TRARG1

Summary

TRARG1 (trafficking regulator of GLUT4 (SLC2A4) 1 (gene/pseudogene), HGNC:29592) is a protein-coding gene on chromosome 17p13.3, encoding Trafficking regulator of GLUT4 1 (Q8IXB3). Regulates insulin-mediated adipose tissue glucose uptake and transport by modulation of SLC2A4 recycling.

Predicted to be involved in endosome to plasma membrane protein transport and glucose import in response to insulin stimulus. Predicted to act upstream of or within establishment of localization in cell and vesicle fusion to plasma membrane. Predicted to be located in cytoplasmic vesicle membrane and plasma membrane. Predicted to be active in membrane.

Source: NCBI Gene 286753 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 45 total — 3 pathogenic, 1 likely-pathogenic
• MANE Select transcript: NM_172367

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:29592
Approved symbol	TRARG1
Name	trafficking regulator of GLUT4 (SLC2A4) 1 (gene/pseudogene)
Location	17p13.3
Locus type	gene with protein product
Status	Approved
Aliases	LOST1, IFITMD3, BEC-1, DSPB1
Ensembl gene	ENSG00000184811
Ensembl biotype	protein_coding
OMIM	612211
Entrez	286753

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000333813

RefSeq mRNA: 1 — MANE Select: NM_172367 NM_172367

CCDS: CCDS42225

Canonical transcript exons

ENST00000333813 — 3 exons

Exon	Start	End
ENSE00001296486	1295491	1295623
ENSE00001315281	1298251	1300978
ENSE00001319256	1279662	1280388

Expression profiles

Bgee: expression breadth ubiquitous, 103 present calls, max score 93.85.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 2.2431 / max 770.1740, expressed in 101 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
158718	1.0001	82
158716	0.5962	63
158717	0.3498	49
158715	0.2255	31
158719	0.0588	15
208021	0.0128	7

Top tissues by expression

128 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
subcutaneous adipose tissue	UBERON:0002190	93.85	gold quality
adipose tissue	UBERON:0001013	93.31	gold quality
omental fat pad	UBERON:0010414	92.49	gold quality
thoracic mammary gland	UBERON:0005200	84.68	gold quality
right coronary artery	UBERON:0001625	83.33	gold quality
popliteal artery	UBERON:0002250	82.89	gold quality
tibial artery	UBERON:0007610	82.85	gold quality
left coronary artery	UBERON:0001626	81.38	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	77.85	gold quality
descending thoracic aorta	UBERON:0002345	71.01	gold quality
hindlimb stylopod muscle	UBERON:0004252	70.47	gold quality
thoracic aorta	UBERON:0001515	66.75	gold quality
ascending aorta	UBERON:0001496	65.68	gold quality
tibial nerve	UBERON:0001323	65.42	gold quality
colonic epithelium	UBERON:0000397	63.79	gold quality
mucosa of stomach	UBERON:0001199	62.51	gold quality
gastrocnemius	UBERON:0001388	61.87	gold quality
muscle of leg	UBERON:0001383	61.42	gold quality
vermiform appendix	UBERON:0001154	59.84	gold quality
skeletal muscle tissue	UBERON:0001134	59.35	gold quality
apex of heart	UBERON:0002098	58.96	gold quality
heart	UBERON:0000948	58.72	gold quality
saliva-secreting gland	UBERON:0001044	58.23	gold quality
heart left ventricle	UBERON:0002084	57.51	gold quality
skin of leg	UBERON:0001511	57.40	gold quality
minor salivary gland	UBERON:0001830	57.06	gold quality
fundus of stomach	UBERON:0001160	55.48	gold quality
right atrium auricular region	UBERON:0006631	55.39	gold quality
muscle tissue	UBERON:0002385	54.86	gold quality
zone of skin	UBERON:0000014	54.20	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.32

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): PPARG

miRNA regulators (miRDB)

111 targeting TRARG1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-4455	100.00	65.48	1587
HSA-MIR-6748-5P	100.00	65.81	1057
HSA-MIR-574-5P	100.00	66.01	989
HSA-MIR-4673	100.00	66.64	1490
HSA-MIR-10401-5P	99.99	65.79	948
HSA-MIR-6759-5P	99.99	66.54	785
HSA-MIR-6793-5P	99.97	65.95	758
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-185-3P	99.95	67.01	1743
HSA-MIR-4648	99.91	67.00	710
HSA-MIR-4731-5P	99.89	67.23	2537
HSA-MIR-1343-3P	99.89	66.78	1815
HSA-MIR-6783-3P	99.89	67.92	2059
HSA-MIR-3140-3P	99.88	68.47	2069
HSA-MIR-605-3P	99.88	69.22	1833
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-3151-5P	99.86	63.83	1069
HSA-MIR-221-5P	99.86	65.45	1052
HSA-MIR-8073	99.86	65.21	1118
HSA-MIR-7978	99.86	66.90	856
HSA-MIR-6764-5P	99.75	67.89	2304
HSA-MIR-92A-2-5P	99.75	67.01	2164
HSA-MIR-1976	99.74	65.48	1127
HSA-MIR-4755-5P	99.71	70.34	2716
HSA-MIR-5006-3P	99.71	70.26	2728
HSA-MIR-548AU-3P	99.70	68.22	1373
HSA-MIR-6848-3P	99.64	66.49	885
HSA-MIR-1827	99.63	68.57	3265
HSA-MIR-1915-3P	99.58	66.79	1988

