TRIM6

Summary

TRIM6 (tripartite motif containing 6, HGNC:16277) is a protein-coding gene on chromosome 11p15.4, encoding Tripartite motif-containing protein 6 (Q9C030). E3 ubiquitin ligase that plays a crucial role in the activation of the IKBKE-dependent branch of the type I interferon signaling pathway.

The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, B-box type 1 and B-box type 2 domain, and a coiled-coil region. The protein localizes to the nucleus, but its specific function has not been identified. This gene is mapped to chromosome 11p15, where it resides within a TRIM gene cluster. Alternative splicing results in multiple transcript variants. A read-through transcript from this gene into the downstream TRIM34 gene has also been observed, which results in a fusion product from these neighboring family members.

Source: NCBI Gene 117854 — RefSeq curated summary.

At a glance

• GWAS associations: 5
• MANE Select transcript: NM_001003818

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:16277
Approved symbol	TRIM6
Name	tripartite motif containing 6
Location	11p15.4
Locus type	gene with protein product
Status	Approved
Aliases	RNF89
Ensembl gene	ENSG00000121236
Ensembl biotype	protein_coding
OMIM	607564
Entrez	117854

Gene structure

Transcript identifiers

Ensembl transcripts: 13 — 10 protein_coding, 2 protein_coding_CDS_not_defined, 1 retained_intron

ENST00000278302, ENST00000380097, ENST00000380107, ENST00000424369, ENST00000445329, ENST00000469187, ENST00000481603, ENST00000506134, ENST00000507320, ENST00000511284, ENST00000515022, ENST00000621176, ENST00000909977

RefSeq mRNA: 4 — MANE Select: NM_001003818 NM_001003818, NM_001198644, NM_001198645, NM_058166

CCDS: CCDS31389, CCDS31390, CCDS55738

Canonical transcript exons

ENST00000380097 — 8 exons

Exon	Start	End
ENSE00001677130	5610777	5612952
ENSE00002216319	5596637	5596914
ENSE00003575566	5610535	5610561
ENSE00003580101	5608372	5608394
ENSE00003612077	5610145	5610245
ENSE00003616466	5605337	5605567
ENSE00003655690	5603246	5603735
ENSE00003678967	5604534	5604629

Expression profiles

Bgee: expression breadth ubiquitous, 192 present calls, max score 97.65.

FANTOM5 (CAGE): breadth broad, TPM avg 1.4551 / max 82.0303, expressed in 434 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
112814	1.1304	633
112812	1.0068	326
112817	0.2444	56
112813	0.1219	76
112816	0.0654	21
112818	0.0166	8

Top tissues by expression

245 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
oocyte	CL:0000023	97.65	gold quality
secondary oocyte	CL:0000655	97.13	gold quality
kidney epithelium	UBERON:0004819	90.85	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	87.78	gold quality
adult mammalian kidney	UBERON:0000082	84.04	gold quality
parotid gland	UBERON:0001831	82.38	gold quality
kidney	UBERON:0002113	82.09	gold quality
palpebral conjunctiva	UBERON:0001812	81.24	gold quality
germinal epithelium of ovary	UBERON:0001304	79.86	gold quality
tibia	UBERON:0000979	79.22	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	79.05	gold quality
esophagus squamous epithelium	UBERON:0006920	79.00	gold quality
parietal pleura	UBERON:0002400	77.91	gold quality
right adrenal gland cortex	UBERON:0035827	77.61	gold quality
smooth muscle tissue	UBERON:0001135	77.54	gold quality
stromal cell of endometrium	CL:0002255	77.50	gold quality
placenta	UBERON:0001987	77.49	gold quality
corpus epididymis	UBERON:0004359	77.18	gold quality
cortex of kidney	UBERON:0001225	76.89	gold quality
right adrenal gland	UBERON:0001233	76.67	gold quality
left adrenal gland	UBERON:0001234	76.35	gold quality
metanephros	UBERON:0000081	76.07	gold quality
esophagus mucosa	UBERON:0002469	76.04	gold quality
testis	UBERON:0000473	76.03	gold quality
metanephros cortex	UBERON:0010533	76.00	gold quality
right testis	UBERON:0004534	75.39	gold quality
left adrenal gland cortex	UBERON:0035825	75.23	gold quality
seminal vesicle	UBERON:0000998	75.21	gold quality
epithelial cell of pancreas	CL:0000083	75.12	silver quality
adrenal cortex	UBERON:0001235	75.07	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	6.58

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

2 targets.

