TUBB8

Summary

TUBB8 (tubulin beta 8 class VIII, HGNC:20773) is a protein-coding gene on chromosome 10p15.3, encoding Tubulin beta-8 chain (Q3ZCM7). Tubulin is the major constituent of microtubules, a cylinder consisting of laterally associated linear protofilaments composed of alpha- and beta-tubulin heterodimers.

The protein encoded by this gene represents the primary beta-tubulin subunit of oocytes and the early embryo. Defects in this gene, which is primate-specific, are a cause of oocyte maturation defect 2 and infertility.

Source: NCBI Gene 347688 — RefSeq curated summary.

At a glance

• Gene–disease (curated): oocyte maturation defect 2 (Definitive, GenCC)
• Clinical variants (ClinVar): 107 total — 12 pathogenic, 30 likely-pathogenic
• Phenotypes (HPO): 8
• Druggable target: yes — 21 molecules with ChEMBL bioactivity
• MANE Select transcript: NM_177987

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:20773
Approved symbol	TUBB8
Name	tubulin beta 8 class VIII
Location	10p15.3
Locus type	gene with protein product
Status	Approved
Aliases	bA631M21.2
Ensembl gene	ENSG00000261456
Ensembl biotype	protein_coding
OMIM	616768
Entrez	347688

Gene structure

Transcript identifiers

Ensembl transcripts: 7 — 5 protein_coding, 1 retained_intron, 1 nonsense_mediated_decay

ENST00000561967, ENST00000562809, ENST00000563456, ENST00000564130, ENST00000567466, ENST00000568584, ENST00000568866

RefSeq mRNA: 2 — MANE Select: NM_177987 NM_001389619, NM_177987

CCDS: CCDS7051

Canonical transcript exons

ENST00000568584 — 4 exons

Exon	Start	End
ENSE00000000317	46888	48114
ENSE00002575813	49182	49296
ENSE00003464213	48804	48912
ENSE00003672288	48615	48725

Expression profiles

Bgee: expression breadth ubiquitous, 107 present calls, max score 84.22.

Top tissues by expression

123 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	84.22	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	76.70	gold quality
cortical plate	UBERON:0005343	58.28	gold quality
testis	UBERON:0000473	56.58	gold quality
right testis	UBERON:0004534	56.56	gold quality
left testis	UBERON:0004533	56.38	gold quality
right lobe of thyroid gland	UBERON:0001119	54.95	gold quality
right uterine tube	UBERON:0001302	54.79	gold quality
thyroid gland	UBERON:0002046	51.70	gold quality
left lobe of thyroid gland	UBERON:0001120	51.22	gold quality
placenta	UBERON:0001987	49.89	gold quality
nucleus accumbens	UBERON:0001882	48.19	gold quality
ganglionic eminence	UBERON:0004023	47.64	gold quality
endometrium	UBERON:0001295	47.63	gold quality
adult mammalian kidney	UBERON:0000082	46.34	gold quality
superior frontal gyrus	UBERON:0002661	45.57	silver quality
ventricular zone	UBERON:0003053	45.36	gold quality
temporal lobe	UBERON:0001871	45.35	gold quality
amygdala	UBERON:0001876	45.10	gold quality
right adrenal gland cortex	UBERON:0035827	45.04	gold quality
kidney	UBERON:0002113	44.68	gold quality
hypothalamus	UBERON:0001898	44.31	gold quality
putamen	UBERON:0001874	44.15	gold quality
granulocyte	CL:0000094	43.95	silver quality
caudate nucleus	UBERON:0001873	43.86	gold quality
Ammon’s horn	UBERON:0001954	43.75	gold quality
anterior cingulate cortex	UBERON:0009835	43.58	gold quality
thoracic mammary gland	UBERON:0005200	43.48	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	43.47	gold quality
monocyte	CL:0000576	43.42	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-MTAB-8381	yes	1065.16
E-ANND-3	no	1.12

