TUBB

Summary

TUBB (tubulin beta class I, HGNC:20778) is a protein-coding gene on chromosome 6p21.33, encoding Tubulin beta chain (P07437). Tubulin is the major constituent of microtubules, a cylinder consisting of laterally associated linear protofilaments composed of alpha- and beta-tubulin heterodimers.

This gene encodes a beta tubulin protein. This protein forms a dimer with alpha tubulin and acts as a structural component of microtubules. Mutations in this gene cause cortical dysplasia, complex, with other brain malformations 6. Alternative splicing results in multiple splice variants. There are multiple pseudogenes for this gene on chromosomes 1, 6, 7, 8, 9, and 13.

Source: NCBI Gene 203068 — RefSeq curated summary.

At a glance

• Gene–disease (curated): TUBB3-related tubulinopathy (Definitive, GenCC) — +3 more curated relationships
• Clinical variants (ClinVar): 139 total — 11 pathogenic, 26 likely-pathogenic
• Regional missense constraint (gnomAD): 1 of 2 regions constrained (≈97% of expected missense variation)
• GTEx eGene: eQTL in 8 tissues, sQTL in 1 (q < 0.05)
• Drug target: yes — 1 via a complex or family; 22 molecules with ChEMBL bioactivity (top 2% of genes corpus-wide)
• Constraint (gnomAD): pLI 1.00 (loss-of-function intolerant), LOEUF 0.18 (highly constrained)
• MANE Select transcript: NM_178014

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:20778
Approved symbol	TUBB
Name	tubulin beta class I
Location	6p21.33
Locus type	gene with protein product
Status	Approved
Aliases	OK/SW-cl.56, MGC16435, M40, Tubb5
Ensembl gene	ENSG00000196230
Ensembl biotype	protein_coding
OMIM	191130
Entrez	203068

Gene structure

Transcript identifiers

Ensembl transcripts: 30 — 28 protein_coding, 2 retained_intron

MANE Select: ENST00000327892

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1, TSL 2: 1, TSL 3: 1, TSL 5: 1

ENST00000327892, ENST00000330914, ENST00000396384, ENST00000396389, ENST00000680530, ENST00000681421, ENST00000681435, ENST00000940306, ENST00000940307, ENST00000940308, ENST00000940309, ENST00001056069, ENST00001076412, ENST00001076427, ENST00001076432, ENST00001105049, ENST00001105050, ENST00001105051, ENST00001105052, ENST00001105053, ENST00001105054, ENST00001105055, ENST00001105056, ENST00001105057, ENST00001105058, ENST00001105059, ENST00001105060, ENST00001105061, ENST00001105062, ENST00001136864

RefSeq mRNA: 6 — MANE Select: NM_178014 NM_001293212, NM_001293213, NM_001293214, NM_001293215, NM_001293216, NM_178014

CCDS: CCDS4687, CCDS78124

Canonical transcript exons

ENST00000327892 — 4 exons

Exon	Start	End
ENSE00001853302	30720352	30720563
ENSE00003650031	30722918	30723028
ENSE00003656975	30722537	30722645
ENSE00003841925	30723340	30725422

Expression profiles

Bgee: expression breadth ubiquitous, 133 present calls, max score 99.92.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 8.6714 / max 146.3959, expressed in 1709 samples.

Highest expression (Bgee): cortical plate, ganglionic eminence, ventricular zone, smooth muscle tissue, stromal cell of endometrium.

Genetic regulation across tissues (GTEx eQTL / sQTL)

TUBB is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 8 tissues and its splicing (sQTL) in 1 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

9 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Whole Blood	eqtl	1.1e-03	-0.25	6:29752091:G:A
Testis	sqtl	4.4e-03	-0.50	6:30717643:A:C
Brain Cerebellum	eqtl	7.3e-03	+0.88	6:31307018:CGAGGCGGGCGGATCATGAGGTCAGGAGATCGAGACCATCCTGGCTAACACAGTGAAACCCCGTCTCTACTAAAAATACAAAAAATTAGCCGGGCGTAGTGGCGGGCGCCTGTAGTCCCAGCTACTCGGGAGGCT:C
Skin Sun Exposed Lower leg	eqtl	1.9e-02	-0.08	6:31445171:T:C
Adipose Subcutaneous	eqtl	3.8e-02	-0.26	6:31354397:C:G
Esophagus Mucosa	eqtl	4.1e-02	+0.08	6:31395249:G:T
Liver	eqtl	4.2e-02	-0.48	6:31552881:T:A
Nerve Tibial	eqtl	4.7e-02	-0.10	6:31574531:T:C
Esophagus Muscularis	eqtl	4.9e-02	-0.10	6:31265793:C:T

FANTOM5 promoters

7 alternative TSS:

Promoter ID	TPM avg	Samples expressed
66762	1222.4213	1826
66767	3.0472	1174
66764	2.5573	1262
66772	1.5609	884
66766	0.7773	508
66763	0.5235	309
66768	0.2052	68

Top tissues by expression

showing 100 of 134 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
cortical plate	UBERON:0005343	99.92	gold quality
ganglionic eminence	UBERON:0004023	99.89	gold quality
ventricular zone	UBERON:0003053	99.84	gold quality
smooth muscle tissue	UBERON:0001135	99.56	gold quality
stromal cell of endometrium	CL:0002255	99.54	gold quality
vermiform appendix	UBERON:0001154	99.40	gold quality
ovary	UBERON:0000992	99.34	gold quality
islet of Langerhans	UBERON:0000006	99.33	gold quality
left ovary	UBERON:0002119	99.33	gold quality
placenta	UBERON:0001987	99.31	gold quality
right ovary	UBERON:0002118	99.31	gold quality
lymph node	UBERON:0000029	99.28	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	99.24	gold quality
body of uterus	UBERON:0009853	99.17	gold quality
myometrium	UBERON:0001296	99.13	gold quality
gall bladder	UBERON:0002110	99.06	gold quality
superior frontal gyrus	UBERON:0002661	99.05	gold quality
hypothalamus	UBERON:0001898	99.04	gold quality
left uterine tube	UBERON:0001303	99.03	gold quality
ectocervix	UBERON:0012249	99.01	gold quality
descending thoracic aorta	UBERON:0002345	99.00	gold quality
muscle layer of sigmoid colon	UBERON:0035805	98.98	gold quality
endocervix	UBERON:0000458	98.97	gold quality
right coronary artery	UBERON:0001625	98.97	gold quality
fallopian tube	UBERON:0003889	98.97	gold quality
lower esophagus	UBERON:0013473	98.97	gold quality
lower esophagus muscularis layer	UBERON:0035833	98.97	gold quality
rectum	UBERON:0001052	98.93	gold quality
left coronary artery	UBERON:0001626	98.90	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	98.90	gold quality
ascending aorta	UBERON:0001496	98.88	gold quality
thoracic aorta	UBERON:0001515	98.88	gold quality
uterine cervix	UBERON:0000002	98.86	gold quality
esophagus	UBERON:0001043	98.85	gold quality
metanephros cortex	UBERON:0010533	98.79	gold quality
endometrium	UBERON:0001295	98.78	gold quality
subcutaneous adipose tissue	UBERON:0002190	98.78	gold quality
lung	UBERON:0002048	98.76	gold quality
anterior cingulate cortex	UBERON:0009835	98.76	gold quality
vagina	UBERON:0000996	98.75	gold quality
Brodmann (1909) area 9	UBERON:0013540	98.75	gold quality
esophagus mucosa	UBERON:0002469	98.74	gold quality
upper lobe of left lung	UBERON:0008952	98.74	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	98.73	gold quality
right frontal lobe	UBERON:0002810	98.70	gold quality
adipose tissue	UBERON:0001013	98.69	gold quality
mucosa of stomach	UBERON:0001199	98.63	gold quality
bone marrow	UBERON:0002371	98.63	gold quality
tibial nerve	UBERON:0001323	98.62	gold quality
tibial artery	UBERON:0007610	98.62	gold quality
popliteal artery	UBERON:0002250	98.61	gold quality
colon	UBERON:0001155	98.60	gold quality
colonic epithelium	UBERON:0000397	98.59	gold quality
heart	UBERON:0000948	98.57	gold quality
heart left ventricle	UBERON:0002084	98.56	gold quality
thoracic mammary gland	UBERON:0005200	98.56	gold quality
omental fat pad	UBERON:0010414	98.56	gold quality
spleen	UBERON:0002106	98.53	gold quality
cerebellum	UBERON:0002037	98.52	gold quality
cerebellar cortex	UBERON:0002129	98.52	gold quality
right lobe of thyroid gland	UBERON:0001119	98.51	gold quality
cerebellar hemisphere	UBERON:0002245	98.51	gold quality
primary visual cortex	UBERON:0002436	98.49	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	98.48	gold quality
urinary bladder	UBERON:0001255	98.47	gold quality
pancreas	UBERON:0001264	98.47	gold quality
fundus of stomach	UBERON:0001160	98.46	gold quality
adrenal tissue	UBERON:0018303	98.46	gold quality
intestine	UBERON:0000160	98.44	gold quality
right hemisphere of cerebellum	UBERON:0014890	98.44	gold quality
right atrium auricular region	UBERON:0006631	98.42	gold quality
left adrenal gland	UBERON:0001234	98.41	gold quality
temporal lobe	UBERON:0001871	98.41	gold quality
mucosa of transverse colon	UBERON:0004991	98.41	gold quality
amygdala	UBERON:0001876	98.40	gold quality
transverse colon	UBERON:0001157	98.38	gold quality
apex of heart	UBERON:0002098	98.38	gold quality
body of stomach	UBERON:0001161	98.37	gold quality
stomach	UBERON:0000945	98.36	gold quality
adrenal gland	UBERON:0002369	98.35	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	98.35	gold quality
left adrenal gland cortex	UBERON:0035825	98.34	gold quality
saliva-secreting gland	UBERON:0001044	98.28	gold quality
left lobe of thyroid gland	UBERON:0001120	98.25	gold quality
cortex of kidney	UBERON:0001225	98.25	gold quality
skin of leg	UBERON:0001511	98.25	gold quality
minor salivary gland	UBERON:0001830	98.25	gold quality
substantia nigra	UBERON:0002038	98.25	gold quality
prostate gland	UBERON:0002367	98.25	gold quality
zone of skin	UBERON:0000014	98.24	gold quality
right adrenal gland	UBERON:0001233	98.24	gold quality
calcaneal tendon	UBERON:0003701	98.23	gold quality
skin of abdomen	UBERON:0001416	98.20	gold quality
thyroid gland	UBERON:0002046	98.18	gold quality
body of pancreas	UBERON:0001150	98.11	gold quality
multicellular organism	UBERON:0000468	98.09	gold quality
nucleus accumbens	UBERON:0001882	98.06	gold quality
granulocyte	CL:0000094	98.03	gold quality
duodenum	UBERON:0002114	98.02	gold quality
small intestine Peyer’s patch	UBERON:0003454	98.02	gold quality

Single-cell (SCXA)

Detected in 44 experiment(s), a significant marker in 33.

