Q01173, Q07068, Q1HPQ0, Q1HPU0, Q22866, Q23758, Q23939

Diamond homologs: A1XQV4, P02561, P04268, P04692, P06753, P07951, P09493, P13104, P13105, P19352, P21107, P42639, P58771, P58772, P58773, P58774, P58775, P58776, P67936, P67937, P84335, Q01173, Q07068, Q5KR47, Q5KR48, Q5KR49, Q9NDS0, O97162, P15846, Q22866, Q25632, Q8IT89, Q8WR63, Q95VA8, Q9NAS5

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
TMOD1	“down-regulates activity”	TPM3	binding

Disease & clinical

Clinical variants and AI predictions

ClinVar

434 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	15
Likely pathogenic	18
Uncertain significance	216
Likely benign	111
Benign	13

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
12446	NM_152263.4(TPM3):c.26T>G (p.Met9Arg)	Pathogenic
12449	NM_152263.4(TPM3):c.94C>T (p.Gln32Ter)	Pathogenic
12450	NM_152263.4(TPM3):c.503G>A (p.Arg168His)	Pathogenic
12451	NM_152263.4(TPM3):c.855del (p.Ter286AsnextTer?)	Pathogenic
12452	NM_152263.4(TPM3):c.298C>A (p.Leu100Met)	Pathogenic
12454	NM_152263.4(TPM3):c.502C>T (p.Arg168Cys)	Pathogenic
1394827	NM_152263.4(TPM3):c.87_91del (p.Gln30fs)	Pathogenic
1412784	NC_000001.10:g.(?154163642)(154164494_?)del	Pathogenic
235143	NM_152263.4(TPM3):c.670GAA[1] (p.Glu225del)	Pathogenic
2443942	NM_152263.4(TPM3):c.445C>A (p.Leu149Ile)	Pathogenic
2882127	NM_152263.4(TPM3):c.138del (p.Met47fs)	Pathogenic
2925294	NM_152263.4(TPM3):c.452A>C (p.Glu151Ala)	Pathogenic
42114	NM_152263.4(TPM3):c.272G>C (p.Arg91Pro)	Pathogenic
462142	NM_152263.4(TPM3):c.758C>A (p.Thr253Lys)	Pathogenic
4785939	NM_152263.4(TPM3):c.688dup (p.Thr230fs)	Pathogenic
12447	NM_152263.4(TPM3):c.857A>C (p.Ter286Ser)	Likely pathogenic
1474806	NM_152263.4(TPM3):c.271C>G (p.Arg91Gly)	Likely pathogenic
1510671	NM_152263.4(TPM3):c.44A>T (p.Asp15Val)	Likely pathogenic
212412	NM_152263.4(TPM3):c.734G>T (p.Arg245Ile)	Likely pathogenic
2141661	NM_152263.4(TPM3):c.272G>A (p.Arg91His)	Likely pathogenic
235144	NM_152263.4(TPM3):c.654AGA[1] (p.Glu219del)	Likely pathogenic
2431882	NM_152263.4(TPM3):c.535C>T (p.Arg179Cys)	Likely pathogenic
2434217	NM_152263.4(TPM3):c.39del (p.Lys13fs)	Likely pathogenic
2939283	NM_152263.4(TPM3):c.243+1G>A	Likely pathogenic
2951138	NM_152263.4(TPM3):c.137C>T (p.Ala46Val)	Likely pathogenic
3247695	NC_000001.10:g.(?154148571)(154148744_?)dup	Likely pathogenic
3338267	NM_152263.4(TPM3):c.41T>G (p.Leu14Ter)	Likely pathogenic
3571611	NM_152263.4(TPM3):c.856T>C (p.Ter286Gln)	Likely pathogenic
3899370	NM_152263.4(TPM3):c.452A>G (p.Glu151Gly)	Likely pathogenic
531180	NM_152263.4(TPM3):c.298C>G (p.Leu100Val)	Likely pathogenic

SpliceAI

1583 predictions. Top by Δscore:

Variant	Effect	Δscore
1:154169402:C:CT	acceptor_gain	1.0000
1:154170465:TCTGC:T	acceptor_loss	1.0000
1:154170466:CTGC:C	acceptor_gain	1.0000
1:154170470:C:A	acceptor_loss	1.0000
1:154170470:C:CC	acceptor_gain	1.0000
1:154170471:T:C	acceptor_loss	1.0000
1:154170650:T:TA	donor_gain	1.0000
1:154170707:GAGTA:G	acceptor_gain	1.0000
1:154170708:AGTA:A	acceptor_gain	1.0000
1:154170709:GTA:G	acceptor_gain	1.0000
1:154170710:TA:T	acceptor_gain	1.0000
1:154170711:AC:A	acceptor_loss	1.0000
1:154170712:C:CA	acceptor_loss	1.0000
1:154170712:C:CC	acceptor_gain	1.0000
1:154170713:T:C	acceptor_loss	1.0000
1:154171485:CTTA:C	acceptor_gain	1.0000
1:154171498:T:TC	acceptor_gain	1.0000
1:154171508:C:CT	acceptor_gain	1.0000
1:154172026:TACCT:T	donor_loss	1.0000
1:154172027:ACCTT:A	donor_loss	1.0000
1:154172130:C:CT	acceptor_gain	1.0000
1:154172137:C:CT	acceptor_gain	1.0000
1:154172137:C:T	acceptor_gain	1.0000
1:154172138:A:T	acceptor_gain	1.0000
1:154172141:T:C	acceptor_gain	1.0000
1:154172141:T:TC	acceptor_gain	1.0000
1:154172143:G:C	acceptor_gain	1.0000
1:154172143:G:GC	acceptor_gain	1.0000
1:154172161:C:CT	acceptor_gain	1.0000
1:154172902:A:AC	donor_gain	1.0000

AlphaMissense

1890 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:154170469:C:G	A236P	1.000
1:154170656:A:G	L233P	1.000
1:154173104:C:G	A159P	1.000
1:154173113:C:G	A156P	1.000
1:154173125:C:G	A152P	1.000
1:154173133:A:G	L149P	1.000
1:154176193:A:G	L100P	1.000
1:154169335:A:G	L275P	0.999
1:154170405:A:G	L257P	0.999
1:154170426:A:G	L250P	0.999
1:154170448:C:G	A243P	0.999
1:154170449:A:C	F242L	0.999
1:154170449:A:T	F242L	0.999
1:154170451:A:G	F242L	0.999
1:154170457:C:G	A240P	0.999
1:154170668:A:G	L229P	0.999
1:154171421:C:G	A212P	0.999
1:154171432:A:G	L208P	0.999
1:154171441:A:G	L205P	0.999
1:154171462:A:G	L198P	0.999
1:154172924:C:G	A184P	0.999
1:154172971:C:G	R168P	0.999
1:154173178:C:G	R134P	0.999
1:154176143:C:G	A117P	0.999
1:154176151:A:G	L114P	0.999
1:154176172:A:G	L107P	0.999
1:154176208:A:G	L95P	0.999
1:154176220:C:G	R91P	0.999
1:154169323:A:G	L279P	0.998
1:154169327:C:G	A278P	0.998

dbSNP variants (sampled 300 via entrez): RS1000014929 (1:154179782 ATCAGATCCACAGGTGGACC>A), RS1000062950 (1:154187788 T>C), RS1000108369 (1:154160963 T>G), RS1000215533 (1:154182448 C>T), RS1000222302 (1:154159691 C>A), RS1000408748 (1:154167187 G>A), RS1000494515 (1:154162606 T>A), RS1000503952 (1:154181048 C>A,T), RS1000511471 (1:154193448 G>C), RS1000867590 (1:154187470 G>C), RS1000874716 (1:154160154 C>T), RS1000893114 (1:154167150 T>C), RS1000926648 (1:154160586 C>T), RS1001028867 (1:154180766 A>T), RS1001178790 (1:154166034 TTC>T)

Disease associations

OMIM: gene MIM:191030 | disease phenotypes: MIM:609284, MIM:255310, MIM:256030, MIM:160150

GenCC curated gene-disease

Disease	Classification	Inheritance
TPM3-related myopathy	Definitive	Autosomal dominant
congenital myopathy 4A, autosomal dominant	Definitive	Autosomal dominant
congenital myopathy 4B, autosomal recessive	Strong	Autosomal recessive
congenital fiber-type disproportion myopathy	Moderate	Semidominant
intermediate nemaline myopathy	Supportive	Autosomal dominant
childhood-onset nemaline myopathy	Supportive	Autosomal dominant
cap myopathy	Supportive	Autosomal dominant
congenital generalized hypercontractile muscle stiffness syndrome	Supportive	Autosomal dominant