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

6 targeting TUBB8, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4719	99.73	72.10	3329
HSA-MIR-3619-5P	99.00	68.87	2308
HSA-MIR-3611	98.76	68.76	1290
HSA-MIR-214-3P	98.71	68.12	2128
HSA-MIR-761	98.71	68.07	2051
HSA-MIR-4722-5P	98.46	66.34	1611

Literature-anchored findings (GeneRIF, showing 25)

• TUBB8 mutations have dominant-negative effects that disrupt microtubule behavior and oocyte meiotic spindle assembly and maturation, causing female infertility. (PMID:26789871)
• 9 novel TUBB8 mutations and phenotypes in patients with oocyte maturation arrest were reported. (PMID:27273344)
• The results not only emphasize the important role of TUBB8 in oocyte maturation, fertilization and early embryonic development but they also provide a basis for determining the genetic variations in TUBB8 as a potential additional criterion for evaluating the quality of patients’ functional PB1 oocytes. (PMID:27989988)
• TUBB8 mutations occur in a high proportion of infertile women with oocyte maturation arrest. (PMID:28652098)
• This TUBB8 variant in one infertile individual was absent in the 100 fertile females and was predicted to be highly damaging to the function of the TUBB8 protein by SIFT and PolyPhen-2. (PMID:29671363)
• A homozygous mutation of TUBB8 associated with complete cleavage failure in fertilized eggs. (PMID:29704226)
• A novel missense TUBB8 mutation (c.1054G > T, p.A352S) in the patient and her elder sister was detected and shown to be associated with oocyte maturation arrest as the cause for their infertility. (PMID:29877102)
• TUBB8 mutations cause oocyte maturation arrest, fertilization failure, early embryonic arrest and embryo implantation failure. (PMID:30297906)
• Oocyte maturation arrest produced by TUBB8 mutations: impact of genetic disorders in infertility treatment. (PMID:32063091)
• Identification novel mutations in TUBB8 in female infertility and a novel phenotype of large polar body in oocytes with TUBB8 mutations. (PMID:32524331)
• Identification and rescue of a novel TUBB8 mutation that causes the first mitotic division defects and infertility. (PMID:32949002)
• Mutation analysis of tubulin beta 8 class VIII in infertile females with oocyte or embryonic defects. (PMID:33009822)
• Novel mutations in TUBB8 expand the mutational and phenotypic spectrum of patients with zygotes containing multiple pronuclei. (PMID:33059025)
• The comprehensive variant and phenotypic spectrum of TUBB8 in female infertility. (PMID:33970371)
• TUBB8 Mutations Cause Female Infertility with Large Polar Body Oocyte and Fertilization Failure. (PMID:34160777)
• Expanding the Genetic and Phenotypic Spectrum of Female Infertility Caused by TUBB8 Mutations. (PMID:34494234)
• Two mutations in TUBB8 cause developmental arrest in human oocytes and early embryos. (PMID:34509376)
• Mutation analysis of the TUBB8 gene in primary infertile women with oocyte maturation arrest. (PMID:35354490)
• Novel mutations in TUBB8 and ZP3 cause human oocyte maturation arrest and female infertility. (PMID:36335766)
• Genetic screening and analysis of TUBB8 variants in females seeking ART. (PMID:36463079)
• A novel compound heterozygous mutation in TUBB8 causing early embryonic developmental arrest. (PMID:36735156)
• Evaluation of TUBB8 gene alterations in infertile women with oocyte maturation and cleavage arrest referred to Royan Institute. (PMID:37597348)
• TUBB8 mutations as a cause of oocyte maturation abnormalities: presentation of oocyte and embryo profiles and novel mutations. (PMID:37672871)
• Phenotypic variability in two female siblings with oocyte maturation arrest due to a TUBB8 variant. (PMID:37904145)
• Novel variants in TUBB8 gene cause multiple phenotypic abnormalities in human oocytes and early embryos. (PMID:38007525)