Experiment	Marker?	Max mean expression
E-MTAB-10287	yes	3159.88
E-MTAB-9543	yes	3068.81
E-CURD-79	yes	2140.44
E-GEOD-84465	yes	2032.86
E-MTAB-9435	yes	1763.78
E-CURD-126	yes	1752.42
E-GEOD-81547	yes	1675.99
E-MTAB-6379	yes	1046.69
E-MTAB-6701	yes	987.32
E-MTAB-10432	yes	979.18
E-GEOD-111727	yes	948.61
E-CURD-98	yes	937.05
E-MTAB-6653	yes	900.40
E-MTAB-10885	yes	713.49
E-MTAB-10283	yes	628.28

HPA expression

RNA tissue specificity: Tissue enriched

showing 60 of 159 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Frontal cortex	tissue	850.2
Locus coeruleus	tissue	726.6
Thymus	tissue	578.1
Pons	tissue	512.1
Bone marrow	tissue	510.4	medium
Postcentral gyrus	tissue	509.4
Prefrontal cortex	tissue	500.0
Cerebral cortex	tissue	500.0	medium
Motor cortex	tissue	487.8
Thalamus	tissue	473.0
Hippocampal formation	tissue	467.0
Retrosplenial and cingulate cortex	tissue	462.0
Tonsil	tissue	457.1	high
Somatosensory cortex	tissue	451.8
Retrosplenial cortex	tissue	451.1
Entorhinal cortex	tissue	448.0
Frontal cortex	tissue	440.2
Ovary	tissue	439.3	low
Temporal cortex	tissue	436.6
Caudate putamen	tissue	428.5
Midbrain	tissue	415.3
Insular cortex	tissue	410.8
Spinal cord	tissue	393.9
Hypothalamus	tissue	388.7
Substantia nigra	tissue	385.4
Medulla oblongata	tissue	382.2
Occipital cortex	tissue	380.9
Superior colliculi	tissue	348.5
Thalamus	tissue	348.0
Smooth muscle	tissue	346.4	not detected
Lymph node	tissue	344.6	high
Hippocampus	tissue	338.7	low
Amygdala	tissue	336.8
Pons	tissue	331.9
Caudate putamen	tissue	329.0
Olfactory bulb	tissue	325.5
Spinal cord	tissue	317.2
Septum	tissue	312.0
Midbrain	tissue	304.8
Ventral forebrain	tissue	296.3
Superior colliculi	tissue	290.7
Hypothalamus	tissue	289.2
Basal ganglia	tissue	288.4	not detected
Substantia nigra	tissue	272.2
Periaqueductal gray	tissue	271.2
Medulla oblongata	tissue	267.2
Hippocampal formation	tissue	260.8
Putamen	tissue	255.5
Cerebral cortex	tissue	245.6	medium
Temporal cortex	tissue	245.6
Prefrontal cortex	tissue	245.5
Somatosensory cortex	tissue	244.6
Endometrium 1	tissue	235.4	low
Motor cortex	tissue	235.4
Locus coeruleus	tissue	235.4
Septum	tissue	232.2
Appendix	tissue	230.0	medium
Entorhinal cortex	tissue	221.5
Retrosplenial and cingulate cortex	tissue	220.6
Liver	tissue	217.1	low

Brain sub-regions (HPA Brain Atlas): detected in 382; highest nTPM — Lateral hypothalamic area (788.0), Nucleus raphe magnus (619.4), Nuclei of the trapezoid body (611.0), Olfactory area (599.4), Stria terminalis, bed nucleus (562.0).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting TUBB by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 73 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6133	100.00	66.48	2064
HSA-MIR-4510	100.00	66.60	2050
HSA-MIR-6127	100.00	66.76	2188
HSA-MIR-6129	100.00	66.46	2080
HSA-MIR-6130	100.00	66.69	2012
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-200B-3P	100.00	73.31	2693
HSA-MIR-200C-3P	100.00	73.35	2685
HSA-MIR-429	100.00	73.44	2698
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-548AW	99.99	72.57	3559
HSA-MIR-3065-5P	99.97	71.56	3281
HSA-MIR-545-3P	99.95	70.74	2783
HSA-MIR-141-3P	99.94	72.79	2421
HSA-MIR-200A-3P	99.94	72.68	2420
HSA-MIR-1305	99.91	71.43	3443
HSA-MIR-5680	99.91	69.83	3421
HSA-MIR-7162-3P	99.89	68.16	1682
HSA-MIR-12119	99.87	68.35	1653
HSA-MIR-3121-3P	99.82	71.96	3630
HSA-MIR-4799-5P	99.82	70.60	2663
HSA-MIR-4694-3P	99.79	69.53	2640
HSA-MIR-548AJ-5P	99.78	71.12	3085
HSA-MIR-548F-5P	99.78	71.02	3093
HSA-MIR-548G-5P	99.78	71.12	3085
HSA-MIR-548X-5P	99.78	71.12	3085
HSA-MIR-4517	99.76	69.19	1867
HSA-MIR-92A-2-5P	99.75	67.01	2164
HSA-MIR-6892-3P	99.68	66.40	1178
HSA-MIR-1827	99.63	68.57	3265

Functional genomics

gnomAD constraint: pLI 1, LOEUF 0.178, missense Z 8.35 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD)

ENST00000327892 splits into 2 regions with different missense tolerance; 1 is missense-constrained (≈97% of the expected missense variation). Missense variants in a constrained region (low observed/expected) are more likely to be pathogenic. gnomAD

Region (GRCh38)	Missense obs / exp	o/e	Constrained
6:30,720,507–30,724,348	38 / 578.9	0.07	yes (p 6.4e-112)
6:30,724,349–30,724,394	12 / 20.5	0.59	no

Literature-anchored findings (GeneRIF, showing 32)

• Mutational analysis of the class I beta-tubulin gene in human breast cancer (PMID:12209587)
• the influence of beta-tubulin mutations in paclitaxel resistance in advanced non-small cell lung cancer (PMID:12826311)
• Review of studies comparing beta-tubulin mutations with antitubulin drug resistance. Throws doubts on earlier such correlation because of the existence of many pseudogenes for beta-tubulin. (PMID:15003198)
• TUBB exon 4 mutations and mismatch repair defects do not play a significant role in paclitaxel/cisplatin resistance (PMID:16095531)
• These data indicate that phosphorylation of tubulin by Cdk1 could be involved in the regulation of microtubule dynamics during mitosis. (PMID:16371510)
• cDNA subtraction revealed increased expression of alpha3-tubulin in the taxol-resistant cell line. (PMID:16380805)
• the dipole moments of each tubulin isotype may influence their functional characteristics within the cell, resulting in differences for MT assembly kinetics and stability (PMID:16941085)
• Nuclear matrix proteins such as mutant Pyst1 and nucleophosmin 1 were downregulated, whereas eIF6 and beta-tubulin were upregulated during cell differentiation in hepatocarcinoma cells. (PMID:17569113)
• Results suggest that glutamate198 in beta-tubulin is a critical determinant for microtubule stability and Taxol resistance. (PMID:17869412)
• Roles of tubulin beta 1,3 residues Ala428 and Thr429 in microtubule formation in vivo. (PMID:19074767)
• This protein has been found differentially expressed in the Wernicke’s Area from patients with schizophrenia. (PMID:19405953)
• human tumor cells can acquire spontaneous mutations in beta1-tubulin that cause resistance to paclitaxel (PMID:20103599)
• Data show that knockdown of S100P led to downregulation of thioredoxin 1 and beta-tubulin and upregulation of RhoGDIA, all potential therapeutic targets in cancer. (PMID:21327297)
• This is the first cell-based evidence to support a beta-tubulin-binding site for peloruside A and laulimalide. (PMID:21653684)
• TQ induced a concentration- and time-dependent degradation of alpha/beta tubulin in both cancer cell types. (PMID:21881916)
• A protein encoded by this locus was found to be differentially expressed in postmortem brains from patients with atypical frontotemporal lobar degeneration. (PMID:22360420)
• Allele frequencies between a group of 191 ITP patients & controls showed no direct aetiological role for SNP (R307H), but it was associated with immunomodulatory treatment failure. (PMID:23157319)
• results provide insight into the functional repertoire of the tubulin gene family, specifically implicating TUBB5 in embryonic neurogenesis and microcephaly (PMID:23246003)
• Centaurin-alpha interacts with beta-tubulin and stabilizes microtubules. (PMID:23285209)
• Studies suggest that tubulin-interactive agents have the potential to play a significant role in the fight against cancer. (PMID:23818224)
• Citrullination of TUBB is associated with neoplasms. (PMID:24099319)
• mechanism of binding and stabilization of microtubules in mammalian cells can be effectively modeled in yeast and also having the advantage of lacking any beta-tubulin isotypes that can complicate interpretation of experiments in mammalian cells. (PMID:24161989)
• Data indicate that leucine-rich repeat kinase 2 (LRRK2) selectively interacts with three beta-tubulin isoforms: TUBB, TUBB4, and TUBB6. (PMID:24275654)
• Data suggest that, while lacking a stable structure, NFL-TBS.40-63 peptide (a peptide derived from light neurofilament protein) preferentially binds on a specific single site located near C-terminal end of beta-tubulin. (PMID:26016807)
• Data suggest a looser binding of the ligand in tubulin mutants. (PMID:26081685)
• Data show that tubulin phosphorylation and acetylation play important roles in the control of microtubule assembly and stability. (PMID:26165356)
• Mutations in either TUBB or MAPRE2 cause circumferential skin creases Kunze type. (PMID:26637975)
• Leucine point mutations viz. L215H, L217R, and L225M were reported for paclitaxel resistance in various cancers. In the current study, molecular mechanism of these resistance causing mutations in TUBB1 was explored using molecular docking, molecular dynamics simulation, binding energy estimation, free energy decomposition, principle component analysis and free energy landscape methods. (PMID:27233604)
• TUBB Variants Underlying Different Phenotypes Result in Altered Vesicle Trafficking and Microtubule Dynamics. (PMID:32085672)
• Competitive Microtubule Binding of PEX14 Coordinates Peroxisomal Protein Import and Motility. (PMID:33484719)
• Identification of two novel de novo TUBB variants in cases with brain malformations: case reports and literature review. (PMID:34211110)
• Dynamics of TUBB protein with five majorly occurring natural variants: a risk of cortical dysplasia. (PMID:36928665)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	tubb5	ENSDARG00000037997
mus_musculus	Tubb5	ENSMUSG00000001525
rattus_norvegicus	Tubb5	ENSRNOG00000061216