ClinGen Gene-Disease Validity (2)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
TPM3-related myopathy	Definitive	AD
TPM3-related myopathy	Definitive	AR

Mondo (11): congenital fiber-type disproportion myopathy (MONDO:0009711), congenital myopathy 4B, autosomal recessive (MONDO:0012239), congenital myopathy 4A, autosomal dominant (MONDO:0800341), nemaline myopathy (MONDO:0018958), centronuclear myopathy (MONDO:0018947), TPM3-related myopathy (MONDO:0100108), myopathy (MONDO:0005336), intermediate nemaline myopathy (MONDO:0015736), childhood-onset nemaline myopathy (MONDO:0015738), cap myopathy (MONDO:0015753), congenital generalized hypercontractile muscle stiffness syndrome (MONDO:0018780)

Orphanet (6): Intermediate nemaline myopathy (Orphanet:171433), Childhood-onset nemaline myopathy (Orphanet:171439), Cap myopathy (Orphanet:171881), Congenital fiber-type disproportion myopathy (Orphanet:2020), Nemaline myopathy (Orphanet:607), Centronuclear myopathy (Orphanet:595)

HPO phenotypes

141 total (30 of 141 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000007	Autosomal recessive inheritance
HP:0000218	High palate
HP:0000275	Narrow face
HP:0000276	Long face
HP:0000316	Hypertelorism
HP:0000343	Long philtrum
HP:0000347	Micrognathia
HP:0000369	Low-set ears
HP:0000467	Neck muscle weakness
HP:0000508	Ptosis
HP:0000602	Ophthalmoplegia
HP:0000678	Dental crowding
HP:0000765	Abnormal thorax morphology
HP:0000767	Pectus excavatum
HP:0000774	Narrow chest
HP:0001252	Hypotonia
HP:0001265	Hyporeflexia
HP:0001270	Motor delay
HP:0001283	Bulbar palsy
HP:0001284	Areflexia
HP:0001288	Gait disturbance
HP:0001290	Generalized hypotonia
HP:0001315	Reduced tendon reflexes
HP:0001319	Neonatal hypotonia
HP:0001349	Facial diplegia
HP:0001371	Flexion contracture
HP:0001374	Congenital hip dislocation
HP:0001508	Failure to thrive
HP:0001533	Slender build

GWAS associations

18 associations (top):

Study	Trait	p-value
GCST004603_168	Platelet count	2.000000e-09
GCST005993_63	Mean corpuscular hemoglobin	7.000000e-15
GCST006011_89	Mean corpuscular volume	8.000000e-16
GCST008810_86	Smoking initiation (ever regular vs never regular)	4.000000e-13
GCST010137_3	Cooked vegetable consumption	3.000000e-09
GCST010142_92	Fish- and plant-related diet	6.000000e-14
GCST010696_22	Cortical thickness (min-P)	4.000000e-10
GCST010697_50	Cortical surface area (min-P)	1.000000e-12
GCST010698_81	Subcortical volume (min-P)	1.000000e-23
GCST010699_7	Brain morphology (min-P)	1.000000e-10
GCST010700_11	Cortical thickness (MOSTest)	4.000000e-13
GCST010701_73	Cortical surface area (MOSTest)	4.000000e-09
GCST010702_45	Subcortical volume (MOSTest)	4.000000e-10
GCST010703_276	Brain morphology (MOSTest)	2.000000e-15
GCST90002385_93	High light scatter reticulocyte count	9.000000e-11
GCST90002386_375	High light scatter reticulocyte percentage of red cells	3.000000e-09
GCST90002392_283	Mean corpuscular volume	9.000000e-10
GCST90002396_143	Mean reticulocyte volume	1.000000e-09

EFO canonical traits (8, from GWAS)

EFO ID	Trait name
EFO:0004309	platelet count
EFO:0004527	mean corpuscular hemoglobin
EFO:0005670	smoking initiation
EFO:0008111	diet measurement
EFO:0004346	neuroimaging measurement
EFO:0004840	cortical thickness
EFO:0007986	reticulocyte count
EFO:0010701	mean reticulocyte volume

MeSH disease descriptors (3)

Descriptor	Name	Tree numbers
D017696	Myopathies, Nemaline	C05.651.575.290; C10.668.491.550.290
C579969	Cap Myopathy (supp.)
C538348	Nemaline myopathy 1 (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (3): CHEMBL3804747 (SINGLE PROTEIN), CHEMBL3883331 (CHIMERIC PROTEIN), CHEMBL5465392 (CHIMERIC PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