Cross-species orthologs

0 orthologs

Paralogs (23): TUBG2 (ENSG00000037042), TUBE1 (ENSG00000074935), TUBA3D (ENSG00000075886), TUBB1 (ENSG00000101162), TUBB4A (ENSG00000104833), TUBD1 (ENSG00000108423), TUBA1B (ENSG00000123416), TUBA4A (ENSG00000127824), TUBG1 (ENSG00000131462), TUBB2A (ENSG00000137267), TUBB2B (ENSG00000137285), TUBA3E (ENSG00000152086), TUBA1A (ENSG00000167552), TUBA1C (ENSG00000167553), TUBB8B (ENSG00000173213), TUBB6 (ENSG00000176014), TUBAL3 (ENSG00000178462), TUBA8 (ENSG00000183785), TUBB4B (ENSG00000188229), TUBB (ENSG00000196230), TUBA3C (ENSG00000198033), TUBA4B (ENSG00000243910), TUBB3 (ENSG00000258947)

Protein

Protein identifiers

Tubulin beta-8 chain — Q3ZCM7 (reviewed: Q3ZCM7)

Alternative names: Tubulin beta 8 class VIII

All UniProt accessions (6): A0A075B724, A0A075B725, A0A075B735, A0A075B736, Q3ZCM7, Q5SQY0

UniProt curated annotations — full annotation on UniProt →

Function. Tubulin is the major constituent of microtubules, a cylinder consisting of laterally associated linear protofilaments composed of alpha- and beta-tubulin heterodimers. Microtubules grow by the addition of GTP-tubulin dimers to the microtubule end, where a stabilizing cap forms. Below the cap, tubulin dimers are in GDP-bound state, owing to GTPase activity of alpha-tubulin. TUBB8 has a key role in meiotic spindle assembly and oocyte maturation.

Subunit / interactions. Dimer of alpha and beta chains. A typical microtubule is a hollow water-filled tube with an outer diameter of 25 nm and an inner diameter of 15 nM. Alpha-beta heterodimers associate head-to-tail to form protofilaments running lengthwise along the microtubule wall with the beta-tubulin subunit facing the microtubule plus end conferring a structural polarity. Microtubules usually have 13 protofilaments but different protofilament numbers can be found in some organisms and specialized cells.

Subcellular location. Cytoplasm. Cytoskeleton. Spindle.

Tissue specificity. Expressed at a high level in oocytes, at different stages of development.

Post-translational modifications. Some glutamate residues at the C-terminus are polyglutamylated, resulting in polyglutamate chains on the gamma-carboxyl group. Polyglutamylation plays a key role in microtubule severing by spastin (SPAST). SPAST preferentially recognizes and acts on microtubules decorated with short polyglutamate tails: severing activity by SPAST increases as the number of glutamates per tubulin rises from one to eight, but decreases beyond this glutamylation threshold. Glutamylation is also involved in cilia motility. Some glutamate residues at the C-terminus are monoglycylated but not polyglycylated due to the absence of functional TTLL10 in human. Monoglycylation is mainly limited to tubulin incorporated into cilia and flagella axonemes, which is required for their stability and maintenance. Flagella glycylation controls sperm motility. Both polyglutamylation and monoglycylation can coexist on the same protein on adjacent residues, and lowering glycylation levels increases polyglutamylation, and reciprocally. Phosphorylated on Ser-172 by CDK1 during the cell cycle, from metaphase to telophase, but not in interphase. This phosphorylation inhibits tubulin incorporation into microtubules.

Disease relevance. Oocyte/zygote/embryo maturation arrest 2 (OZEMA2) [MIM:616780] A primary infertility disorder caused by defective oocyte maturation. Oocytes are arrested at metaphase I, and have an abnormal or no detectable spindle on polarization microscopy. OOMD2 inheritance can be autosomal dominant or autosomal recessive. The disease is caused by variants affecting the gene represented in this entry.

Domain organisation. The MREI motif is common among all beta-tubulin isoforms and may be critical for tubulin autoregulation.

Similarity. Belongs to the tubulin family.