Paralogs (23): TUBG2 (ENSG00000037042), TUBE1 (ENSG00000074935), TUBA3D (ENSG00000075886), TUBB1 (ENSG00000101162), TUBB4A (ENSG00000104833), TUBD1 (ENSG00000108423), TUBA1B (ENSG00000123416), TUBA4A (ENSG00000127824), TUBG1 (ENSG00000131462), TUBB2A (ENSG00000137267), TUBB2B (ENSG00000137285), TUBA3E (ENSG00000152086), TUBA1A (ENSG00000167552), TUBA1C (ENSG00000167553), TUBB8B (ENSG00000173213), TUBB6 (ENSG00000176014), TUBAL3 (ENSG00000178462), TUBA8 (ENSG00000183785), TUBB4B (ENSG00000188229), TUBA3C (ENSG00000198033), TUBA4B (ENSG00000243910), TUBB3 (ENSG00000258947), TUBB8 (ENSG00000261456)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:107812) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 16 distinct phenotype terms.

Mouse phenotype (MP)	Records
microcephaly	1
decreased brain size	1
decreased corpus callosum size	1
small cerebellum	1
small olfactory bulb	1
abnormal neuron morphology	1
increased neuron apoptosis	1
abnormal mitosis	1
abnormal putamen morphology	1
thin cerebral cortex	1
small hippocampus	1
abnormal mitotic spindle morphology	1
abnormal cerebellar layer morphology	1
postnatal lethality, complete penetrance	1
prenatal lethality, incomplete penetrance	1
small thalamus	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Chlamydomonas reinhardtii	P04690	100.0%	Diamond
Gallus gallus	P09244	100.0%	Diamond
Volvox carteri	P11482	100.0%	Diamond
Plasmodium falciparum K1	P14643	100.0%	Diamond
Strongylocentrotus purpuratus	P18700	100.0%	Diamond
Paramecium tetraurelia	P33188	100.0%	Diamond
Tetrahymena thermophila	P41352	100.0%	Diamond
Haliotis discus	P41386	100.0%	Diamond
Solanum tuberosum	P46263	100.0%	Diamond
Drosophila melanogaster	P61857	100.0%	Diamond
Drosophila hydei	P61858	100.0%	Diamond
Cricetulus griseus	P69893	100.0%	Diamond
Macaca mulatta	P69895	100.0%	Diamond
Bos taurus	Q2KJD0	100.0%	Diamond
Macaca fascicularis	Q4R4X8	100.0%	Diamond
Pongo abelii	Q5R943	100.0%	Diamond
Xenopus tropicalis	Q6GLE7	100.0%	Diamond
Sus scrofa	Q767L7	100.0%	Diamond
Pan troglodytes	Q7JJU6	100.0%	Diamond
Plasmodium falciparum 3D7	Q7KQL5	100.0%	Diamond
Xenopus laevis	Q91575	100.0%	Diamond
Chlamydomonas incerta	O04386	99.8%	Diamond
Tetrahymena pyriformis	P10876	99.8%	Diamond
Epichloe typhina	P17938	99.8%	Diamond
Aspergillus flavus	P22012	99.8%	Diamond
Epichloe coenophiala	P33127	99.8%	Diamond
Drosophila erecta	P83130	99.8%	Diamond
Aspergillus oryzae RIB40	Q2U2U3	99.8%	Diamond
Dothistroma septosporum	O42786	99.6%	Diamond
Fusarium fujikuroi	P53374	99.6%	Diamond
Aspergillus parasiticus	Q00264	99.6%	Diamond
Cercospora beticola	Q3KVN1	99.6%	Diamond
Fusarium graminearum PH-1	Q4HZS8	99.6%	Diamond
Caenorhabditis elegans	P12456	99.5%	Diamond
Caenorhabditis briggsae	Q17299	99.5%	Diamond
Manduca sexta	O17449	99.3%	Diamond
Paracentrotus lividus	P11833	99.3%	Diamond
Oryza sativa Japonica Group	P46265	99.3%	Diamond
Zea mays	Q41783	99.3%	Diamond
Eleusine indica	Q9ZPP0	99.3%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
MDC1-AS1	ncRNA	106478956
NRM	protein-coding	11270
PPP1R18	protein-coding	170954
C6orf136	protein-coding	221545
DHX16	protein-coding	8449
MDC1	protein-coding	9656
IER3-AS1	ncRNA	105379695
IER3	protein-coding	8870
FLOT1	protein-coding	10211
HCG20	ncRNA	105375013

Protein

Protein identifiers

Tubulin beta chain — P07437 (reviewed: P07437)

Alternative names: Tubulin beta-5 chain

All UniProt accessions (4): P07437, Q5JP53, Q5ST81, Q5SU16

UniProt curated annotations — full annotation on UniProt →

Function. Tubulin is the major constituent of microtubules, a cylinder consisting of laterally associated linear protofilaments composed of alpha- and beta-tubulin heterodimers. Microtubules grow by the addition of GTP-tubulin dimers to the microtubule end, where a stabilizing cap forms. Below the cap, tubulin dimers are in GDP-bound state, owing to GTPase activity of alpha-tubulin.

Subunit / interactions. Heterodimer of alpha and beta chains. A typical microtubule is a hollow water-filled tube with an outer diameter of 25 nm and an inner diameter of 15 nM. Alpha-beta heterodimers associate head-to-tail to form protofilaments running lengthwise along the microtubule wall with the beta-tubulin subunit facing the microtubule plus end conferring a structural polarity. Microtubules usually have 13 protofilaments but different protofilament numbers can be found in some organisms and specialized cells. Interacts with CIMAP3. Interacts with DIAPH1. Interacts with MX1. May interact with RNABP10. Interacts with CFAP157. Nascent tubulin polypeptide interacts (via beta-tubulin MREI motif) with TTC5/STRAP; this interaction results in tubulin mRNA-targeted degradation.

Subcellular location. Cytoplasm. Cytoskeleton.

Tissue specificity. Ubiquitously expressed with highest levels in spleen, thymus and immature brain.

Post-translational modifications. Some glutamate residues at the C-terminus are polyglutamylated, resulting in polyglutamate chains on the gamma-carboxyl group. Polyglutamylation plays a key role in microtubule severing by spastin (SPAST). SPAST preferentially recognizes and acts on microtubules decorated with short polyglutamate tails: severing activity by SPAST increases as the number of glutamates per tubulin rises from one to eight, but decreases beyond this glutamylation threshold. Glutamylation is also involved in cilia motility. Some glutamate residues at the C-terminus are monoglycylated but not polyglycylated due to the absence of functional TTLL10 in human. Monoglycylation is mainly limited to tubulin incorporated into cilia and flagella axonemes, which is required for their stability and maintenance. Flagella glycylation controls sperm motility. Both polyglutamylation and monoglycylation can coexist on the same protein on adjacent residues, and lowering glycylation levels increases polyglutamylation, and reciprocally. Phosphorylated on Ser-172 by CDK1 during the cell cycle, from metaphase to telophase, but not in interphase. This phosphorylation inhibits tubulin incorporation into microtubules.

Disease relevance. Cortical dysplasia, complex, with other brain malformations 6 (CDCBM6) [MIM:615771] A disorder of aberrant neuronal migration and disturbed axonal guidance. Affected individuals have microcephaly, ataxia, and severe delayed psychomotor development. Brain imaging shows variable malformations of cortical development, including white matter streaks, dysmorphic basal ganglia, corpus callosum abnormalities, brainstem and cerebellar hypoplasia, cortical dysplasia, polymicrogyria. The disease is caused by variants affecting the gene represented in this entry. Skin creases, congenital symmetric circumferential, 1 (CSCSC1) [MIM:156610] An autosomal dominant disease characterized by multiple, symmetric, circumferential rings of folded skin, affecting primarily the limbs. Affected individuals also exhibit intellectual disability, cleft palate, and dysmorphic features. The disease is caused by variants affecting the gene represented in this entry.

Domain organisation. The highly acidic C-terminal region may bind cations such as calcium. The MREI motif is common among all beta-tubulin isoforms and may be critical for tubulin autoregulation.

