TRABD

Summary

TRABD (TraB domain containing, HGNC:28805) is a protein-coding gene on chromosome 22q13.33, encoding TraB domain-containing protein (Q9H4I3). Along with MFN2, MIGA2 and PLD6 promotes mitochondrial clustering and fusion.

Enables mitochondrion-mitochondrion outer membrane tether activity. Involved in mitochondrial fusion. Located in mitochondrion. Is active in mitochondrial outer membrane.

Source: NCBI Gene 80305 — RefSeq curated summary.

At a glance

• GWAS associations: 14
• Clinical variants (ClinVar): 72 total
• MANE Select transcript: NM_001320485

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:28805
Approved symbol	TRABD
Name	TraB domain containing
Location	22q13.33
Locus type	gene with protein product
Status	Approved
Aliases	PP2447
Ensembl gene	ENSG00000170638
Ensembl biotype	protein_coding
OMIM	621246
Entrez	80305

Gene structure

Transcript identifiers

Ensembl transcripts: 35 — 33 protein_coding, 2 retained_intron

ENST00000303434, ENST00000380909, ENST00000395827, ENST00000395829, ENST00000463233, ENST00000472677, ENST00000906961, ENST00000906962, ENST00000906963, ENST00000906964, ENST00000906965, ENST00000906966, ENST00000906967, ENST00000906968, ENST00000906969, ENST00000906970, ENST00000906971, ENST00000906972, ENST00000906973, ENST00000906974, ENST00000906975, ENST00000916737, ENST00000916738, ENST00000916739, ENST00000916740, ENST00000916741, ENST00000916742, ENST00000916743, ENST00000916744, ENST00000916745, ENST00000916746, ENST00000941707, ENST00000941708, ENST00000941709, ENST00000941710

RefSeq mRNA: 7 — MANE Select: NM_001320485 NM_001320484, NM_001320485, NM_001320487, NM_001320488, NM_001378762, NM_001378765, NM_025204

CCDS: CCDS14086, CCDS82724

Canonical transcript exons

ENST00000380909 — 10 exons

Exon	Start	End
ENSE00001129699	50198075	50198186
ENSE00001129703	50197823	50197995
ENSE00001522976	50185913	50185976
ENSE00001842935	50198345	50199595
ENSE00003459715	50193576	50193654
ENSE00003625841	50197241	50197351
ENSE00003634438	50193027	50193093
ENSE00003644353	50197449	50197588
ENSE00003678309	50194340	50194506
ENSE00003694552	50194900	50195040

Expression profiles

Bgee: expression breadth ubiquitous, 266 present calls, max score 96.95.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 34.9574 / max 594.9924, expressed in 1820 samples.

FANTOM5 promoters (7 alternative TSS)

Promoter ID	TPM avg	Samples expressed
192968	27.5821	1816
192971	3.9742	945
192972	2.5338	435
192969	0.4078	191
192970	0.3215	170
192973	0.0987	33
192974	0.0393	14

Top tissues by expression

289 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
granulocyte	CL:0000094	96.95	gold quality
lower esophagus mucosa	UBERON:0035834	96.28	gold quality
body of pancreas	UBERON:0001150	96.26	gold quality
parotid gland	UBERON:0001831	95.54	gold quality
mucosa of transverse colon	UBERON:0004991	94.91	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	94.10	gold quality
small intestine Peyer’s patch	UBERON:0003454	94.01	gold quality
right hemisphere of cerebellum	UBERON:0014890	93.53	gold quality
tendon of biceps brachii	UBERON:0008188	93.39	gold quality
saliva-secreting gland	UBERON:0001044	93.09	gold quality
body of stomach	UBERON:0001161	93.09	gold quality
spleen	UBERON:0002106	93.01	gold quality
cerebellar hemisphere	UBERON:0002245	93.00	gold quality
right lobe of thyroid gland	UBERON:0001119	92.98	gold quality
minor salivary gland	UBERON:0001830	92.97	gold quality
vena cava	UBERON:0004087	92.89	gold quality
cerebellar cortex	UBERON:0002129	92.83	gold quality
transverse colon	UBERON:0001157	92.78	gold quality
esophagus mucosa	UBERON:0002469	92.64	gold quality
right uterine tube	UBERON:0001302	92.58	gold quality
monocyte	CL:0000576	92.56	gold quality
left lobe of thyroid gland	UBERON:0001120	92.53	gold quality
adenohypophysis	UBERON:0002196	92.51	gold quality
right lung	UBERON:0002167	92.34	gold quality
endocervix	UBERON:0000458	92.28	gold quality
mononuclear cell	CL:0000842	92.17	gold quality
leukocyte	CL:0000738	92.13	gold quality
left uterine tube	UBERON:0001303	92.01	gold quality
metanephros cortex	UBERON:0010533	92.00	gold quality
body of tongue	UBERON:0011876	91.97	gold quality