RefSeq proteins (2): NP_001376548, NP_817124* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000217	Tubulin	Family
IPR002453	Beta_tubulin	Family
IPR003008	Tubulin_FtsZ_GTPase	Domain
IPR008280	Tub_FtsZ_C	Homologous_superfamily
IPR013838	Beta-tubulin_BS	Binding_site
IPR017975	Tubulin_CS	Conserved_site
IPR018316	Tubulin/FtsZ_2-layer-sand-dom	Domain
IPR023123	Tubulin_C	Homologous_superfamily
IPR036525	Tubulin/FtsZ_GTPase_sf	Homologous_superfamily
IPR037103	Tubulin/FtsZ-like_C	Homologous_superfamily

Pfam: PF00091, PF03953

UniProt features (32 total): sequence variant 17, binding site 9, modified residue 2, chain 1, region of interest 1, short sequence motif 1, compositionally biased region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q3ZCM7-F1	91.99	0.83

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (9): 144; 204; 226; 11; 69; 69; 138; 142; 143

Post-translational modifications (2): 172, 436

Function

Pathways and Gene Ontology

Reactome pathways

77 pathways

ID	Pathway
R-HSA-1445148	Translocation of SLC2A4 (GLUT4) to the plasma membrane
R-HSA-190840	Microtubule-dependent trafficking of connexons from Golgi to the plasma membrane
R-HSA-190861	Gap junction assembly
R-HSA-2132295	MHC class II antigen presentation
R-HSA-2467813	Separation of Sister Chromatids
R-HSA-2500257	Resolution of Sister Chromatid Cohesion
R-HSA-3371497	HSP90 chaperone cycle for steroid hormone receptors (SHR) in the presence of ligand
R-HSA-380320	Recruitment of NuMA to mitotic centrosomes
R-HSA-437239	Recycling pathway of L1
R-HSA-5620920	Cargo trafficking to the periciliary membrane
R-HSA-5626467	RHO GTPases activate IQGAPs
R-HSA-5663220	RHO GTPases Activate Formins
R-HSA-6807878	COPI-mediated anterograde transport
R-HSA-6811434	COPI-dependent Golgi-to-ER retrograde traffic
R-HSA-6811436	COPI-independent Golgi-to-ER retrograde traffic
R-HSA-68877	Mitotic Prometaphase
R-HSA-8852276	The role of GTSE1 in G2/M progression after G2 checkpoint
R-HSA-8955332	Carboxyterminal post-translational modifications of tubulin
R-HSA-9609690	HCMV Early Events
R-HSA-9609736	Assembly and cell surface presentation of NMDA receptors
R-HSA-9619483	Activation of AMPK downstream of NMDARs
R-HSA-9646399	Aggrephagy
R-HSA-9648025	EML4 and NUDC in mitotic spindle formation
R-HSA-9668328	Sealing of the nuclear envelope (NE) by ESCRT-III
R-HSA-983189	Kinesins
R-HSA-9833482	PKR-mediated signaling
R-HSA-5617833	Cilium Assembly
R-HSA-109582	Hemostasis
R-HSA-112314	Neurotransmitter receptors and postsynaptic signal transmission
R-HSA-112315	Transmission across Chemical Synapses

MSigDB gene sets: 166 (showing top): GOBP_MEIOTIC_CHROMOSOME_SEGREGATION, REACTOME_ADAPTIVE_IMMUNE_SYSTEM, REACTOME_CYTOKINE_SIGNALING_IN_IMMUNE_SYSTEM, GOBP_OOGENESIS, REACTOME_MEMBRANE_TRAFFICKING, GOBP_ANATOMICAL_STRUCTURE_MATURATION, GOBP_ORGANELLE_FISSION, GOBP_CELL_MATURATION, GOBP_ORGANELLE_ASSEMBLY, GOBP_CELLULAR_PROCESS_INVOLVED_IN_REPRODUCTION_IN_MULTICELLULAR_ORGANISM, GOBP_OOCYTE_MATURATION, GOBP_OOCYTE_DIFFERENTIATION, GOBP_MITOTIC_CELL_CYCLE, GOBP_FEMALE_GAMETE_GENERATION, GOBP_DEVELOPMENTAL_PROCESS_INVOLVED_IN_REPRODUCTION