Induction. Autoregulated by feedback control of mRNA degradation. In excess of soluble tubulin, nascent beta-tubulin chain binds TTC5/STRAP cofactor through the MREI motif which triggers cotranslation degradation of tubulin mRNA.

Similarity. Belongs to the tubulin family.

RefSeq proteins (6): NP_001280141, NP_001280142, NP_001280143, NP_001280144, NP_001280145, NP_821133* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000217	Tubulin	Family
IPR002453	Beta_tubulin	Family
IPR003008	Tubulin_FtsZ_GTPase	Domain
IPR008280	Tub_FtsZ_C	Homologous_superfamily
IPR013838	Beta-tubulin_BS	Binding_site
IPR017975	Tubulin_CS	Conserved_site
IPR018316	Tubulin/FtsZ_2-layer-sand-dom	Domain
IPR023123	Tubulin_C	Homologous_superfamily
IPR036525	Tubulin/FtsZ_GTPase_sf	Homologous_superfamily
IPR037103	Tubulin/FtsZ-like_C	Homologous_superfamily

Pfam: PF00091, PF03953

UniProt features (90 total): helix 24, strand 18, modified residue 17, binding site 9, turn 6, sequence variant 5, sequence conflict 5, cross-link 2, chain 1, region of interest 1, short sequence motif 1, compositionally biased region 1

Structure

Experimental structures (PDB)

21 structures by resolution:

PDB	Title	Method	Resolution (Å)
3QNZ	Orthorhombic form of IgG1 Fab fragment (in complex with antigenic tubulin peptide) …	X-RAY DIFFRACTION	2.2
3QO0	Monoclinic form of IgG1 Fab fragment (in complex with antigenic peptide) sharing same Fv …	X-RAY DIFFRACTION	2.3
8BPO	Structure of rabbit 80S ribosome translating beta-tubulin in complex with …	ELECTRON MICROSCOPY	2.8
7TTT	The beta-tubulin folding intermediate III	ELECTRON MICROSCOPY	2.9
8V2J	Structure of alpha1B and betaI/IVb microtubule bound to GDP	ELECTRON MICROSCOPY	2.9
9COC	Two protofilament structure of alpha1B and betaI/IVb microtubule bound to GDP	ELECTRON MICROSCOPY	2.9
7TRG	The beta-tubulin folding intermediate I	ELECTRON MICROSCOPY	3
7X0S	Human TRiC-tubulin-S3	ELECTRON MICROSCOPY	3.1
9BP6	Structure of alpha1B and betaI/IVb microtubule bound to GMPCPP	ELECTRON MICROSCOPY	3.1
9CMM	Two protofilament structure of alpha1B and betaI/IVb microtubule bound to GMPCPP	ELECTRON MICROSCOPY	3.1
9HQ4	TTLL11 bound to microtubule	ELECTRON MICROSCOPY	3.28
7TTN	The beta-tubulin folding intermediate II	ELECTRON MICROSCOPY	3.3
6I2I	Refined 13pf Hela Cell Tubulin microtubule (EML4-NTD decorated)	ELECTRON MICROSCOPY	3.6
7TUB	The beta-tubulin folding intermediate IV	ELECTRON MICROSCOPY	3.6
8T42	Model of TTLL6 MTBH1-2 bound to microtubule	ELECTRON MICROSCOPY	3.6
8U3Z	Model of TTLL6 bound to microtubule from composite map	ELECTRON MICROSCOPY	3.6
6QUS	HsCKK (human CAMSAP1) decorated 13pf taxol-GDP microtubule	ELECTRON MICROSCOPY	3.7
6QVE	NgCKK (Naegleria Gruberi CKK) decorated 14pf taxol-GDP microtubule	ELECTRON MICROSCOPY	3.7
6QUY	NgCKK (N.Gruberi CKK) decorated 13pf taxol-GDP microtubule	ELECTRON MICROSCOPY	3.8
6QVJ	HsCKK (human CAMSAP1) decorated 14pf taxol-GDP microtubule	ELECTRON MICROSCOPY	3.8
5N5N	Cryo-EM structure of tsA201 cell alpha1B and betaI and betaIVb microtubules	ELECTRON MICROSCOPY	4.2

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P07437-F1	92.18	0.85

Antibody-complex structures (SAbDab)

2 antibodies co-crystallized with this protein: 3QNZ, 3QO0

Human Protein Atlas

Protein class: Predicted intracellular proteins, Disease related genes, Human disease related genes, Congenital malformations, Congenital malformations of the nervous system

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): microtubules; basal body; cytokinetic bridge; end piece; flagellar centriole; mitotic spindle; primary cilium; primary cilium tip; principal piece

Antibody reliability (HPA): IH supported · IF supported

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (9)

Position	Role
144	GTP
204	GTP
226	GTP
11	GTP
69	GTP
69	Mg(2+)
138	GTP
142	GTP
143	GTP

Post-translational modifications (19)

Type	Positions
Phosphoserine	40, 172
Phosphothreonine	55, 285, 290
N6-acetyllysine	58
N6-succinyllysine	58
Omega-n-methylarginine	318
5-glutamyl polyglutamate	434, 438, 439, 441
5-glutamyl glycine	438, 439, 441, 442, 443
Glycyl lysine isopeptide (lys-gly) (interchain with g-cter in ubiquitin)	58, 324

Function

Pathways and Gene Ontology

Reactome pathways

9 curated (TAS) of 24; 5 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

24 pathways:

ID	Pathway	Evidence
R-HSA-9679191	Potential therapeutics for SARS ⚕	curated
R-HSA-8854518	AURKA Activation by TPX2	curated
R-HSA-5620912	Anchoring of the basal body to the plasma membrane	curated
R-HSA-380259	Loss of Nlp from mitotic centrosomes	curated
R-HSA-380284	Loss of proteins required for interphase microtubule organization from the centrosome	curated
R-HSA-6798695	Neutrophil degranulation	curated
R-HSA-380320	Recruitment of NuMA to mitotic centrosomes	curated
R-HSA-380270	Recruitment of mitotic centrosome proteins and complexes	curated
R-HSA-2565942	Regulation of PLK1 Activity at G2/M Transition	curated
R-HSA-1643685	Disease ⚕	—
R-HSA-5663205	Infectious disease ⚕	—
R-HSA-9679506	SARS-CoV Infections ⚕	—
R-HSA-9824446	Viral Infection Pathways ⚕	—
R-HSA-1640170	Cell Cycle	—
R-HSA-69278	Cell Cycle, Mitotic	—
R-HSA-380287	Centrosome maturation	—
R-HSA-5617833	Cilium Assembly	—
R-HSA-69275	G2/M Transition	—
R-HSA-168256	Immune System	—
R-HSA-168249	Innate Immune System	—
R-HSA-68886	M Phase	—
R-HSA-453274	Mitotic G2-G2/M phases	—
R-HSA-68877	Mitotic Prometaphase	—
R-HSA-1852241	Organelle biogenesis and maintenance	—

MSigDB gene sets: 553 (showing top): GNF2_RTN1, GOBP_EPITHELIUM_DEVELOPMENT, HONMA_DOCETAXEL_RESISTANCE, BUYTAERT_PHOTODYNAMIC_THERAPY_STRESS_DN, REACTOME_INNATE_IMMUNE_SYSTEM, GOCC_SECRETORY_GRANULE, MATTIOLI_MGUS_VS_PCL, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_DN, GOBP_LEUKOCYTE_MEDIATED_CYTOTOXICITY, MITSIADES_RESPONSE_TO_APLIDIN_DN, GOBP_LEUKOCYTE_MEDIATED_IMMUNITY, HERNANDEZ_MITOTIC_ARREST_BY_DOCETAXEL_1_DN, PATIL_LIVER_CANCER, WEI_MYCN_TARGETS_WITH_E_BOX

GO Biological Process (9): microtubule cytoskeleton organization (GO:0000226), mitotic cell cycle (GO:0000278), microtubule-based process (GO:0007017), cytoskeleton-dependent intracellular transport (GO:0030705), natural killer cell mediated cytotoxicity (GO:0042267), regulation of synapse organization (GO:0050807), cell division (GO:0051301), odontoblast differentiation (GO:0071895), cytoskeleton organization (GO:0007010)

GO Molecular Function (12): GTPase activity (GO:0003924), structural molecule activity (GO:0005198), structural constituent of cytoskeleton (GO:0005200), GTP binding (GO:0005525), protein domain specific binding (GO:0019904), ubiquitin protein ligase binding (GO:0031625), GTPase activating protein binding (GO:0032794), MHC class I protein binding (GO:0042288), protein-containing complex binding (GO:0044877), metal ion binding (GO:0046872), nucleotide binding (GO:0000166), protein binding (GO:0005515)

GO Cellular Component (20): extracellular region (GO:0005576), nucleus (GO:0005634), nuclear envelope lumen (GO:0005641), cytoplasm (GO:0005737), cytosol (GO:0005829), cytoskeleton (GO:0005856), microtubule (GO:0005874), cilium (GO:0005929), microtubule cytoskeleton (GO:0015630), protein-containing complex (GO:0032991), azurophil granule lumen (GO:0035578), cytoplasmic ribonucleoprotein granule (GO:0036464), cell body (GO:0044297), membrane raft (GO:0045121), intercellular bridge (GO:0045171), extracellular exosome (GO:0070062), mitotic spindle (GO:0072686), sperm principal piece (GO:0097228), sperm end piece (GO:0097229), ciliary tip (GO:0097542)

Reactome top-level categories

12 top-level categories:

Category	Pathways
G2/M Transition	3
Centrosome maturation	2
Cell Cycle, Mitotic	2
Loss of proteins required for interphase microtubule organization from the centrosome	1
Mitotic Prometaphase	1
Assembly of the 9+0 primary cilium	1
Innate Immune System	1
SARS-CoV Infections	1
Immune System	1
Organelle biogenesis and maintenance	1
Disease	1
M Phase	1

GO top-level categories

49 GO namespaces:

Category	Terms
cellular anatomical structure	8
cytoskeleton organization	2
cellular process	2
cytoskeleton	2
protein binding	2
binding	2
cytoplasm	2
sperm flagellum	2
microtubule-based process	1
cell cycle	1
mitotic nuclear division	1
intracellular transport	1
leukocyte mediated cytotoxicity	1
natural killer cell mediated immunity	1
regulation of synapse structure or activity	1
synapse organization	1
regulation of cellular component organization	1
neuroepithelial cell differentiation	1
organelle organization	1
ribonucleoside triphosphate phosphatase activity	1
molecular_function	1
structural molecule activity	1
guanyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
anion binding	1
ubiquitin-like protein ligase binding	1
MHC protein binding	1
cation binding	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
intracellular membrane-bounded organelle	1
nuclear envelope	1
organelle envelope lumen	1
intracellular anatomical structure	1
intracellular membraneless organelle	1
microtubule cytoskeleton	1
polymeric cytoskeletal fiber	1
intraciliary transport particle	1
membrane-bounded organelle	1
plasma membrane bounded cell projection	1
cellular_component	1
vacuolar lumen	1
secretory granule lumen	1
azurophil granule	1
ribonucleoprotein granule	1
membrane microdomain	1
extracellular vesicle	1
spindle	1
cilium	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 17 of 41 annotations. The rest are phylogenetic / computational / electronic (IEA).