Target	Regulation
IKBKE	Activation
MYC	Repression

miRNA regulators (miRDB)

95 targeting TRIM6, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-6758-5P	100.00	66.21	1470
HSA-MIR-6856-5P	100.00	65.47	1298
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-6748-5P	100.00	65.81	1057
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-196A-1-3P	99.99	72.15	2772
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-4482-3P	99.98	72.50	3147
HSA-MIR-32-5P	99.98	75.21	1964
HSA-MIR-92A-3P	99.98	75.21	1960
HSA-MIR-92B-3P	99.98	75.25	1955
HSA-LET-7F-2-3P	99.98	70.98	2588
HSA-MIR-1185-1-3P	99.98	71.04	2593
HSA-MIR-1185-2-3P	99.98	71.04	2593
HSA-MIR-4789-5P	99.98	70.76	2721
HSA-MIR-25-3P	99.98	74.60	1817
HSA-MIR-363-3P	99.98	74.72	1821
HSA-MIR-367-3P	99.98	74.83	1819
HSA-MIR-3065-5P	99.97	71.56	3281
HSA-MIR-302C-5P	99.97	72.56	3642
HSA-MIR-302E	99.96	70.74	2669
HSA-MIR-548AA	99.96	70.64	3753

Literature-anchored findings (GeneRIF, showing 13)

• heterologous RING, B-box 2, and CC domains from related TRIM proteins can functionally substitute for TRIM5alpha(rh) domains. (PMID:16775307)
• TRIM6 and the E2-ubiquitin conjugase UbE2K cooperated in the synthesis of unanchored K48-linked polyubiquitin chains, which activated IKKepsilon for subsequent STAT1 phosphorylation. (PMID:24882218)
• Live NiV infection, but not a recombinant NiV lacking the M protein, reduced the levels of endogenous TRIM6 protein expression. To our knowledge, matrix proteins of paramyxoviruses have never been reported to be involved in innate immune antagonism. We report here a novel mechanism of viral innate immune evasion by targeting TRIM6, IKKepsilon and unanchored polyubiquitin chains. (PMID:27622505)
• Intriguingly, the authors also found that TRIM6 enhances ebola virus polymerase activity in a minigenome assay and TRIM6 knockout cells have reduced replication of infectious ebola virus, suggesting that VP35 hijacks TRIM6 to promote ebola virus replication through ubiquitination. (PMID:28679761)
• these results provide evidence that TRIM6 contributes to the antiviral response against WNV and identify VAMP8 as a novel regulator of the IFN-I system. (PMID:31694946)
• TRIM6 promotes colorectal cancer cells proliferation and response to thiostrepton by TIS21/FoxM1. (PMID:31992359)
• Tripartite motif-containing protein 6 facilitates growth and migration of breast cancer through degradation of STUB1. (PMID:33728863)
• TRIM6 Reduces Ferroptosis and Chemosensitivity by Targeting SLC1A5 in Lung Cancer. (PMID:36654781)
• TRIM6 silencing for inhibiting growth and angiogenesis of gliomas by regulating VEGFA. (PMID:37236551)
• TRIM6: An Upregulated Biomarker with Prognostic Significance and Immune Correlations in Gliomas. (PMID:37759698)
• TRIM6 Promotes ROS-Mediated Inflammasome Activation and Pyroptosis in Renal Tubular Epithelial Cells via Ubiquitination and Degradation of GPX3 Protein. (PMID:38420829)
• TRIM6 facilitates SARS-CoV-2 proliferation by catalyzing the K29-typed ubiquitination of NP to enhance the ability to bind viral genomes. (PMID:38515377)
• Tripartite motif protein 6 promotes hepatocellular carcinoma progression via multiple pathways. (PMID:38813007)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Trim6	ENSMUSG00000072244
rattus_norvegicus	Trim6	ENSRNOG00000017147