GO Biological Process (6): microtubule cytoskeleton organization (GO:0000226), mitotic cell cycle (GO:0000278), oocyte maturation (GO:0001556), spindle assembly involved in female meiosis (GO:0007056), cytoskeleton organization (GO:0007010), microtubule-based process (GO:0007017)

GO Molecular Function (6): GTPase activity (GO:0003924), structural constituent of cytoskeleton (GO:0005200), GTP binding (GO:0005525), metal ion binding (GO:0046872), nucleotide binding (GO:0000166), protein binding (GO:0005515)

GO Cellular Component (9): cytoplasm (GO:0005737), microtubule (GO:0005874), microtubule cytoskeleton (GO:0015630), intercellular bridge (GO:0045171), extracellular exosome (GO:0070062), mitotic spindle (GO:0072686), meiotic spindle (GO:0072687), spindle (GO:0005819), cytoskeleton (GO:0005856)

Reactome top-level categories

Rollup of top-17 pathways:

Category	Pathways
Mitotic Prometaphase	2
RHO GTPase Effectors	2
Golgi-to-ER retrograde transport	2
Membrane Trafficking	1
Transport of connexons to the plasma membrane	1
Gap junction trafficking	1
Adaptive Immune System	1
Mitotic Anaphase	1
Cellular responses to stress	1
L1CAM interactions	1
Assembly of the 9+0 primary cilium	1
ER to Golgi Anterograde Transport	1
M Phase	1
G2/M Transition	1
Post-translational protein modification	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cytoskeleton organization	2
cytoskeleton	2
cellular anatomical structure	2
microtubule cytoskeleton	2
spindle	2
intracellular membraneless organelle	2
microtubule-based process	1
cell cycle	1
mitotic nuclear division	1
developmental process involved in reproduction	1
cell maturation	1
oocyte development	1
female meiotic nuclear division	1
meiotic spindle assembly	1
organelle organization	1
cellular process	1
ribonucleoside triphosphate phosphatase activity	1
structural molecule activity	1
guanyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
cation binding	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
binding	1
intracellular anatomical structure	1
polymeric cytoskeletal fiber	1
extracellular vesicle	1

Protein interactions and networks

STRING

3794 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TUBB8	TUBA1B	P04687	857
TUBB8	TUBAL3	A6NHL2	809
TUBB8	TUBA4A	P05215	807
TUBB8	TUBA3E	Q6PEY2	807
TUBB8	TUBA3C	P0DPH7	807
TUBB8	TUBA8	Q9NY65	807
TUBB8	TUBA1C	Q9BQE3	807
TUBB8	TUBA1B	P04687	806
TUBB8	PATL2	C9JE40	720
TUBB8	WEE2	P0C1S8	607
TUBB8	TLE6	Q9H808	591
TUBB8	LRRC40	Q9H9A6	524
TUBB8	POLR2E	P19388	498
TUBB8	ISLR	O14498	473
TUBB8	EIF2S3	P41091	468

IntAct

447 interactions, top by confidence:

A	B	Type	Score
PRKAG1	PRKAB2	psi-mi:“MI:0914”(association)	0.940
DNAJB11	HSPA5	psi-mi:“MI:0914”(association)	0.830
CFTR	ESYT2	psi-mi:“MI:0914”(association)	0.710
EFNB3	DENND11	psi-mi:“MI:0914”(association)	0.640
KLK5	DENND11	psi-mi:“MI:0914”(association)	0.640
TUBB	PLD2	psi-mi:“MI:0914”(association)	0.640
FAM174A	BLTP3B	psi-mi:“MI:0914”(association)	0.530
TOR1AIP2	TMEM223	psi-mi:“MI:0914”(association)	0.530
CELA3A	POTEF	psi-mi:“MI:0914”(association)	0.530
LPAR4	POTEF	psi-mi:“MI:0914”(association)	0.530
ANTXR1	POTEF	psi-mi:“MI:0914”(association)	0.530
CD79A	METTL15	psi-mi:“MI:0914”(association)	0.530
VASN	AP3B1	psi-mi:“MI:0914”(association)	0.530
LRP1	NME4	psi-mi:“MI:0914”(association)	0.530
TSPYL6	NME4	psi-mi:“MI:0914”(association)	0.530
HCFC2	SETD1A	psi-mi:“MI:0914”(association)	0.530
ERBB3	SLC31A1	psi-mi:“MI:0914”(association)	0.530
CDH13	INSIG1	psi-mi:“MI:0914”(association)	0.530
TKTL1	DNAJB5	psi-mi:“MI:0914”(association)	0.530
LRIG1	LRIG2	psi-mi:“MI:0914”(association)	0.530
TUBB2B	EML2	psi-mi:“MI:0914”(association)	0.530
WNT7A	LDLR	psi-mi:“MI:0914”(association)	0.530
STK16	FLG	psi-mi:“MI:0914”(association)	0.530
GDF9	MYH11	psi-mi:“MI:0914”(association)	0.530
TTC5	TUBA4A	psi-mi:“MI:0914”(association)	0.530