Single-cell (SCXA)

Detected in 5 experiment(s), a significant marker in 5.

Experiment	Marker?	Max mean expression
E-HCAD-4	yes	57.86
E-CURD-112	yes	37.43
E-MTAB-9067	yes	13.17
E-ANND-3	yes	11.24
E-CURD-122	yes	5.02

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

47 targeting TRABD, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6873-3P	100.00	71.42	2626
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-4768-5P	100.00	69.49	2861
HSA-MIR-4500	99.99	72.72	2367
HSA-MIR-10401-5P	99.99	65.79	948
HSA-LET-7A-5P	99.98	72.29	1790
HSA-LET-7B-5P	99.98	72.31	1790
HSA-LET-7C-5P	99.98	72.29	1790
HSA-LET-7E-5P	99.98	72.29	1790
HSA-LET-7F-5P	99.98	72.56	1784
HSA-LET-7G-5P	99.98	72.37	1784
HSA-LET-7I-5P	99.98	72.37	1788
HSA-MIR-98-5P	99.98	72.33	1787
HSA-LET-7D-5P	99.96	71.76	1632
HSA-MIR-4458	99.96	71.64	1650
HSA-MIR-205-3P	99.92	69.92	3165
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-6756-5P	99.82	67.97	2466
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-6817-3P	99.79	68.35	2126
HSA-MIR-3617-5P	99.75	69.41	1968
HSA-MIR-641	99.75	69.35	1975
HSA-MIR-7856-5P	99.75	69.99	2901
HSA-MIR-149-3P	99.72	68.22	3963
HSA-MIR-6883-5P	99.69	68.05	3785
HSA-MIR-6766-5P	99.68	67.70	2325
HSA-MIR-762	99.58	66.61	1994
HSA-MIR-4328	99.57	71.06	4094
HSA-MIR-5004-3P	99.54	68.27	1371

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	trabd	ENSDARG00000010445
mus_musculus	Trabd	ENSMUSG00000015363
rattus_norvegicus	Trabd	ENSRNOG00000029095
drosophila_melanogaster	CG46280	FBGN0283438
caenorhabditis_elegans		WBGENE00018161

Protein

Protein identifiers

TraB domain-containing protein — Q9H4I3 (reviewed: Q9H4I3)

Alternative names: Protein TTG2

All UniProt accessions (2): Q9H4I3, J3KPT4

UniProt curated annotations — full annotation on UniProt →

Function. Along with MFN2, MIGA2 and PLD6 promotes mitochondrial clustering and fusion. May play a role in mitochondrial import of proteins, such as that of SLC25A19.

Subunit / interactions. Forms homomers. Interacts with MFN2; this interaction may be required to efficiently promote mitochondrial fusion. Interacts with MIGA2 and PLD6. Interacts with MUL1. Interacts with the translocase of the outer mitochondrial membrane (TOM complex).