Paralogs (80): MID2 (ENSG00000080561), TRIM9 (ENSG00000100505), MID1 (ENSG00000101871), MEFV (ENSG00000103313), TRIM35 (ENSG00000104228), TRIM14 (ENSG00000106785), TRIM37 (ENSG00000108395), TRIM2 (ENSG00000109654), TRIM3 (ENSG00000110171), TRIM38 (ENSG00000112343), TRIM62 (ENSG00000116525), TRIM67 (ENSG00000119283), TRIM32 (ENSG00000119401), BSPRY (ENSG00000119411), TRIM25 (ENSG00000121060), TRIM24 (ENSG00000122779), TRIM51 (ENSG00000124900), TRIM28 (ENSG00000130726), TRIM21 (ENSG00000132109), TRIM5 (ENSG00000132256), TRIM22 (ENSG00000132274), TRIM47 (ENSG00000132481), TRIM45 (ENSG00000134253), TRIM29 (ENSG00000137699), TRIM54 (ENSG00000138100), PML (ENSG00000140464), TRIM65 (ENSG00000141569), TRIM43B (ENSG00000144010), TRIM43 (ENSG00000144015), TRIM7 (ENSG00000146054), TRIM41 (ENSG00000146063), TRIM50 (ENSG00000146755), TRIM4 (ENSG00000146833), TRIM55 (ENSG00000147573), TRIM48 (ENSG00000150244), TRIM36 (ENSG00000152503), TRIM11 (ENSG00000154370), TRIM74 (ENSG00000155428), TRIM42 (ENSG00000155890), TRIM63 (ENSG00000158022)

Protein

Protein identifiers

Tripartite motif-containing protein 6 — Q9C030 (reviewed: Q9C030)

Alternative names: RING finger protein 89, RING-type E3 ubiquitin transferase TRIM6

All UniProt accessions (3): C9JNQ0, E9PFM0, Q9C030

UniProt curated annotations — full annotation on UniProt →

Function. E3 ubiquitin ligase that plays a crucial role in the activation of the IKBKE-dependent branch of the type I interferon signaling pathway. In concert with the ubiquitin-conjugating E2 enzyme UBE2K, synthesizes unanchored ‘Lys-48’-linked polyubiquitin chains that promote the oligomerization and autophosphorylation of IKBKE leading to stimulation of an antiviral response. Also ubiquitinates MYC and inhibits its transcription activation activity, maintaining the pluripotency of embryonic stem cells. Promotes the association of unanchored ‘Lys-48’-polyubiquitin chains with DHX16 leading to enhanced RIGI-mediated innate antiviral immune response. (Microbial infection) Ubiquitinates ebolavirus protein VP35 leading to enhanced viral transcriptase activity.

Subunit / interactions. Homotrimer. Forms heteromultimers (via B30.2/SPRY domain) with TRIM5. Interacts with MYC. Interacts (via SPRY domain) with IKBKE. Interacts with VAMP8; this interaction contributes to the activation of the type I interferon antiviral response. Interacts with DHX16. (Microbial infection) Interacts with HIV-1 capsid complexes. (Microbial infection) Interacts with matrix protein of Nipah virus; this interaction inhibits the IKBKE-dependent activation of the type I interferon signaling pathway.

Subcellular location. Cytoplasm.

Domain organisation. The B-box zinc finger and the linker region between the coiled coil and B30.2/SPRY domains contribute to higher order self-association.

Pathway. Protein modification; protein ubiquitination.

Similarity. Belongs to the TRIM/RBCC family.