BioGRID (491): TUBB8 (Affinity Capture-MS), TUBB8 (Affinity Capture-MS), TUBB8 (Affinity Capture-MS), TUBB8 (Affinity Capture-MS), TUBB8 (Affinity Capture-MS), TUBB8 (Affinity Capture-MS), TUBB8 (Affinity Capture-MS), TUBB8 (Affinity Capture-MS), TUBB8 (Affinity Capture-MS), TUBB8 (Affinity Capture-MS), TUBB8 (Affinity Capture-MS), TUBB8 (Affinity Capture-MS), TUBB8 (Affinity Capture-MS), TUBB8 (Affinity Capture-MS), TUBB8 (Affinity Capture-MS)

ESM2 similar proteins: A6NNZ2, P02554, P04350, P07437, P09206, P09244, P09652, P11833, P11857, P14643, P18025, P30156, P61857, P61858, P68371, P69893, P69895, P69897, P83130, P99024, Q08115, Q13509, Q24560, Q27U48, Q2HJ81, Q2KJD0, Q2T9S0, Q3MHM5, Q3ZBU7, Q3ZCM7, Q4QRB4, Q4R4X8, Q5R943, Q60HC2, Q6GLE7, Q6P9T8, Q6VAF4, Q767L7, Q7JJU6, Q7KQL5

Diamond homologs: A2AQ07, A6NNZ2, O04386, O17449, O44388, P02554, P04350, P04690, P07436, P07437, P08841, P09203, P09206, P09207, P09244, P09652, P09653, P10876, P10878, P11482, P11833, P11857, P12456, P13602, P14643, P18241, P20365, P22852, P30883, P32882, P33188, P34108, P36221, P37832, P41352, P41387, P41937, P46265, P50261, P50262

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 252 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Microtubule-dependent trafficking of connexons from Golgi to the plasma membrane	8	27.5×	4e-08
Transport of connexons to the plasma membrane	8	27.5×	4e-08
Activation of AMPK downstream of NMDARs	11	26.5×	8e-11
Gap junction trafficking and regulation	8	24.1×	6e-08
Gap junction trafficking	8	24.1×	6e-08
Post-chaperonin tubulin folding pathway	8	24.1×	6e-08
Formation of tubulin folding intermediates by CCT/TriC	8	21.4×	2e-07
Cooperation of Prefoldin and TriC/CCT in actin and tubulin folding	8	20.6×	2e-07

GO biological processes:

GO term	Partners	Fold	FDR
cytoplasmic microtubule organization	7	10.5×	3e-03
microtubule cytoskeleton organization	11	5.8×	3e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

107 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	12
Likely pathogenic	30
Uncertain significance	35
Likely benign	11
Benign	13