2 potent at pChembl≥5 of 4 total, top 2 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
5.25	Kd	5570	nM	CHEMBL3752910
5.25	ED50	5570	nM	CHEMBL3752910

PubChem BioAssay actives

1 with measured affinity, of 21 total; 1 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-methyl-3-[(1-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2149643: Binding affinity to human TPM3 incubated for 45 mins by Kinobead based pull down assay	kd	5.5705	uM

CTD chemical–gene interactions

76 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	affects expression, decreases expression, increases expression, affects cotreatment	5
Decitabine	affects expression, decreases expression, decreases reaction	3
bisphenol F	increases expression, affects cotreatment, decreases expression	2
sodium arsenite	affects cotreatment, decreases expression, increases abundance, increases expression	2
Rosiglitazone	affects expression, decreases expression, increases reaction	2
Arsenic	increases abundance, affects methylation, affects cotreatment, decreases expression	2
Benzo(a)pyrene	affects methylation, increases methylation	2
Copper	affects binding, decreases expression	2
Smoke	decreases expression, decreases reaction	2
Tretinoin	decreases expression, increases expression	2
Valproic Acid	increases expression	2
Particulate Matter	decreases expression, increases abundance, increases expression, affects cotreatment	2
3-((6-(2-methoxyphenyl)pyrimidin-4-yl)amino)phenyl)methane sulfonamide	decreases expression	1
triphenyl phosphate	affects expression	1
alpha-pinene	affects cotreatment, increases oxidation, increases abundance	1
sodium arsenate	decreases expression	1
pyrogallol 1,3-dimethyl ether	affects cotreatment, affects localization, decreases expression, increases expression	1
trichostatin A	decreases expression	1
arsenite	affects binding, increases reaction	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
butyraldehyde	increases expression	1
ochratoxin A	increases expression	1
methacrylaldehyde	affects cotreatment, increases oxidation, increases abundance	1
beta-methylcholine	affects expression	1
phenethyl isothiocyanate	affects binding	1
penconazole	increases expression	1
CGP 52608	affects binding, increases reaction	1
K 7174	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
LDN 193189	affects cotreatment, decreases expression	1

ChEMBL screening assays

18 unique, capped per target: 18 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4118549	Binding	Binding affinity to TPM3 in human NCI-H23 cells at 1 uM by mass spectrometry based pull down assay	Studies of TAK1-centered polypharmacology with novel covalent TAK1 inhibitors. — Bioorg Med Chem

Cellosaurus cell lines

19 cell lines: 18 cancer cell line, 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_1331	KM12	Cancer cell line	Male
CVCL_4M93	KM12-HX	Cancer cell line	Male
CVCL_4M94	KM12-LX	Cancer cell line	Male
CVCL_5920	KM12-OxR	Cancer cell line	Male
CVCL_5946	KM12-L4	Cancer cell line	Male
CVCL_8747	PMF-ko14	Cancer cell line	Male
CVCL_9547	KM12-C	Cancer cell line	Male
CVCL_9548	KM12-SM	Cancer cell line	Male
CVCL_AU12	KM12L4/OXR	Cancer cell line	Male
CVCL_B3JY	Abcam HEK293T TPM3 KO	Transformed cell line	Female

Clinical trials (associated diseases)