Isoforms (3)

UniProt ID	Names	Canonical?
Q9C030-1	1	yes
Q9C030-2	2
Q9C030-3	3

RefSeq proteins (4): NP_001003818, NP_001185573, NP_001185574, NP_477514 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000315	Znf_B-box	Domain
IPR001841	Znf_RING	Domain
IPR001870	B30.2/SPRY	Domain
IPR003877	SPRY_dom	Domain
IPR003879	Butyrophylin_SPRY	Domain
IPR006574	PRY	Domain
IPR013083	Znf_RING/FYVE/PHD	Homologous_superfamily
IPR013320	ConA-like_dom_sf	Homologous_superfamily
IPR017907	Znf_RING_CS	Conserved_site
IPR027370	Znf-RING_euk	Domain
IPR035828	PRY/SPRY_TRIM6	Domain
IPR043136	B30.2/SPRY_sf	Homologous_superfamily
IPR050143	TRIM/RBCC	Family

Pfam: PF00622, PF00643, PF13445

UniProt features (16 total): binding site 4, splice variant 2, mutagenesis site 2, sequence conflict 2, zinc finger region 2, chain 1, domain 1, sequence variant 1, coiled-coil region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9C030-F1	86.68	0.63

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (4): 97; 100; 119; 125

Mutagenesis-validated functional residues (2):

Position	Phenotype
15	abolishes binding of polyubiquitin to ikbke.
121	reduced higher order self-association and association with trim5.

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-877300	Interferon gamma signaling

MSigDB gene sets: 187 (showing top): GSE18804_SPLEEN_MACROPHAGE_VS_BRAIN_TUMORAL_MACROPHAGE_UP, GSE45365_NK_CELL_VS_BCELL_DN, GOBP_CELLULAR_RESPONSE_TO_VIRUS, GOBP_REGULATION_OF_PHOSPHORYLATION, REACTOME_CYTOKINE_SIGNALING_IN_IMMUNE_SYSTEM, GOBP_REGULATION_OF_DEFENSE_RESPONSE_TO_VIRUS, GOBP_RESPONSE_TO_PEPTIDE, GOBP_POSITIVE_REGULATION_OF_CYTOKINE_PRODUCTION_INVOLVED_IN_IMMUNE_RESPONSE, GOBP_NEGATIVE_REGULATION_OF_STEM_CELL_DIFFERENTIATION, GOBP_PEPTIDYL_SERINE_MODIFICATION, GOBP_NEGATIVE_REGULATION_OF_VIRAL_PROCESS, GOBP_RESPONSE_TO_TYPE_I_INTERFERON, GOBP_POSITIVE_REGULATION_OF_CYTOKINE_PRODUCTION, GOBP_RESPONSE_TO_INTERFERON_BETA, GOBP_POSITIVE_REGULATION_OF_BINDING

GO Biological Process (23): positive regulation of defense response to virus by host (GO:0002230), positive regulation of cytokine production involved in immune response (GO:0002720), regulation of gene expression (GO:0010468), negative regulation of gene expression (GO:0010629), positive regulation of peptidyl-threonine phosphorylation (GO:0010800), free ubiquitin chain polymerization (GO:0010994), response to lipopolysaccharide (GO:0032496), positive regulation of peptidyl-serine phosphorylation (GO:0033138), cellular response to interferon-beta (GO:0035458), negative regulation of viral genome replication (GO:0045071), innate immune response (GO:0045087), negative regulation of DNA-templated transcription (GO:0045892), positive regulation of type I interferon-mediated signaling pathway (GO:0060340), protein K48-linked ubiquitination (GO:0070936), cellular response to virus (GO:0098586), antiviral innate immune response (GO:0140374), positive regulation of transcription regulatory region DNA binding (GO:2000679), negative regulation of stem cell differentiation (GO:2000737), protein polyubiquitination (GO:0000209), positive regulation of gene expression (GO:0010628), protein ubiquitination (GO:0016567), type I interferon-mediated signaling pathway (GO:0060337), regulation of primary metabolic process (GO:0080090)