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
221268	NM_177987.3(TUBB8):c.686T>C (p.Val229Ala)	Pathogenic
221269	NM_177987.3(TUBB8):c.1249G>A (p.Asp417Asn)	Pathogenic
221270	NM_177987.3(TUBB8):c.5G>A (p.Arg2Lys)	Pathogenic
223143	NM_177987.3(TUBB8):c.527C>T (p.Ser176Leu)	Pathogenic
223144	NM_177987.3(TUBB8):c.785G>A (p.Arg262Gln)	Pathogenic
223145	NM_177987.3(TUBB8):c.1088T>C (p.Met363Thr)	Pathogenic
223146	NM_177987.3(TUBB8):c.900G>A (p.Met300Ile)	Pathogenic
378059	NM_177987.3(TUBB8):c.713C>T (p.Thr238Met)	Pathogenic
378060	NM_177987.3(TUBB8):c.80_100del (p.Glu27_Ala33del)	Pathogenic
378061	NM_177987.3(TUBB8):c.426dup (p.Thr143fs)	Pathogenic
977667	NM_177987.3(TUBB8):c.1203_1204insCT (p.Gly402fs)	Pathogenic
977673	NM_177987.3(TUBB8):c.722G>A (p.Arg241His)	Pathogenic
3382491	NM_177987.3(TUBB8):c.322G>A (p.Glu108Lys)	Likely pathogenic
4686581	NM_177987.3(TUBB8):c.880T>C (p.Phe294Leu)	Likely pathogenic
4686582	NM_177987.3(TUBB8):c.1030T>A (p.Trp344Arg)	Likely pathogenic
4686583	NM_177987.3(TUBB8):c.404_405dup (p.Thr136Ter)	Likely pathogenic
4845687	NM_177987.3(TUBB8):c.227_228del (p.Val76fs)	Likely pathogenic
684762	NM_177987.3(TUBB8):c.735G>C (p.Gln245His)	Likely pathogenic
694522	NM_177987.3(TUBB8):c.763G>A (p.Val255Met)	Likely pathogenic
977653	NM_177987.3(TUBB8):c.394G>T (p.Gly132Cys)	Likely pathogenic
977654	NM_177987.3(TUBB8):c.422G>C (p.Gly141Ala)	Likely pathogenic
977655	NM_177987.3(TUBB8):c.1189T>G (p.Trp397Gly)	Likely pathogenic
977656	NM_177987.3(TUBB8):c.1163T>C (p.Met388Thr)	Likely pathogenic
977658	NM_177987.3(TUBB8):c.539T>C (p.Val180Ala)	Likely pathogenic
977659	NM_177987.3(TUBB8):c.550A>G (p.Asn184Asp)	Likely pathogenic
977660	NM_177987.3(TUBB8):c.1242C>G (p.Asn414Lys)	Likely pathogenic
977661	NM_177987.3(TUBB8):c.1271A>G (p.Gln424Arg)	Likely pathogenic
977662	NM_177987.3(TUBB8):c.1178C>A (p.Ala393Asp)	Likely pathogenic
977663	NM_177987.3(TUBB8):c.629T>A (p.Ile210Lys)	Likely pathogenic
977664	NM_177987.3(TUBB8):c.136C>T (p.Arg46Cys)	Likely pathogenic

SpliceAI

528 predictions. Top by Δscore:

Variant	Effect	Δscore
10:48175:CA:C	acceptor_gain	1.0000
10:48796:GGTCT:G	donor_loss	1.0000
10:48797:GTCTC:G	donor_loss	1.0000
10:48798:TCTCA:T	donor_loss	1.0000
10:48799:CT:C	donor_loss	1.0000
10:48800:TCA:T	donor_loss	1.0000
10:48801:CA:C	donor_loss	1.0000
10:48802:A:AC	donor_gain	1.0000
10:48802:A:C	donor_loss	1.0000
10:48803:C:CC	donor_gain	1.0000
10:48803:CCG:C	donor_gain	1.0000
10:48908:CAGAA:C	acceptor_gain	1.0000
10:48909:AGAA:A	acceptor_gain	1.0000
10:48910:GAA:G	acceptor_gain	1.0000
10:48910:GAACT:G	acceptor_loss	1.0000
10:48911:AA:A	acceptor_gain	1.0000
10:48911:AAC:A	acceptor_loss	1.0000
10:48912:ACT:A	acceptor_loss	1.0000
10:48913:C:CC	acceptor_gain	1.0000
10:48913:C:T	acceptor_loss	1.0000
10:48916:C:CT	acceptor_gain	1.0000
10:48917:A:T	acceptor_gain	1.0000
10:48923:C:CT	acceptor_gain	1.0000
10:48924:G:T	acceptor_gain	1.0000
10:49405:CACC:C	donor_loss	1.0000
10:49406:ACCT:A	donor_loss	1.0000
10:49407:C:CG	donor_loss	1.0000
10:48110:CTGAC:C	acceptor_gain	0.9900
10:48172:CACCA:C	acceptor_gain	0.9900
10:48176:A:T	acceptor_gain	0.9900