Subcellular location. Mitochondrion outer membrane.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9H4I3-1	1	yes
Q9H4I3-2	2

RefSeq proteins (7): NP_001307413, NP_001307414, NP_001307416, NP_001307417, NP_001365691, NP_001365694, NP_079480 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002816	TraB/PrgY/GumN_fam	Family
IPR046345	TraB_PrgY-like	Family

Pfam: PF01963

UniProt features (19 total): mutagenesis site 9, topological domain 2, region of interest 2, modified residue 2, chain 1, transmembrane region 1, compositionally biased region 1, splice variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9H4I3-F1	80.89	0.37

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (2): 1, 65

Mutagenesis-validated functional residues (9):

Position	Phenotype
80	no effect on mitochondrial localization, nor on mitochondrial clustering.
82	no effect on mitochondrial localization, nor on mitochondrial clustering.
100	no effect on mitochondrial clustering.
106	no effect on mitochondrial localization, nor on mitochondrial clustering.
196	no effect on mitochondrial clustering.
259	no effect on mitochondrial localization, nor on mitochondrial clustering.
299	no effect on mitochondrial clustering.
300	no effect on mitochondrial localization, nor on mitochondrial clustering.
329	no effect on mitochondrial clustering.

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 125 (showing top): MODULE_255, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_UP, MODULE_317, NIKOLSKY_BREAST_CANCER_22Q13_AMPLICON, GTGCCTT_MIR506, GOCC_MITOCHONDRIAL_ENVELOPE, LIAO_METASTASIS, GOBP_MITOCHONDRIAL_FUSION, BERTUCCI_MEDULLARY_VS_DUCTAL_BREAST_CANCER_UP, GOBP_PROTEIN_LOCALIZATION_TO_ORGANELLE, GOBP_PROTEIN_LOCALIZATION_TO_MITOCHONDRION, GOBP_ORGANELLE_FUSION, GINESTIER_BREAST_CANCER_ZNF217_AMPLIFIED_DN, GOCC_OUTER_MITOCHONDRIAL_MEMBRANE_PROTEIN_COMPLEX, TCCCRNNRTGC_UNKNOWN

GO Biological Process (2): mitochondrial fusion (GO:0008053), protein localization to mitochondrion (GO:0070585)

GO Molecular Function (1): mitochondrion-mitochondrion outer membrane tether activity (GO:0160204)

GO Cellular Component (3): mitochondrion (GO:0005739), mitochondrial outer membrane (GO:0005741), TOM complex (GO:0140596)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
mitochondrion organization	1
organelle fusion	1
protein localization to organelle	1
membrane-membrane adaptor activity	1
cytoplasm	1
intracellular membrane-bounded organelle	1
mitochondrial membrane	1
organelle outer membrane	1
mitochondrial outer membrane translocase complex	1

Protein interactions and networks

STRING

688 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TRABD	TBC1D22A	Q8WUA7	549
TRABD	NTAQ1	Q96HA8	530
TRABD	RBM12B	Q8IXT5	504
TRABD	COPZ2	Q9P299	499
TRABD	TRABD2A	Q86V40	487
TRABD	OSTM1	Q86WC4	454
TRABD	NUDT22	Q9BRQ3	436
TRABD	TMED6	Q8WW62	416
TRABD	LARGE2	Q8N3Y3	404
TRABD	QTRT1	Q9BXR0	399
TRABD	TTC7B	Q86TV6	399
TRABD	FAM3B	P58499	399
TRABD	CEP76	Q8TAP6	397
TRABD	TRABD2B	A6NFA1	385
TRABD	QPCTL	Q9NXS2	381

IntAct

66 interactions, top by confidence:

A	B	Type	Score
BECN1	ZWINT	psi-mi:“MI:0914”(association)	0.750
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
PKN3	ARHGAP10	psi-mi:“MI:0914”(association)	0.680
NRAS	RGL2	psi-mi:“MI:0914”(association)	0.550
TRABD	FCN1	psi-mi:“MI:0914”(association)	0.530
PON2	NPC1	psi-mi:“MI:0914”(association)	0.530
TRAK1	MTX2	psi-mi:“MI:0914”(association)	0.530
ABHD14A	TMEM259	psi-mi:“MI:0914”(association)	0.530
ILK	ILVBL	psi-mi:“MI:0914”(association)	0.530
HSCB	RBP5	psi-mi:“MI:0914”(association)	0.350
TPTE	ILVBL	psi-mi:“MI:0914”(association)	0.350
ATP2B2	GPR89A	psi-mi:“MI:0914”(association)	0.350
TRABD	NME2	psi-mi:“MI:0914”(association)	0.350
JMJD4	SPTLC1	psi-mi:“MI:0914”(association)	0.350
M		psi-mi:“MI:0914”(association)	0.350
MAP2K7	ILVBL	psi-mi:“MI:0914”(association)	0.350
BCKDK	AIP	psi-mi:“MI:0914”(association)	0.350
GRK6	ILVBL	psi-mi:“MI:0914”(association)	0.350
ADCK2	ILVBL	psi-mi:“MI:0914”(association)	0.350
ADCK1	BCKDK	psi-mi:“MI:0914”(association)	0.350
STK32C	ILVBL	psi-mi:“MI:0914”(association)	0.350
CDK20	APOD	psi-mi:“MI:0914”(association)	0.350
COQ8A	ESYT2	psi-mi:“MI:0914”(association)	0.350
UHMK1	CNOT1	psi-mi:“MI:0914”(association)	0.350
COQ8B	DNAJB6	psi-mi:“MI:0914”(association)	0.350
TSSK6	HAX1	psi-mi:“MI:0914”(association)	0.350
ATG16L1	ESYT2	psi-mi:“MI:0914”(association)	0.350

BioGRID (131): NME2 (Affinity Capture-MS), ATP12A (Affinity Capture-MS), HSP90AA4P (Affinity Capture-MS), ATP2B2 (Affinity Capture-MS), DNAJC11 (Affinity Capture-MS), HSDL1 (Affinity Capture-MS), TOMM40 (Affinity Capture-MS), RNF40 (Affinity Capture-MS), UQCRQ (Affinity Capture-MS), NME2 (Affinity Capture-MS), HSP90AA4P (Affinity Capture-MS), TRABD (Affinity Capture-MS), DNAJC11 (Affinity Capture-MS), HSDL1 (Affinity Capture-MS), ATP12A (Affinity Capture-MS)

ESM2 similar proteins: A1C4X8, A2R994, A4FUD1, A4H6J5, A4HAG7, A4HUY0, A4I9M7, A7AW49, A8B3G9, A8JGB0, B4I0K4, B6Q1T9, B9FK36, B9PGU1, O45244, O60231, P06595, Q0CE30, Q0UAM9, Q10SS2, Q1DSY6, Q2UA27, Q2V573, Q382V8, Q3SX23, Q4CNH2, Q4DKF7, Q4DZ91, Q4P8S7, Q4Q3F0, Q4QH08, Q4WEN1, Q58DF3, Q5BB57, Q5PQY6, Q5TGY1, Q6C0L7, Q755E4, Q767K6, Q7QEI1

Diamond homologs: Q58DF3, Q99JY4, Q9H4I3

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

72 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	54
Likely benign	9
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

2280 predictions. Top by Δscore:

Variant	Effect	Δscore
22:50186011:G:GT	donor_gain	1.0000
22:50193568:A:AG	acceptor_gain	1.0000
22:50193568:ACCT:A	acceptor_gain	1.0000
22:50193569:C:G	acceptor_gain	1.0000
22:50193570:CTGCA:C	acceptor_loss	1.0000
22:50193571:TGCAG:T	acceptor_loss	1.0000
22:50193572:GCAGG:G	acceptor_loss	1.0000
22:50193573:CAGGC:C	acceptor_loss	1.0000
22:50193574:A:AG	acceptor_gain	1.0000
22:50193575:G:A	acceptor_loss	1.0000
22:50193575:G:GG	acceptor_gain	1.0000
22:50193650:CCTGT:C	donor_gain	1.0000
22:50193651:CTGT:C	donor_gain	1.0000
22:50193652:TGTGT:T	donor_loss	1.0000
22:50193653:GT:G	donor_gain	1.0000
22:50193653:GTGT:G	donor_loss	1.0000
22:50193655:G:GG	donor_gain	1.0000
22:50194335:TGCAG:T	acceptor_loss	1.0000
22:50194336:GCAGC:G	acceptor_loss	1.0000
22:50194338:A:AG	acceptor_gain	1.0000
22:50194338:AG:A	acceptor_loss	1.0000
22:50194338:AGCC:A	acceptor_gain	1.0000
22:50194339:G:GA	acceptor_gain	1.0000
22:50194339:GCC:G	acceptor_gain	1.0000
22:50194339:GCCG:G	acceptor_gain	1.0000
22:50194339:GCCGA:G	acceptor_gain	1.0000
22:50194495:G:T	donor_gain	1.0000
22:50194507:G:GG	donor_gain	1.0000
22:50194507:GTGAG:G	donor_loss	1.0000
22:50194508:T:A	donor_loss	1.0000