GO Molecular Function (10): zinc ion binding (GO:0008270), protein kinase binding (GO:0019901), protein-macromolecule adaptor activity (GO:0030674), identical protein binding (GO:0042802), ubiquitin protein ligase activity (GO:0061630), DNA-binding transcription factor binding (GO:0140297), protein tyrosine kinase binding (GO:1990782), protein binding (GO:0005515), transferase activity (GO:0016740), metal ion binding (GO:0046872)

GO Cellular Component (3): nucleus (GO:0005634), cytoplasm (GO:0005737), cytosol (GO:0005829)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Interferon Signaling	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
gene expression	3
regulation of gene expression	2
positive regulation of protein phosphorylation	2
protein binding	2
cellular anatomical structure	2
regulation of defense response to virus by host	1
positive regulation of cytokine production	1
cytokine production involved in immune response	1
positive regulation of production of molecular mediator of immune response	1
regulation of cytokine production involved in immune response	1
regulation of macromolecule biosynthetic process	1
negative regulation of macromolecule biosynthetic process	1
regulation of peptidyl-threonine phosphorylation	1
peptidyl-threonine phosphorylation	1
ubiquitin recycling	1
protein polymerization	1
response to molecule of bacterial origin	1
response to lipid	1
response to oxygen-containing compound	1
peptidyl-serine phosphorylation	1
regulation of peptidyl-serine phosphorylation	1
response to interferon-beta	1
cellular response to cytokine stimulus	1
viral genome replication	1
regulation of viral genome replication	1
negative regulation of viral process	1
immune response	1
defense response to symbiont	1
DNA-templated transcription	1
regulation of DNA-templated transcription	1
negative regulation of RNA biosynthetic process	1
positive regulation of cytokine-mediated signaling pathway	1
positive regulation of innate immune response	1
type I interferon-mediated signaling pathway	1
regulation of type I interferon-mediated signaling pathway	1
protein polyubiquitination	1
response to virus	1
innate immune response	1
defense response to virus	1
transcription cis-regulatory region binding	1

Protein interactions and networks

STRING

639 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TRIM6	TRAT1	Q6PIZ9	912
TRIM6	BBOX1	O75936	800
TRIM6	IKBKE	Q14164	497
TRIM6	BTBD2	Q9BX70	492
TRIM6	BTBD1	Q9H0C5	492
TRIM6	TRIM56	Q9BRZ2	490
TRIM6	TRIM23	P36406	472
TRIM6	TRIM16	O95361	470
TRIM6	MYC	P01106	467
TRIM6	OR52B6	Q8NGF0	461
TRIM6	TRIM66	O15016	449
TRIM6	TRIM24	O15164	443
TRIM6	TRIM28	Q13263	417
TRIM6	PRY	O14603	415
TRIM6	MAVS	Q7Z434	404

IntAct

8 interactions, top by confidence:

A	B	Type	Score
IMPDH1	BCAT2	psi-mi:“MI:0914”(association)	0.530
ZNRD2	CCDC85C	psi-mi:“MI:0914”(association)	0.530
TRIM6		psi-mi:“MI:0915”(physical association)	0.370
TRIM34	TRIM6-TRIM34	psi-mi:“MI:0914”(association)	0.350
CAMK2D	PPM1D	psi-mi:“MI:0914”(association)	0.350

BioGRID (108): TRIM6 (Affinity Capture-MS), TRIM6 (Reconstituted Complex), TRIM6 (Reconstituted Complex), TRIM6 (Affinity Capture-RNA), ALB (Affinity Capture-MS), MYH6 (Affinity Capture-MS), MYH7 (Affinity Capture-MS), ACTA1 (Affinity Capture-MS), ACTG2 (Affinity Capture-MS), HSPA8 (Affinity Capture-MS), DEFB109P1B (Affinity Capture-MS), RAB1A (Affinity Capture-MS), LCN1 (Affinity Capture-MS), DEFB126 (Affinity Capture-MS), FLNA (Affinity Capture-MS)