17 experimentally-supported GO terms:

GO term	NS	Evidence
odontoblast differentiation	BP	direct assay
cell body	CC	direct assay
ciliary tip	CC	direct assay
cilium	CC	direct assay
cytoplasm	CC	direct assay
cytoplasmic ribonucleoprotein granule	CC	direct assay
extracellular exosome	CC	high-throughput assay
intercellular bridge	CC	direct assay
microtubule	CC	direct assay
microtubule cytoskeleton	CC	direct assay
mitotic spindle	CC	direct assay
nuclear envelope lumen	CC	direct assay
nucleus	CC	high-throughput assay
sperm end piece	CC	direct assay
sperm principal piece	CC	direct assay
MHC class I protein binding	MF	direct assay
ubiquitin protein ligase binding	MF	physical interaction

Protein interactions and networks

IntAct

Human interaction partners of TUBB in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

showing 30 of 81 partners by confidence:

Partner	Interaction type	MIscore	Records
LRRK2	physical association	0.740	2
APP	physical association	0.670	3
NEDD8	physical association	0.670	3
SQSTM1	physical association	0.670	3
PLD2	association	0.640	1
HTT	physical association	0.560	9
CALR	physical association	0.560	3
DLST	physical association	0.560	3
NDUFV2	physical association	0.560	3
NEFL	physical association	0.560	3
NEK7	physical association	0.560	3
SNCA	physical association	0.560	3
SOD1	physical association	0.560	3
TFF2	physical association	0.560	3
TUBA1A	physical association	0.550	4
LNX2	physical association	0.550	2
MAPT	physical association	0.550	1
FXR1	physical association	0.510	2
TINF2	physical association	0.510	2
EBNA-LP	association	0.500	2
HTRA3	direct interaction	0.440	2
CLIP1	direct interaction	0.440	1
GRK2	phosphorylation reaction	0.440	1
STAU1	colocalization	0.430	1
YWHAG	physical association	0.400	2
TTK	physical association	0.400	1
YWHAB	physical association	0.400	1
YWHAZ	physical association	0.400	1
MTNR1A	physical association	0.370	1
NCAPH2	physical association	0.370	1

BioGRID (1,043 interactions; top human partners by supporting records in a sample of 600 records): ARL2 (Affinity Capture-MS; 4 records), HSPA8 (Co-fractionation; 4 records), PARK2 (Affinity Capture-MS; 4 records), TUBA1C (Co-fractionation; 4 records), TUBA4A (Co-fractionation; 4 records), EML4 (Affinity Capture-MS; 3 records), TBCD (Affinity Capture-MS; 3 records), TUBA1A (Proximity Label-MS; 3 records), TUBB3 (Affinity Capture-MS; 3 records), TUBB4B (Proximity Label-MS; 3 records), ZMYND19 (Reconstituted Complex; 3 records), ZNHIT6 (Affinity Capture-MS; 3 records), ADAP2 (Two-hybrid; 2 records), AGR2 (Affinity Capture-MS; 2 records), AIFM1 (Proximity Label-MS; 2 records)

SIGNOR signaling

11 signaling interactions:

A	Effect	B	Mechanism
NUMA1	up-regulates	TUBB	binding
TUBB	down-regulates	SMAD2	binding
TUBB	down-regulates	SMAD3	binding
TUBB	“down-regulates activity”	SMAD2	binding
TUBB	“down-regulates activity”	SMAD3	binding
“Vincristine sulfate”	“down-regulates activity”	TUBB	“chemical inhibition”
“vincaleukoblastine sulfate”	“down-regulates activity”	TUBB	“chemical inhibition”
“vinorelbine L-tartrate”	“down-regulates activity”	TUBB	“chemical inhibition”
JAKMIP1	“up-regulates quantity by stabilization”	TUBB	binding
YAP1	“up-regulates quantity by expression”	TUBB	“transcriptional regulation”
YAP/TAZ	“up-regulates quantity by expression”	TUBB	“transcriptional regulation”

Protein complexes (CORUM) (9)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

9 complexes by size:

Complex	Subunits	Members
★ TIP60-C complex	23	TRRAP, DMAP1, H2AZ2, H2BC18, MORF4L2, RUVBL2, EP400, EPC1, H2AC20, KAT5, TUBB, YEATS4, ACTL6A, BRD8, MEAF6, MORF4L1, MRGBP, RUVBL1, VPS72, ACTBL2, CREB3L2, ING3, MBTD1
★ SNW1 complex	18	SNW1, TUBB, ABCF2, DDB1, DDX23, EEF1A1, HSPA5, PFKL, CDC5L, EFTUD2, PRPF8, SFPQ, MATR3, MSH2, UBR5, EEF1G, HNRNPU, SNRNP200
★ CD4 receptor complex	9	PTPRCAP, TFRC, TUBA1C, TUBB, VIM, CD4, LCK, MYH9, PTPRC
★ ASCOM complex	7	RBBP5, TUBA4A, TUBB, ASH2L, KMT2C, KMT2D, NCOA6
★ TBCD-ARL2-tubulin(beta)-TBCE complex	4	TBCE, TUBB, ARL2, TBCD
★ TBCD-tubulin(alpha)-tubulin(beta) complex	3	TBCD, TUBA1A, TUBB
★ TBCD-ARL2-tubulin(beta) complex	3	ARL2, TBCD, TUBB
★ ANG-TUBB complex	2	TUBB, ANG
★ TRAF3IP1-TUBB complex	2	TRAF3IP1, TUBB

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 81 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
RIP-mediated NFkB activation via ZBP1	9	90.2×	1e-14
TRAF6 mediated NF-kB activation	11	75.0×	1e-16
TAK1-dependent IKK and NF-kappa-B activation	13	58.3×	7e-18
TNF signaling	9	56.8×	2e-12
TNFR1-induced NF-kappa-B signaling pathway	11	55.1×	5e-15
TICAM1, RIP1-mediated IKK complex recruitment	6	53.8×	1e-08
Regulation of NF-kappa B signaling	5	47.4×	6e-07
JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1	6	46.5×	3e-08

GO biological processes:

GO term	Partners	Fold	FDR
non-canonical NF-kappaB signal transduction	12	134.8×	2e-21
canonical NF-kappaB signal transduction	16	78.2×	4e-24
interleukin-1-mediated signaling pathway	5	53.5×	3e-06
toll-like receptor 4 signaling pathway	7	49.1×	2e-08
tumor necrosis factor-mediated signaling pathway	11	48.5×	7e-14
amyloid fibril formation	6	48.1×	3e-07
response to interleukin-1	5	34.0×	3e-05
positive regulation of canonical NF-kappaB signal transduction	17	16.5×	6e-14

Disease & clinical

Genetic variants

Variant evidence for TUBB: 139 ClinVar records (37 pathogenic / likely pathogenic). Per-variant detail is on Sugi Variant.

ClinVar

139 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	11
Likely pathogenic	26
Uncertain significance	62
Likely benign	13
Benign	13

Top pathogenic / likely-pathogenic (15)

Showing the 15 best-reviewed of 37 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
127189	NM_178014.4(TUBB):c.895A>G (p.Met299Val)	Pathogenic	criteria provided, multiple submitters, no conflicts	8
127191	NM_178014.4(TUBB):c.1201G>A (p.Glu401Lys)	Pathogenic	criteria provided, multiple submitters, no conflicts	6
1685467	NM_178014.4(TUBB):c.45G>C (p.Gln15His)	Likely pathogenic	criteria provided, multiple submitters, no conflicts	2
3256783	NM_178014.4(TUBB):c.869C>T (p.Thr290Ile)	Pathogenic	criteria provided, single submitter	2
2662647	NM_178014.4(TUBB):c.859C>T (p.Pro287Ser)	Pathogenic	criteria provided, single submitter	1
3343929	NM_178014.4(TUBB):c.716G>C (p.Cys239Ser)	Pathogenic	criteria provided, single submitter	1
4528358	NM_178014.4(TUBB):c.626A>G (p.Asp209Gly)	Pathogenic	criteria provided, single submitter	1
4853816	NM_178014.4(TUBB):c.628dup (p.Ile210fs)	Pathogenic	criteria provided, single submitter	1
4857507	NM_178014.4(TUBB):c.897G>C (p.Met299Ile)	Pathogenic	criteria provided, single submitter	1
976678	NM_178014.4(TUBB):c.139A>G (p.Ile47Val)	Likely pathogenic	criteria provided, single submitter	2
1339905	NM_178014.4(TUBB):c.917G>C (p.Arg306Pro)	Likely pathogenic	criteria provided, single submitter	2
373428	NM_178014.4(TUBB):c.322G>A (p.Glu108Lys)	Likely pathogenic	criteria provided, single submitter	1
376764	NM_178014.4(TUBB):c.533C>G (p.Thr178Ser)	Likely pathogenic	criteria provided, single submitter	1
392956	NM_178014.4(TUBB):c.682C>G (p.Leu228Val)	Likely pathogenic	criteria provided, single submitter	1
426178	NM_178014.4(TUBB):c.1230G>T (p.Glu410Asp)	Likely pathogenic	criteria provided, single submitter	1