63 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00120055	PHASE4	COMPLETED	Association Between Systemic Exposure of Atorvastatin and Metabolites and Atorvastatin-induced Myotoxicity
NCT03633565	PHASE4	UNKNOWN	Comparative Study of Strategies for Management of Duchenne Myopathy (DM)
NCT01225614	PHASE3	UNKNOWN	Efficacy and Tolerance of Early Launching of Nocturnal Non Invasive
NCT02035501	PHASE2	UNKNOWN	Treatment of TNNT1-Myopathy With L-Tyrosine.
NCT00278564	PHASE1	TERMINATED	Stem Cell Transplantation in Idiopathic Inflammatory Myopathy Diseases
NCT00272883	Not specified	RECRUITING	Molecular and Genetic Studies of Congenital Myopathies
NCT06791369	Not specified	NOT_YET_RECRUITING	The Prevalence of RYR1-related Disease
NCT03728803	Not specified	COMPLETED	Inspiratory Muscle Training in Nemaline Myopathy
NCT05099107	Not specified	COMPLETED	Changes of Motor Function Tests in Congenital Myopathy Subjects Treated With Oral Salbutamol as Compared to no Treatment
NCT06157268	Not specified	RECRUITING	The Natural History and Muscle Fatigability of Patients With Congenital Myopathies.
NCT06670378	Not specified	ACTIVE_NOT_RECRUITING	Natural History Study for Patients With Nemaline Myopathy in the UK
NCT06774703	Not specified	NOT_YET_RECRUITING	Nemaline Myopathy Clinical Research Network (NM-CTRN)
NCT07201636	Not specified	NOT_YET_RECRUITING	Natural History Study for Patients With Nemaline Myopathy in Belgium
NCT07478172	Not specified	RECRUITING	Effects of Whole-body Electrical Muscle Stimulation Exercise on Adults With Neuromuscular Disease
NCT07488806	Not specified	RECRUITING	Natural History Study for Patients With Nemaline Myopathy in Spain
NCT04033159	PHASE1/PHASE2	TERMINATED	Early Phase Human Drug Trial to Investigate Dynamin 101 (DYN101) in Patients ≥ 16 Years With Centronuclear Myopathies
NCT04743557	PHASE1/PHASE2	WITHDRAWN	Early Phase Human Drug Trial to Investigate DYN101 in Participants 2 to 17 Years With Centronuclear Myopathies
NCT03351270	Not specified	COMPLETED	Prospective Natural History Study of Patients With Myotubular Myopathy and Other CentroNuclear Myopathies
NCT04064307	Not specified	RECRUITING	Myotubular and Centronuclear Myopathy Patient Registry
NCT04977648	Not specified	WITHDRAWN	Natural History Study of Patients With Centronuclear Myopathies
NCT05982119	Not specified	RECRUITING	Assessments in Patients With Muscular Pathology and in Control Subjects : The ActiLiège Next Study
NCT07021820	Not specified	RECRUITING	Multispectral Optoacoustic Tomography for Advanced Imaging of Centronuclear Myopathy
NCT01642056	PHASE1/PHASE2	COMPLETED	EPI-743 for Metabolism or Mitochondrial Disorders
NCT02124070	PHASE1/PHASE2	WITHDRAWN	Therapeutic Effect of Recombinant Human Growth Hormone (rhGH) on the Myopathy of Cystinosis
NCT00549029	Not specified	UNKNOWN	The Association of Genetic Polymorphisms With Statin-Induced Myopathy.
NCT00767130	Not specified	UNKNOWN	DNA Diagnostic System for Statin Safety and Efficacy
NCT00922428	Not specified	COMPLETED	PASCOE-Agil HOM-Injektopas in the Treatment of Rheumatic Disorders
NCT00937001	Not specified	ACTIVE_NOT_RECRUITING	Critical Illness Myopathy as a Cause of Debilitating ICU-Acquired Weakness
NCT00990834	Not specified	WITHDRAWN	Muscle Characteristics Associated With Statin Therapy
NCT01022450	Not specified	UNKNOWN	Study of the Causes of the Breakdown of Muscle Fibers in Hospitalized Patients
NCT01040650	Not specified	TERMINATED	Metabolic Features of Post-Myopathy Patients Associated With Statin Treatment
NCT01047163	Not specified	COMPLETED	Maintenance of Muscle Mass in Older People: the Negative Impact of Statin Therapy
NCT01270269	Not specified	COMPLETED	ACT-ICU Study: Activity and Cognitive Therapy in the Intensive Care Unit
NCT01353430	Not specified	RECRUITING	Characterization of Inclusion Body Myopathy Associated With Paget’s Disease of Bone and Frontotemporal Dementia (IBMPFD)
NCT01395563	Not specified	WITHDRAWN	Strength Training on Pancreatic Cancer
NCT01530841	Not specified	COMPLETED	Efficacy and Tolerance of AVAPS Mode in Myotonic Dystrophy
NCT01547767	Not specified	COMPLETED	Investigations Into ISCU Myopathy or Iron Sulfur Scaffold U Protein Myopathy
NCT01702987	Not specified	COMPLETED	Evaluation of Ubiquinol on Mitochondrial Oxidative Capacity in Statin Patients Using 31PMRS
NCT01790178	Not specified	COMPLETED	Ultrasound in Muscle Biopsy
NCT02011282	Not specified	COMPLETED	Electro-Neuro-Muscular Stimulation in ICU