ESM2 similar proteins: A0A3B3IT33, A6NCK2, A6NDI0, A6NGJ6, A6NI03, A6NLI5, C9J1S8, I1YAP6, K7N6K2, P0CI25, P0CI26, P15533, Q0PF16, Q1ACD5, Q1ACD6, Q1ACD7, Q1ACD8, Q2YEM8, Q2YEM9, Q2YEN0, Q2YEN2, Q3ZEE5, Q587N6, Q587N7, Q5BN31, Q5C8T6, Q5C8T8, Q5C8U1, Q5C8U3, Q5C8U4, Q5D7H7, Q5D7H8, Q5D7I0, Q5D7I1, Q5D7I2, Q5D7I3, Q5D7I5, Q5D7I6, Q5D7I9, Q5D7J0

Diamond homologs: A0JN74, A6NCK2, A6NDI0, A6NGJ6, A6NI03, A6NK02, A6NLI5, B1H278, C9J1S8, K7N6K2, O00635, O15553, O19085, O77666, P0CI25, P0CI26, P14373, P15533, P18892, P19474, Q02084, Q0PF16, Q12899, Q13410, Q1ACD5, Q1ACD6, Q1ACD7, Q1ACD8, Q1XHU0, Q2T9Z0, Q2YEM8, Q2YEM9, Q2YEN0, Q2YEN2, Q3UWZ0, Q3ZEE5, Q495X7, Q587N6, Q587N7, Q58DK8

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
Ub:E2	“up-regulates activity”	TRIM6	ubiquitination

Disease & clinical

Clinical variants and AI predictions

ClinVar

0 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1777 predictions. Top by Δscore:

Variant	Effect	Δscore
11:5604626:G:GT	donor_gain	1.0000
11:5605326:T:A	acceptor_gain	1.0000
11:5605326:T:TA	acceptor_gain	1.0000
11:5605332:T:TA	acceptor_gain	1.0000
11:5605335:A:AG	acceptor_gain	1.0000
11:5605336:G:GC	acceptor_gain	1.0000
11:5605563:TGCAG:T	donor_loss	1.0000
11:5605564:GCAGG:G	donor_loss	1.0000
11:5605565:CAGGT:C	donor_loss	1.0000
11:5605566:AGGTA:A	donor_loss	1.0000
11:5605568:GTA:G	donor_loss	1.0000
11:5605569:T:A	donor_loss	1.0000
11:5610143:A:AG	acceptor_gain	1.0000
11:5610144:G:GG	acceptor_gain	1.0000
11:5610144:GGA:G	acceptor_gain	1.0000
11:5610144:GGAGT:G	acceptor_gain	1.0000
11:5610775:A:AG	acceptor_gain	1.0000
11:5610776:G:GG	acceptor_gain	1.0000
11:5612551:A:AC	donor_gain	1.0000
11:5612552:A:C	donor_gain	1.0000
11:5596178:CCAG:C	donor_loss	0.9900
11:5596179:CAG:C	donor_loss	0.9900
11:5596182:G:T	donor_loss	0.9900
11:5596182:GTTA:G	donor_gain	0.9900
11:5596910:GAGAG:G	donor_gain	0.9900
11:5596911:AGAGG:A	donor_loss	0.9900
11:5596913:AGGTA:A	donor_loss	0.9900
11:5596915:GTAT:G	donor_loss	0.9900
11:5596916:T:G	donor_loss	0.9900
11:5604532:A:G	acceptor_gain	0.9900