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000104568 (22:50189443 G>A), RS1000107044 (22:50190637 G>A), RS1000184359 (22:50187381 G>C), RS1000249865 (22:50196286 AGCCTGGGCTCCCCAGGGTG>A), RS1000429509 (22:50196420 T>C), RS1000546239 (22:50185234 G>A,T), RS1000550203 (22:50191408 G>A), RS1000557438 (22:50187767 C>A), RS1000583023 (22:50191179 C>A,T), RS1000732757 (22:50195811 G>A,C), RS1000748566 (22:50199603 T>C), RS1000890923 (22:50199276 G>A), RS1001091724 (22:50198913 C>T), RS1001139834 (22:50192678 A>C), RS1001278134 (22:50187312 G>C)

Disease associations

OMIM: gene MIM:621246 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

14 associations (top):

Study	Trait	p-value
GCST002481_12	Acne (severe)	4.000000e-06
GCST004603_154	Platelet count	2.000000e-59
GCST004603_155	Platelet count	4.000000e-22
GCST004607_196	Plateletcrit	2.000000e-55
GCST004607_197	Plateletcrit	6.000000e-23
GCST006101_10	Cardiometabolic and hematological traits	8.000000e-32
GCST010397_98	Gut microbiota (bacterial taxa, rank normal transformation method)	9.000000e-08
GCST90002381_495	Eosinophil count	5.000000e-11
GCST90002382_515	Eosinophil percentage of white cells	7.000000e-10
GCST90002395_627	Mean platelet volume	6.000000e-11
GCST90002400_515	Plateletcrit	1.000000e-133
GCST90002400_516	Plateletcrit	5.000000e-29
GCST90002402_506	Platelet count	1.000000e-27
GCST90002402_655	Platelet count	4.000000e-137

EFO canonical traits (5, from GWAS)

EFO ID	Trait name
EFO:0004309	platelet count
EFO:0007985	platelet crit
EFO:0007874	gut microbiome measurement
EFO:0004842	eosinophil count
EFO:0007991	eosinophil percentage of leukocytes

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

28 total (human), top 28 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, increases expression	2
Tobacco Smoke Pollution	decreases expression, increases expression	2
aristolochic acid I	increases expression	1
triphenyl phosphate	affects expression	1
bisphenol A	affects cotreatment, increases methylation	1
beta-lapachone	decreases expression	1
cobaltous chloride	decreases expression	1
perfluorooctanoic acid	increases expression	1
zinc chromate	decreases expression, increases abundance	1
M-VAC protocol	decreases response to substance	1
chromium hexavalent ion	decreases expression, increases abundance	1
ICG 001	increases expression	1
abrine	decreases expression	1
jinfukang	affects cotreatment, increases expression	1
(+)-JQ1 compound	decreases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	increases expression	1
Fulvestrant	affects cotreatment, increases methylation	1
Air Pollutants	affects expression, increases abundance	1
Vehicle Emissions	increases abundance, increases expression	1
Benzo(a)pyrene	decreases methylation	1
Cisplatin	affects cotreatment, increases expression	1
Copper	affects binding, increases expression	1
Disulfiram	affects binding, increases expression	1
Ozone	affects expression, increases abundance	1
Smoke	decreases expression	1
Valproic Acid	increases methylation	1
Cyclosporine	decreases methylation	1
Particulate Matter	increases expression, increases abundance	1

Cellosaurus cell lines

1 cell lines: 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B3K0	Abcam HEK293T TRABD KO	Transformed cell line	Female

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.