Per-variant reference — Sugi Variant

Explore TUBB’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

AlphaMissense

2,396 missense substitutions predicted likely pathogenic (of 2,961 scored), across 428 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M403	9	0.975	0.999
M388	9	0.954	0.998
M300	9	0.924	0.996
M406	9	0.893	0.993
M233	9	0.874	0.997
M363	9	0.821	0.944
D67	8	0.999	1.000
D417	8	0.999	1.000
D203	8	0.998	1.000
N204	8	0.997	1.000
D249	8	0.997	0.999
F408	8	0.997	1.000
H264	8	0.994	0.999
H396	8	0.994	1.000
H28	8	0.993	0.997
F260	8	0.993	1.000
N184	8	0.992	1.000
D224	8	0.992	0.998
N226	8	0.991	1.000
F341	8	0.991	1.000

HPA cancer prognostics

RNA cancer specificity: Cancer enhanced (Glioblastoma Multiforme)

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

4 prognostic cancer types:

Cancer	Prognostic	p-value
Lung Adenocarcinoma (validation)	unfavorable	7.48e-07
Kidney Renal Clear Cell Carcinoma (validation)	unfavorable	5.26e-05
Kidney Chromophobe (TCGA)	unfavorable	0.000125
Kidney Renal Papillary Cell Carcinoma (TCGA)	unfavorable	0.000324

Disease associations

OMIM: gene MIM:191130 | disease phenotypes: MIM:615771, MIM:156610

GenCC curated gene-disease

4 curated gene-disease records:

Disease	Classification	Inheritance	Records
TUBB3-related tubulinopathy	Definitive	Autosomal dominant
multiple benign circumferential skin creases on limbs 1	Strong	Autosomal dominant	2
complex cortical dysplasia with other brain malformations 6	Strong	Autosomal dominant	3
multiple benign circumferential skin creases on limbs	Supportive	Autosomal dominant

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (12 panels, 8 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

12 panels:

Panel	Rating
Cerebral malformation	green
Clefting	green
DDG2P	green
Fetal anomalies	green
Hypotonic infant	green
Intellectual disability	green
Leukodystrophy, childhood onset	green
Malformations of cortical development	green
Early onset or syndromic epilepsy	amber
Paediatric disorders	amber
Structural eye disease	amber
Unexplained death in infancy and sudden unexplained death in childhood	amber

Mondo (4): complex cortical dysplasia with other brain malformations 6 (MONDO:0014341), skin creases, congenital symmetric circumferential, 1 (MONDO:0020738), TUBB3-related tubulinopathy (MONDO:0100154), multiple benign circumferential skin creases on limbs (MONDO:0007990)

MeSH disease descriptors

1 disease descriptors:

Descriptor	Name	Tree numbers
C537575	Michelin tire baby syndrome *(supp.)*

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (5): CHEMBL2095182 (PROTEIN COMPLEX GROUP), CHEMBL3832942 (PROTEIN FAMILY), CHEMBL3885647 (PROTEIN COMPLEX GROUP), CHEMBL5444 (SINGLE PROTEIN), CHEMBL6066847 (PROTEIN-PROTEIN INTERACTION)

Drugs acting on a complex or family that includes this protein

Curated ChEMBL mechanism-of-action drugs whose target is a protein complex or family of ≤10 members that includes TUBB — the drug acts on the assembly or class, not necessarily on this subunit alone.

1 drugs via a complex or family:

Drug	Target (ChEMBL)	Members	Max phase
ABT-751	Tubulin beta	10	2

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 1,654,135 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

22 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL107	COLCHICINE	4	94,904
CHEMBL3545252	DOCETAXEL	4	1,048
CHEMBL92	DOCETAXEL ANHYDROUS	4	198,959
CHEMBL5315124	LEVOFLOXACIN	4	195
CHEMBL33	LEVOFLOXACIN ANHYDROUS	4	43,906
CHEMBL364713	NOSCAPINE	4	15,119
CHEMBL428647	PACLITAXEL	4	335,735
CHEMBL61	PODOFILOX	4	37,975
CHEMBL571546	TIRBANIBULIN	4	1,248
CHEMBL159	VINBLASTINE	4	416,858
CHEMBL378544	VINBLASTINE SULFATE	4	33,140
CHEMBL90555	VINCRISTINE	4	270,851
CHEMBL553025	VINORELBINE	4	143,812
CHEMBL94657	PATUPILONE	3	15,122
CHEMBL20684	ABT-751	2	2,296
CHEMBL39541	DOLASTATIN-10	2	1,447
CHEMBL49642	INDIBULIN	2	1,015
CHEMBL292702	MAYTANSINE	2	9,381
CHEMBL1232461	MOLIBRESIB	2	1,601
CHEMBL9514	NOCODAZOLE	2	29,523
CHEMBL528271	PARBENDAZOLE	2
CHEMBL246600	COMBRETASTATIN	1

PharmGKB: 1 entry (CPIC guideline: no)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: other protein — Tubulins

Most potent curated ligand interactions (4 total), top 4:

Ligand	Action	Affinity	Parameter
vinblastine	Inhibition	9.0	pIC50
eribulin	Inhibition	8.23	pIC50
paclitaxel	Inhibition	8.05	pEC50
colchicine	Inhibition	7.96	pIC50

Binding affinities (BindingDB)

6 measured of 7 human assays (9 total across all organisms); most potent 6 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value
CHEMBL5653589	KD	1440 nM
CHEMBL4128424	IC50	2890 nM
CHEMBL4127437	IC50	6130 nM
CHEMBL4129198	IC50	9370 nM
CHEMBL3917601	KD	654000 nM
CHEMBL4298925	KD	1.06e+06 nM

ChEMBL bioactivities

1181 potent at pChembl≥5 of 1333 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
10.26	IC50	0.0551	nM	CHEMBL5194719
9.75	IC50	0.176	nM	CHEMBL5203711
9.51	IC50	0.308	nM	VINORELBINE
9.30	IC50	0.5	nM	DOLASTATIN-10
8.92	IC50	1.2	nM	CHEMBL5169466
8.85	IC50	1.4	nM	CHEMBL4575066
8.74	IC50	1.8	nM	PATUPILONE
8.59	IC50	2.6	nM	CHEMBL2024544
8.52	Ki	3	nM	COMBRETASTATIN A4
8.52	IC50	3	nM	COMBRETASTATIN A4
8.52	IC50	3	nM	DOLASTATIN-10
8.52	Kd	3	nM	CHEMBL5410715
8.52	IC50	3	nM	COLCHICINE
8.46	IC50	3.5	nM	PATUPILONE
8.38	IC50	4.2	nM	CHEMBL5197739
8.27	IC50	5.4	nM	CHEMBL5280519
8.22	IC50	6	nM	CHEMBL498271
8.05	EC50	9	nM	COMBRETASTATIN A4
8.04	Kd	9.047	nM	CHEMBL5653589
8.04	ED50	9.047	nM	CHEMBL5653589
8.01	EC50	9.8	nM	COMBRETASTATIN A4
8.01	IC50	9.77	nM	CHEMBL4778826
8.00	Ki	10	nM	CHEMBL381852
8.00	IC50	10	nM	CHEMBL204241
7.96	Kd	11	nM	CHEMBL5611905
7.89	IC50	12.9	nM	COMBRETASTATIN A4
7.85	Kd	14	nM	MAYTANSINE
7.70	IC50	20	nM	CHEMBL2369093
7.70	Ki	20	nM	CHEMBL369927
7.70	IC50	20	nM	CHEMBL5183440
7.70	Kd	20	nM	CHEMBL5613121
7.67	Kd	21.5	nM	CHEMBL4797381
7.64	IC50	23	nM	COMBRETASTATIN A4
7.62	EC50	24	nM	CHEMBL4250191
7.60	IC50	25	nM	CHEMBL552462
7.52	IC50	30	nM	CHEMBL381122
7.52	IC50	30	nM	COMBRETASTATIN A4
7.52	IC50	30	nM	CHEMBL203062
7.52	IC50	30	nM	CHEMBL204710
7.51	EC50	31	nM	PACLITAXEL
7.43	Kd	36.9	nM	CHEMBL4756812
7.40	EC50	40	nM	CHEMBL1688184
7.35	EC50	45	nM	CHEMBL4239716
7.34	IC50	46	nM	CHEMBL374257
7.33	Kd	47	nM	CHEMBL5542101
7.30	Ki	50	nM	CHEMBL196966
7.30	EC50	50	nM	CHEMBL1688183
7.30	EC50	50	nM	CHEMBL1688189
7.29	Kd	51	nM	CHEMBL5614306
7.28	EC50	53	nM	CHEMBL4241638