Literature-anchored findings (GeneRIF, showing 3)

• These findings may point to participation of Tusc5 in shared adipose-nervous system functions. (PMID:17689857)
• Aberrant DNA hypermethylation of TUSC5 in breast cancer suggests epigenetic mechanism of cancer associated down-regulation (PMID:23302999)
• Trafficking regulator of GLUT4-1 (TRARG1) is a GSK3 substrate. (PMID:35594055)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	trarg1a	ENSDARG00000090481
danio_rerio	trarg1b	ENSDARG00000094675
mus_musculus	Trarg1	ENSMUSG00000046275
rattus_norvegicus	Trarg1	ENSRNOG00000022239

Paralogs (4): PRRT2 (ENSG00000167371), PRRT1 (ENSG00000204314), TMEM233 (ENSG00000224982), PRRT1B (ENSG00000283526)

Protein

Protein identifiers

Trafficking regulator of GLUT4 1 — Q8IXB3 (reviewed: Q8IXB3)

Alternative names: Dispanin subfamily B member 1, Interferon-induced transmembrane domain-containing protein D3, Protein located at seventeen-p-thirteen point three 1, Tumor suppressor candidate 5

All UniProt accessions (1): Q8IXB3

UniProt curated annotations — full annotation on UniProt →

Function. Regulates insulin-mediated adipose tissue glucose uptake and transport by modulation of SLC2A4 recycling. Not required for SLC2A4 membrane fusion upon an initial stimulus, but rather is necessary for proper protein recycling during prolonged insulin stimulation.

Subunit / interactions. Interacts with SLC2A4; the interaction is required for proper SLC2A4 reacycling after insulin stimulation.

Subcellular location. Cell membrane. Endomembrane system. Cytoplasm. Perinuclear region.

Tissue specificity. Expressed at high levels in heart, mammary gland, adrenal gland, stomach, smooth muscle and skeletal muscle, and at lower levels in brain and lung. Strongly down-regulated in lung cancer tissues, due to hypermethylation of the corresponding locus. Expressed in adipose tissue.

Similarity. Belongs to the CD225/Dispanin family.

RefSeq proteins (1): NP_758955* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR007593	CD225/Dispanin_fam	Family
IPR051423	CD225/Dispanin	Family

Pfam: PF04505

UniProt features (17 total): sequence variant 6, topological domain 3, modified residue 3, chain 1, intramembrane region 1, transmembrane region 1, region of interest 1, compositionally biased region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8IXB3-F1	54.68	0.00

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (3): 88, 48, 87

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 92 (showing top): GOBP_RESPONSE_TO_NITROGEN_COMPOUND, GOBP_CARBOHYDRATE_TRANSPORT, GOBP_INTRACELLULAR_PROTEIN_TRANSPORT, GOBP_VESICLE_ORGANIZATION, GOBP_MEMBRANE_FUSION, GOBP_VESICLE_MEDIATED_TRANSPORT, GOBP_CELLULAR_RESPONSE_TO_OXYGEN_CONTAINING_COMPOUND, GOBP_PROTEIN_LOCALIZATION_TO_CELL_PERIPHERY, GOBP_CELLULAR_RESPONSE_TO_INSULIN_STIMULUS, GOBP_EXOCYTOSIS, GOBP_VESICLE_FUSION_TO_PLASMA_MEMBRANE, GOBP_CELLULAR_RESPONSE_TO_HORMONE_STIMULUS, GOBP_RESPONSE_TO_INSULIN, GOBP_ORGANELLE_MEMBRANE_FUSION, GOBP_D_GLUCOSE_IMPORT

GO Biological Process (6): cellular response to insulin stimulus (GO:0032869), glucose import in response to insulin stimulus (GO:0044381), protein localization to plasma membrane (GO:0072659), vesicle fusion to plasma membrane (GO:0099500), endosome to plasma membrane protein transport (GO:0099638), establishment of localization in cell (GO:0051649)

GO Molecular Function (0):