AlphaMissense

3368 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
11:5611211:T:C	F446L	0.990
11:5611213:T:A	F446L	0.990
11:5611213:T:G	F446L	0.990
11:5610974:T:A	W367R	0.989
11:5610974:T:C	W367R	0.989
11:5610944:T:A	W357R	0.988
11:5610944:T:C	W357R	0.988
11:5611250:T:C	F459L	0.988
11:5611252:C:A	F459L	0.988
11:5611252:C:G	F459L	0.988
11:5610946:G:C	W357C	0.983
11:5610946:G:T	W357C	0.983
11:5611206:T:A	V444D	0.983
11:5611219:T:A	N448K	0.982
11:5611219:T:G	N448K	0.982
11:5611212:T:C	F446S	0.980
11:5610983:G:T	G370W	0.977
11:5611208:T:C	S445P	0.975
11:5611181:T:C	F436L	0.972
11:5611183:C:A	F436L	0.972
11:5611183:C:G	F436L	0.972
11:5603631:T:C	F107L	0.970
11:5603633:C:A	F107L	0.970
11:5603633:C:G	F107L	0.970
11:5610984:G:A	G370E	0.970
11:5605376:T:C	F187L	0.969
11:5605378:T:A	F187L	0.969
11:5605378:T:G	F187L	0.969
11:5611179:T:A	V435D	0.967
11:5610945:G:C	W357S	0.963

dbSNP variants (sampled 300 via entrez): RS1000045375 (11:5613101 C>T), RS1000137673 (11:5598084 T>A,C), RS1000190275 (11:5598418 A>C,G), RS1000373977 (11:5603422 C>T), RS1000474907 (11:5609142 C>G,T), RS1000662155 (11:5603664 C>A,T), RS1000756370 (11:5603175 G>A,C), RS1001070949 (11:5594769 C>T), RS1001546378 (11:5597385 T>A), RS1001706067 (11:5595735 T>A), RS1001750169 (11:5598747 T>A,C), RS1001803276 (11:5611098 A>G), RS1001937131 (11:5594546 A>G), RS1001982373 (11:5609506 G>A), RS1002257900 (11:5596384 AGTTAAACCTCTATTCTACAAGCTGAAGTATGTAGAGGAG>A)

Disease associations

OMIM: gene MIM:607564 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

5 associations (top):

Study	Trait	p-value
GCST003075_141	Cognitive decline rate in late mild cognitive impairment	8.000000e-10
GCST003075_48	Cognitive decline rate in late mild cognitive impairment	9.000000e-09
GCST010725_20	Malaria	4.000000e-69
GCST010725_33	Malaria	2.000000e-67
GCST010725_51	Malaria	1.000000e-55

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0007710	cognitive decline measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

48 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, affects cotreatment, increases expression	8
trichostatin A	affects cotreatment, increases expression	4
Aflatoxin B1	affects expression, increases expression, increases methylation	3
entinostat	increases expression, affects cotreatment	2
Panobinostat	affects cotreatment, increases expression	2
Air Pollutants	decreases expression, increases abundance	2
Arsenic	decreases expression, increases abundance, affects methylation, affects cotreatment	2
Nickel	decreases expression	2
Phenylmercuric Acetate	affects cotreatment, increases expression	2
Tobacco Smoke Pollution	affects expression, decreases methylation	2
Particulate Matter	decreases expression, increases abundance	2
aristolochic acid I	increases expression	1
bisphenol F	affects cotreatment, increases expression	1
methylmercuric chloride	decreases expression	1
pirinixic acid	affects binding, decreases expression, increases activity	1
bisphenol A	increases expression, affects cotreatment	1
3,4-dichloroaniline	decreases expression	1
sodium arsenite	increases abundance, affects cotreatment, decreases expression	1
manganese chloride	affects cotreatment, decreases expression, increases abundance	1
cupric oxide	decreases expression	1
perfluorooctane sulfonic acid	decreases expression	1
CGP 52608	affects binding, increases reaction	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
erucylphospho-N,N,N-trimethylpropylammonium	decreases expression	1
ICG 001	increases expression	1
abrine	decreases expression	1
dorsomorphin	affects cotreatment, increases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	increases expression	1
Temozolomide	decreases expression	1
Benzo(a)pyrene	decreases methylation	1

Cellosaurus cell lines

2 cell lines: 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_TU42	HAP1 TRIM6 (-) 1	Cancer cell line	Male
CVCL_TU43	HAP1 TRIM6 (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.