PubChem BioAssay actives

1114 with measured affinity, of 6100 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
(Z)-1-[4-bromo-2-(4-fluorophenyl)-1-benzofuran-7-yl]-3-(4-methoxyphenyl)prop-2-en-1-one	1882651: Inhibition of tubulin polymerization (unknown origin) measured every 3 secs for 1 hr by spectroflourimetric analysis	ic50	0.0001	uM
(Z)-1-[4-bromo-2-(4-fluorophenyl)-1-benzofuran-7-yl]-3-[4-(trifluoromethoxy)phenyl]prop-2-en-1-one	1882651: Inhibition of tubulin polymerization (unknown origin) measured every 3 secs for 1 hr by spectroflourimetric analysis	ic50	0.0002	uM
Vinorelbine	1993632: Inhibition of tubulin polymerization (unknown origin)	ic50	0.0003	uM
(2S)-2-[[(2S)-2-(dimethylamino)-3-methylbutanoyl]amino]-N-[(3R,4S,5S)-3-methoxy-1-[(2S)-2-[(1R,2R)-1-methoxy-2-methyl-3-oxo-3-(2-pyridin-2-ylethylamino)propyl]pyrrolidin-1-yl]-5-methyl-1-oxoheptan-4-yl]-N,3-dimethylbutanamide	1896115: Binding affinity to tubulin (unknown origin)	ic50	0.0012	uM
(2S)-2-[[(2S)-2-(dimethylamino)-3-methylbutanoyl]amino]-N-[(3R,4S,5S)-3-methoxy-1-[(2S)-2-[(1R,2R)-1-methoxy-2-methyl-3-oxo-3-[[(1S)-2-phenyl-1-(1,3-thiazol-2-yl)ethyl]amino]propyl]pyrrolidin-1-yl]-5-methyl-1-oxoheptan-4-yl]-N,3-dimethylbutanamide	1896110: Inhibition of tubulin (unknown origin) polymerization assessed as reduction in microtubule formation measured for 20 mins by spectrophotometric analysis	ic50	0.0012	uM
(3Z,6Z)-3-[(5-tert-butyl-1H-imidazol-4-yl)methylidene]-6-phenacylidenepiperazine-2,5-dione	1587857: Inhibition of tubulin polymerization (unknown origin)	ic50	0.0014	uM
(1S,3S,7S,10R,11S,12S,16R)-7,11-dihydroxy-8,8,10,12,16-pentamethyl-3-[(E)-1-(2-methyl-1,3-thiazol-4-yl)prop-1-en-2-yl]-4,17-dioxabicyclo[14.1.0]heptadecane-5,9-dione	2231268: Inhibition of tubulin polymerization (unknown origin)	ic50	0.0018	uM
(3Z,6Z)-3-[(5-tert-butyl-1H-imidazol-4-yl)methylidene]-6-[(2,5-difluorophenyl)methylidene]piperazine-2,5-dione	1587857: Inhibition of tubulin polymerization (unknown origin)	ic50	0.0026	uM
3-hydroxy-2-[N-[2-(methoxymethyl)-1-benzofuran-7-yl]-C-methylcarbonimidoyl]-5-phenylcyclohex-2-en-1-one	2034736: Displacement of fluorescent probe (R)-(+)-ethyl 5-amino2-methyl-1,2-dihydro-3-phenylpyrido[3,4-b]pyrazin-7-ylcarbamate from tubulin colchicine binding site (unknown origin) assessed as dissociation constant	kd	0.0030	uM
2-methoxy-5-[(Z)-2-(3,4,5-trimethoxyphenyl)ethenyl]phenol	1862628: Inhibition of tubulin polymerization in human HeLa cells assessed as microtubule network polymerization after 30 mins by immunofluorescence analysis	ic50	0.0030	uM
Colchicine	2074087: Inhibition of microtubule polymerization in human K562 cells measured for 60 mins by fluorescence based analysis	ic50	0.0030	uM
tert-butyl (3R,4S,5S)-4-[[(2S)-2-[[(2S)-2-(dimethylamino)-3-methylbutanoyl]amino]-3-methylbutanoyl]-methylamino]-3-methoxy-5-methylheptanoate	1896110: Inhibition of tubulin (unknown origin) polymerization assessed as reduction in microtubule formation measured for 20 mins by spectrophotometric analysis	ic50	0.0042	uM
3-methoxy-6-[4-(3,4,5-trimethoxyphenyl)-1H-pyrazol-5-yl]benzene-1,2-diol	1929685: Inhibition of tubulin polymerization in human SH-SY5Y cells incubated for 24 hrs by SDS-PAGE based analysis	ic50	0.0054	uM
2-methoxy-5-[1-(3,4,5-trimethoxyphenyl)ethenyl]phenol	1862628: Inhibition of tubulin polymerization in human HeLa cells assessed as microtubule network polymerization after 30 mins by immunofluorescence analysis	ic50	0.0060	uM
4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2149678: Binding affinity to human TUBB incubated for 45 mins by Kinobead based pull down assay	kd	0.0090	uM
(E)-1-[1-(4-chlorophenyl)-5-methyltriazol-4-yl]-3-(3,4-dimethoxyphenyl)prop-2-en-1-one	1689700: Inhibition of Tubulin in human RPMI-8226 cells incubated for 2 hrs by ELISA	ic50	0.0098	uM
N-(1,3-benzodioxol-5-yl)-5-[2-(3,5-dimethoxyphenoxy)-3-pyridinyl]-1H-1,2,4-triazol-3-amine	256882: Displacement of [3H]colchicine from tubulin	ki	0.0100	uM
N-(2,3-dihydro-1,4-benzodioxin-6-yl)-5-[2-(pyridin-2-ylmethylamino)phenyl]-1,3-oxazol-2-amine	261214: Displacement of [3H]colchicine from tubulin at 65 nM	ic50	0.0100	uM
[(1S,2R,3S,5R,6S,16E,18E,20R,21S)-11-chloro-21-hydroxy-12,20-dimethoxy-2,5,9,16-tetramethyl-8,23-dioxo-4,24-dioxa-9,22-diazatetracyclo[19.3.1.110,14.03,5]hexacosa-10,12,14(26),16,18-pentaen-6-yl] acetate	2126113: Displacement of fluorescent Maytansine probe from tubulin (unknown origin) assessed as dissociation constant by competitive binding based fluorescence anisotropy	kd	0.0110	uM
[(1S,2R,3S,5S,6S,16E,18E,20R,21S)-11-chloro-21-hydroxy-12,20-dimethoxy-2,5,9,16-tetramethyl-8,23-dioxo-4,24-dioxa-9,22-diazatetracyclo[19.3.1.110,14.03,5]hexacosa-10,12,14(26),16,18-pentaen-6-yl] (2S)-2-[acetyl(methyl)amino]propanoate	2126113: Displacement of fluorescent Maytansine probe from tubulin (unknown origin) assessed as dissociation constant by competitive binding based fluorescence anisotropy	kd	0.0140	uM
N-(2,3-dihydro-1,4-benzodioxin-6-yl)-5-[2-(3,5-dimethoxyphenoxy)-3-pyridinyl]-1H-1,2,4-triazol-3-amine	256882: Displacement of [3H]colchicine from tubulin	ki	0.0200	uM
methyl (13S,15S,17S)-13-[(1R,9R,10S,11R,12R,19R)-10-(1-diethoxyphosphorylhexylcarbamoyl)-12-ethyl-10,11-dihydroxy-5-methoxy-8-methyl-8,16-diazapentacyclo[10.6.1.01,9.02,7.016,19]nonadeca-2,4,6,13-tetraen-4-yl]-17-ethyl-17-hydroxy-1,11-diazatetracyclo[13.3.1.04,12.05,10]nonadeca-4(12),5,7,9-tetraene-13-carboxylate	214333: The compound tested for the inhibition of tubulin polymerization.	ic50	0.0200	uM
(E)-3-[5-[(2-cyanoquinolin-4-yl)-methylamino]-2-methoxyphenyl]-N-hydroxyprop-2-enamide	1862628: Inhibition of tubulin polymerization in human HeLa cells assessed as microtubule network polymerization after 30 mins by immunofluorescence analysis	ic50	0.0200	uM
[(1S,2R,3S,5R,6S,16E,18E,20R,21S)-11-chloro-21-hydroxy-12,20-dimethoxy-2,5,9,16-tetramethyl-8,23-dioxo-4,24-dioxa-9,22-diazatetracyclo[19.3.1.110,14.03,5]hexacosa-10,12,14(26),16,18-pentaen-6-yl] hept-6-ynoate	2126113: Displacement of fluorescent Maytansine probe from tubulin (unknown origin) assessed as dissociation constant by competitive binding based fluorescence anisotropy	kd	0.0200	uM
(3S)-3-[(5R)-6-[[1-(4-fluorophenyl)triazol-4-yl]methyl]-4-methoxy-7,8-dihydro-5H-[1,3]dioxolo[4,5-g]isoquinolin-5-yl]-6,7-dimethoxy-3H-2-benzofuran-1-one	1675128: Binding affinity to CM5 chip immobilized beta tubulin (unknown origin) assessed as thermodynamic constants by SPR assay	kd	0.0215	uM
N-(4-methoxyphenyl)-N,5-dimethylfuro[2,3-d]pyrimidin-4-amine	1635267: Induction of microtubule depolymerization in human A10 cells incubated for 18 hrs by indirect immunofluorescence analysis	ec50	0.0240	uM
[4-amino-2-(4-methoxyanilino)-1,3-thiazol-5-yl]-(3,4-dimethoxyphenyl)methanone	1674862: Binding affinity to beta tubulin in HEK293 cells assessed as disruption of microtubule polymerization by ITDRF-CETSA assay	ic50	0.0250	uM
N-(2,3-dihydro-1,4-benzodioxin-6-yl)-5-[2-(pyridin-3-ylmethylamino)-3-pyridinyl]-1,3,4-oxadiazol-2-amine	261214: Displacement of [3H]colchicine from tubulin at 65 nM	ic50	0.0300	uM
N-(1,3-benzodioxol-5-yl)-5-[2-(pyridin-4-ylmethylamino)-3-pyridinyl]-1,3,4-oxadiazol-2-amine	261214: Displacement of [3H]colchicine from tubulin at 65 nM	ic50	0.0300	uM
N-(1,3-benzodioxol-5-yl)-5-[2-(pyridin-2-ylmethylamino)-3-pyridinyl]-1,3,4-oxadiazol-2-amine	261214: Displacement of [3H]colchicine from tubulin at 65 nM	ic50	0.0300	uM
Paclitaxel	260235: Effect on induction of mitotic arrest by phosphohistone H3 (pH3) assay	ec50	0.0310	uM
(3S)-3-[(5R)-9-bromo-6-[[1-(4-bromophenyl)triazol-4-yl]methyl]-4-methoxy-7,8-dihydro-5H-[1,3]dioxolo[4,5-g]isoquinolin-5-yl]-6,7-dimethoxy-3H-2-benzofuran-1-one	1675128: Binding affinity to CM5 chip immobilized beta tubulin (unknown origin) assessed as thermodynamic constants by SPR assay	kd	0.0369	uM
6-(3-chloro-6,11,11-trioxobenzo[b][1,4]benzothiazepin-5-yl)-N-hydroxyhexanamide	580932: Inhibition of HDAC activity in human NB4 cells assessed as acetylated tubulin after 24 hrs by Western blot analysis	ec50	0.0400	uM
N,5-dimethyl-N-(4-methylsulfanylphenyl)furo[2,3-d]pyrimidin-4-amine	1635267: Induction of microtubule depolymerization in human A10 cells incubated for 18 hrs by indirect immunofluorescence analysis	ec50	0.0450	uM
[7-(3-hydroxyprop-1-ynyl)-6-methoxy-2H-indazol-3-yl]-(3,4,5-trimethoxyphenyl)methanone	280080: Displacement of [3H]colchicine from tubulin in MCF7 cells	ic50	0.0460	uM
N-hydroxy-6-(3-methoxy-6,11,11-trioxobenzo[b][1,4]benzothiazepin-5-yl)hexanamide	580932: Inhibition of HDAC activity in human NB4 cells assessed as acetylated tubulin after 24 hrs by Western blot analysis	ec50	0.0500	uM
N-hydroxy-6-(6,11,11-trioxobenzo[b][1,4]benzothiazepin-5-yl)hexanamide	580932: Inhibition of HDAC activity in human NB4 cells assessed as acetylated tubulin after 24 hrs by Western blot analysis	ec50	0.0500	uM
5-[2-(3,5-dimethoxyphenoxy)-3-pyridinyl]-N-(3-methoxyphenyl)-1H-1,2,4-triazol-3-amine	256882: Displacement of [3H]colchicine from tubulin	ki	0.0500	uM
[(1S,2R,3S,5R,6S,16E,18E,20R,21S)-11-chloro-21-hydroxy-12,20-dimethoxy-2,5,9,16-tetramethyl-8,23-dioxo-4,24-dioxa-9,22-diazatetracyclo[19.3.1.110,14.03,5]hexacosa-10,12,14(26),16,18-pentaen-6-yl] benzoate	2126113: Displacement of fluorescent Maytansine probe from tubulin (unknown origin) assessed as dissociation constant by competitive binding based fluorescence anisotropy	kd	0.0510	uM
N-ethyl-N-(4-methoxyphenyl)-5-methylfuro[2,3-d]pyrimidin-4-amine	1635267: Induction of microtubule depolymerization in human A10 cells incubated for 18 hrs by indirect immunofluorescence analysis	ec50	0.0530	uM
3-[3-(1,3-benzodioxol-5-ylamino)-1H-1,2,4-triazol-5-yl]-N-(3,5-dimethoxyphenyl)pyridin-2-amine	256882: Displacement of [3H]colchicine from tubulin	ki	0.0600	uM
Vinblastine	214333: The compound tested for the inhibition of tubulin polymerization.	ic50	0.0700	uM
methyl (13S,15S,17S)-13-[(1R,9R,10S,11R,12R,19R)-10-[(1-diethoxyphosphoryl-2-phenylethyl)carbamoyl]-12-ethyl-10,11-dihydroxy-5-methoxy-8-methyl-8,16-diazapentacyclo[10.6.1.01,9.02,7.016,19]nonadeca-2,4,6,13-tetraen-4-yl]-17-ethyl-17-hydroxy-1,11-diazatetracyclo[13.3.1.04,12.05,10]nonadeca-4(12),5,7,9-tetraene-13-carboxylate	214333: The compound tested for the inhibition of tubulin polymerization.	ic50	0.0700	uM
N-(2,3-dihydro-1,4-benzodioxin-6-yl)-5-[3-(pyridin-2-ylmethylamino)thiophen-2-yl]-1,3,4-oxadiazol-2-amine	261214: Displacement of [3H]colchicine from tubulin at 65 nM	ic50	0.0750	uM
methyl (13S,15S,17S)-13-[(1R,9R,10S,11R,12R,19R)-10-[[(1S)-1-diethoxyphosphorylethyl]carbamoyl]-12-ethyl-10,11-dihydroxy-5-methoxy-8-methyl-8,16-diazapentacyclo[10.6.1.01,9.02,7.016,19]nonadeca-2,4,6,13-tetraen-4-yl]-17-ethyl-17-hydroxy-1,11-diazatetracyclo[13.3.1.04,12.05,10]nonadeca-4(12),5,7,9-tetraene-13-carboxylate	214333: The compound tested for the inhibition of tubulin polymerization.	ic50	0.0800	uM
4-methoxy-2-[(Z)-2-(3,4,5-trimethoxyphenyl)ethenyl]thiophene	1267532: Inhibition of Tubulin polymerization in human HeLa cells assessed as decrease in dynamic tyrosinated microtubules after 2 hrs by microplate reader analysis	ec50	0.0810	uM
N-[2-[[(E)-(2,4-dihydroxyphenyl)methylideneamino]carbamoyl]phenyl]furan-2-carboxamide	1882654: Inhibition of tubulin polymerization (unknown origin)	ic50	0.0876	uM
N-hydroxy-6-(3-methoxy-6-oxobenzo[b][1,4]benzoxazepin-5-yl)hexanamide	580932: Inhibition of HDAC activity in human NB4 cells assessed as acetylated tubulin after 24 hrs by Western blot analysis	ec50	0.0900	uM
N-(3,5-dimethoxyphenyl)-3-[3-(3-methoxyanilino)-1H-1,2,4-triazol-5-yl]pyridin-2-amine	256882: Displacement of [3H]colchicine from tubulin	ki	0.1000	uM
methyl (13S,15S,17S)-13-[(1R,9R,10S,11R,12R,19R)-10-[[(1R)-1-diethoxyphosphoryl-2-(1H-indol-3-yl)ethyl]carbamoyl]-12-ethyl-10,11-dihydroxy-5-methoxy-8-methyl-8,16-diazapentacyclo[10.6.1.01,9.02,7.016,19]nonadeca-2,4,6,13-tetraen-4-yl]-17-ethyl-17-hydroxy-1,11-diazatetracyclo[13.3.1.04,12.05,10]nonadeca-4(12),5,7,9-tetraene-13-carboxylate	214333: The compound tested for the inhibition of tubulin polymerization.	ic50	0.1000	uM