GO Cellular Component (6): plasma membrane (GO:0005886), endomembrane system (GO:0012505), membrane (GO:0016020), cytoplasmic vesicle membrane (GO:0030659), perinuclear region of cytoplasm (GO:0048471), cytoplasm (GO:0005737)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	4
response to insulin	1
cellular response to peptide hormone stimulus	1
cellular response to insulin stimulus	1
D-glucose import across plasma membrane	1
protein localization to membrane	1
protein localization to cell periphery	1
vesicle fusion	1
exocytic process	1
intracellular protein transport	1
endocytic recycling	1
establishment of protein localization to plasma membrane	1
protein localization to plasma membrane	1
establishment of localization	1
cellular localization	1
membrane	1
cell periphery	1
vacuole	1
plasma membrane	1
vesicle membrane	1
cytoplasmic vesicle	1
cytoplasm	1
intracellular anatomical structure	1

Protein interactions and networks

STRING

656 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TRARG1	BHLHA9	Q7RTU4	921
TRARG1	PITPNA	Q00169	811
TRARG1	YWHAE	P29360	799
TRARG1	TIMM22	Q9Y584	770
TRARG1	PAFAH1B1	P43034	770
TRARG1	SCARF1	Q14162	714
TRARG1	CRK	P46108	714
TRARG1	SYNDIG1	Q9H7V2	554
TRARG1	LRRC42	Q9Y546	526
TRARG1	TMEM91	Q6ZNR0	509
TRARG1	ARMC7	Q9H6L4	469
TRARG1	PPP1R14D	Q9NXH3	458
TRARG1	SYNDIG1L	A6NDD5	456
TRARG1	PLIN4	Q96Q06	455
TRARG1	SNAP47	Q5SQN1	451

IntAct

3 interactions, top by confidence:

A	B	Type	Score
TRARG1	SGPL1	psi-mi:“MI:0914”(association)	0.530
TRARG1	TNPO2	psi-mi:“MI:0914”(association)	0.350

BioGRID (126): SGPL1 (Affinity Capture-MS), ATP12A (Affinity Capture-MS), BZW1 (Affinity Capture-MS), TNPO2 (Affinity Capture-MS), TNPO1 (Affinity Capture-MS), RMND1 (Affinity Capture-MS), EXOC8 (Affinity Capture-MS), BRI3BP (Affinity Capture-MS), SGPL1 (Affinity Capture-MS), TNPO2 (Affinity Capture-MS), ATP12A (Affinity Capture-MS), RMND1 (Affinity Capture-MS), TNPO1 (Affinity Capture-MS), BZW1 (Affinity Capture-MS), TUSC5 (Two-hybrid)

ESM2 similar proteins: A0A087WTH1, A2RRL7, A5D7M7, A6NNB3, C9JQL5, K7EJ46, O70491, O88728, P0C5X8, P13164, P26376, P70606, Q01628, Q01629, Q0V8E7, Q1HG43, Q1HG44, Q1KZG0, Q2KJ98, Q2MHH0, Q2TA35, Q49LS7, Q4QR83, Q4VV71, Q5M8E3, Q5R7B4, Q5RCC0, Q5T197, Q5T1A1, Q640M6, Q6PEY1, Q6ZNR0, Q7TNJ2, Q7YQI4, Q8BH02, Q8C581, Q8IUH8, Q8IXB3, Q8IZY2, Q8WTR4

Diamond homologs: B4DJY2, D3Z1U7, D3ZFB6, E9PUL5, Q2MHH0, Q5RAC1, Q6DFT4, Q7Z6L0, Q8C838, Q8IXB3, Q91499, Q6ZNR0, Q8C581

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

45 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	3
Likely pathogenic	1
Uncertain significance	36
Likely benign	4
Benign	0

Top pathogenic / likely-pathogenic (4)

Variant ID	HGVS	Classification
154373	GRCh38/hg38 17p13.3-13.2(chr17:198748-4265640)x1	Pathogenic
1695391	Single allele	Pathogenic
625580	GRCh37/hg19 17p13.3(chr17:1084016-1278527)	Pathogenic
808339	GRCh37/hg19 17p13.3(chr17:882559-1401416)x1	Likely pathogenic

SpliceAI

760 predictions. Top by Δscore:

Variant	Effect	Δscore
17:1280385:CATG:C	donor_gain	1.0000
17:1280385:CATGG:C	donor_loss	1.0000
17:1280386:ATGG:A	donor_loss	1.0000
17:1280387:TG:T	donor_gain	1.0000
17:1280388:GG:G	donor_gain	1.0000
17:1280389:G:GA	donor_loss	1.0000
17:1280389:G:GG	donor_gain	1.0000
17:1295620:ACAGG:A	donor_loss	1.0000
17:1295622:AG:A	donor_loss	1.0000
17:1295624:GTGA:G	donor_loss	1.0000
17:1280384:TCATG:T	donor_gain	0.9900
17:1280386:ATG:A	donor_gain	0.9900
17:1280390:T:G	donor_loss	0.9900
17:1284363:GCT:G	donor_gain	0.9900
17:1295489:A:AG	acceptor_gain	0.9900
17:1295489:AGTC:A	acceptor_loss	0.9900
17:1295490:G:A	acceptor_loss	0.9900
17:1295490:G:GT	acceptor_gain	0.9900
17:1295490:GT:G	acceptor_gain	0.9900
17:1295490:GTCT:G	acceptor_gain	0.9900
17:1295490:GTCTC:G	acceptor_gain	0.9900
17:1295624:G:GG	donor_gain	0.9900
17:1298249:A:AG	acceptor_gain	0.9900
17:1298250:G:GA	acceptor_gain	0.9900
17:1298250:GTTCA:G	acceptor_gain	0.9900
17:1284413:GA:G	donor_gain	0.9800
17:1284428:GG:G	donor_gain	0.9800
17:1284429:GG:G	donor_gain	0.9800
17:1295490:GTC:G	acceptor_gain	0.9800
17:1298247:ACAGT:A	acceptor_loss	0.9800

AlphaMissense

1142 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
17:1295560:A:C	S153R	0.993
17:1295562:C:A	S153R	0.993
17:1295562:C:G	S153R	0.993
17:1280341:T:C	C114R	0.991
17:1280335:T:C	C112R	0.989
17:1295581:G:C	G160R	0.988
17:1280369:C:G	P123R	0.983
17:1280350:T:A	W117R	0.982
17:1280350:T:C	W117R	0.982
17:1280361:C:A	N120K	0.980
17:1280361:C:G	N120K	0.980
17:1280369:C:A	P123H	0.974
17:1280354:C:G	P118R	0.967
17:1280372:T:A	L124H	0.967
17:1295540:G:A	G146D	0.965
17:1295492:C:T	S130F	0.964
17:1295495:G:C	R131P	0.962
17:1295549:C:A	A149D	0.962
17:1280354:C:A	P118H	0.959
17:1295491:T:C	S130P	0.958
17:1280337:C:G	C112W	0.956
17:1295540:G:T	G146V	0.955
17:1280324:C:A	A108D	0.953
17:1280336:G:A	C112Y	0.950
17:1295582:G:A	G160D	0.950
17:1280309:A:T	D103V	0.949
17:1280363:T:C	L121P	0.949
17:1295539:G:C	G146R	0.949
17:1280363:T:A	L121H	0.948
17:1280363:T:G	L121R	0.945

dbSNP variants (sampled 300 via entrez): RS1000133556 (17:1282090 A>C,G,T), RS1000266700 (17:1278191 G>A), RS1000464562 (17:1282043 T>A,C), RS1000882086 (17:1301114 G>A), RS1000904748 (17:1278851 G>A), RS1000975042 (17:1297595 T>C), RS1000982700 (17:1278694 C>T), RS1001026571 (17:1281953 TACATGTACATATATGCACAC>T), RS1001081366 (17:1287894 C>T), RS1001329355 (17:1298475 C>A), RS1001490157 (17:1300047 G>A), RS1001735972 (17:1294003 GTCT>G), RS1001866395 (17:1279119 G>A), RS1001894184 (17:1301382 G>A), RS1001962022 (17:1300283 C>T)

Disease associations

OMIM: gene MIM:612211 | disease phenotypes: MIM:228250, MIM:612576

GenCC curated gene-disease

Mondo (2): Gollop-Wolfgang complex (MONDO:0009222), chromosome 17P13.3, telomeric, duplication syndrome (MONDO:0012944)

Orphanet (2): Gollop-Wolfgang complex (Orphanet:1986), Tibial aplasia-ectrodactyly syndrome (Orphanet:3329)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
C537917	Femur bifid with monodactylous ectrodactyly (supp.)
C567245	Split-Hand-Foot Malformation With Long Bone Deficiency 3 (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

15 total (human), top 15 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Dexamethasone	increases expression, affects cotreatment	2
aristolochic acid I	increases expression	1
GSK-J4	decreases expression	1
benzo(e)pyrene	increases methylation	1
Resveratrol	affects cotreatment, decreases expression	1
Copper	affects cotreatment, decreases expression	1
Dietary Carbohydrates	decreases expression	1
Indomethacin	affects cotreatment, increases expression	1
Methapyrilene	increases methylation	1
Nickel	decreases expression	1
Smoke	increases expression	1
Tretinoin	decreases expression	1
Valproic Acid	increases methylation	1
1-Methyl-3-isobutylxanthine	affects cotreatment, increases expression	1
1-Methyl-4-phenylpyridinium	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.