CTD chemical–gene interactions

115 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	affects cotreatment, increases expression, decreases expression	6
bisphenol A	affects expression, affects cotreatment, increases methylation, increases expression, decreases expression	5
Tobacco Smoke Pollution	affects expression, decreases expression, increases metabolic processing	4
Benzo(a)pyrene	increases methylation, decreases expression, increases expression	3
cobaltous chloride	decreases expression, increases expression	2
perfluorooctanoic acid	affects cotreatment, affects expression, decreases expression	2
chloropicrin	affects expression, decreases expression	2
Docetaxel	decreases reaction, increases response to substance, decreases response to substance, increases expression	2
Arsenic	affects methylation, affects binding, decreases activity, decreases reaction	2
Doxorubicin	affects cotreatment, increases expression, decreases expression	2
Quercetin	decreases expression	2
Tunicamycin	decreases expression	2
Valproic Acid	decreases expression	2
Cyclosporine	decreases expression, affects expression	2
Cadmium Chloride	decreases expression, increases expression, increases methylation	2
Thapsigargin	decreases expression	2
Particulate Matter	decreases expression, increases abundance	2
aristolochic acid I	decreases expression	1
GSK-J4	decreases expression	1
bisphenol F	increases expression	1
ammonium 2,3,3,3-tetrafluoro-2-(heptafluoropropoxy)-propanoate	affects cotreatment, affects expression	1
beauvericin	affects cotreatment, increases expression	1
biochanin A	increases expression	1
triphenyl phosphate	affects expression	1
pirinixic acid	affects binding, decreases expression, increases activity	1
titanium dioxide	increases phosphorylation	1
withaferin A	decreases expression	1
pyrogallol 1,3-dimethyl ether	affects cotreatment, affects localization, decreases expression, increases expression	1
salinomycin	decreases expression	1
tris(2-butoxyethyl) phosphate	affects expression	1

ChEMBL screening assays

1780 unique, capped per target: 1740 binding, 34 functional, 6 admet

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1009021	Binding	Inhibition of tubulin polymerization in human MCF7 cells at 1 uM after 2 hrs by SDS-PAGE	A new cytotoxic epothilone from modified polyketide synthases heterologously expressed in Myxococcus xanthus. — *J Nat Prod*
CHEMBL4146506	ADMET	Inhibition of tubulin polymerization in human HaCaT cells assessed as chromatin condensation at 1 uM after 24 hrs by Hoechst 33258 staining-based fluorescence microscopic analysis	Design, synthesis, and biological evaluation of novel combretastatin A-4 thio derivatives as microtubule targeting agents. — *Eur J Med Chem*
CHEMBL5056161	Functional	Inhibition of tubulin polymerization (unknown origin) assessed as fluorescence intensity measured for 90 mins by DAPI based microplate reader	Design, synthesis and biological evaluation of indole-based [1,2,4]triazolo[4,3-a] pyridine derivatives as novel microtubule polymerization inhibitors. — *Eur J Med Chem*

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

1 trials:

NCT	Phase	Status	Title
NCT03059420	Not specified	RECRUITING	Genetic Studies of Strabismus, Congenital Cranial Dysinnervation Disorders (CCDDs), and Their Associated Anomalies

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for TUBB across ~30M SureChEMBL compounds — explore on Sugi Predict.