AlphaMissense

2963 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
10:47210:G:C	F394L	0.999
10:47210:G:T	F394L	0.999
10:47212:A:G	F394L	0.999
10:47139:A:G	L418P	0.998
10:47161:C:G	A411P	0.998
10:47666:G:C	F242L	0.998
10:47666:G:T	F242L	0.998
10:47668:A:G	F242L	0.998
10:47888:G:C	S168R	0.998
10:47888:G:T	S168R	0.998
10:47890:T:G	S168R	0.998
10:47956:C:A	G146W	0.998
10:48091:A:G	W101R	0.998
10:48091:A:T	W101R	0.998
10:47237:A:C	F385L	0.997
10:47237:A:T	F385L	0.997
10:47239:A:G	F385L	0.997
10:47840:G:C	N184K	0.997
10:47840:G:T	N184K	0.997
10:47955:C:T	G146E	0.997
10:47962:C:A	G144W	0.997
10:47998:C:G	G132R	0.997
10:48089:C:A	W101C	0.997
10:48089:C:G	W101C	0.997
10:47839:C:G	A185P	0.996
10:47845:A:C	Y183D	0.996
10:48081:C:T	G104E	0.996
10:48082:C:G	G104R	0.996
10:48082:C:T	G104R	0.996
10:48087:G:T	A102D	0.996

dbSNP variants (sampled 300 via entrez): RS10218948 (10:50691 A>G), RS1057520306 (10:47679 G>A,T), RS1057520307 (10:48869 CCAGCGGAGTCGATGGCATGTT>C), RS10751931 (10:50009 C>T), RS10795288 (10:73671 G>A,C), RS10795291 (10:76673 C>G), RS10904032 (10:48086 G>A,T), RS10904041 (10:48298 A>T), RS10904045 (10:48486 C>G,T), RS10904047 (10:48605 C>G,T), RS10904178 (10:54714 A>G), RS10904372 (10:62948 T>A,G), RS10904409 (10:64520 C>A,G), RS10904494 (10:67994 A>C), RS10904505 (10:68368 T>C)

Disease associations

OMIM: gene MIM:616768 | disease phenotypes: MIM:616780, MIM:615774

GenCC curated gene-disease

Disease	Classification	Inheritance
oocyte maturation defect 2	Definitive	Semidominant

Mondo (4): oocyte maturation defect 2 (MONDO:0021573), female infertility (MONDO:0021124), inherited oocyte maturation defect (MONDO:0014769), CIC-rearranged sarcoma (MONDO:0956989)

Orphanet (0):

HPO phenotypes

8 total (8 of 8 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000007	Autosomal recessive inheritance
HP:0000147	Polycystic ovaries
HP:0008222	Female infertility
HP:0008669	Abnormal spermatogenesis
HP:0020155	Abnormal oocyte morphology
HP:0031515	Abnormal meiosis
HP:0031516	Metaphase I oocyte maturation arrest

GWAS associations

0 associations (top):

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D007247	Infertility, Female	C12.050.351.500.498; C12.100.250.498; C12.100.750.350

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (4): CHEMBL2095182 (PROTEIN COMPLEX GROUP), CHEMBL3832942 (PROTEIN FAMILY), CHEMBL4024 (SINGLE PROTEIN), CHEMBL6066847 (PROTEIN-PROTEIN INTERACTION)

Molecules with ChEMBL bioactivity

21 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 1,641,397 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL107	COLCHICINE	4	93,932
CHEMBL159	VINBLASTINE	4	412,636
CHEMBL33	LEVOFLOXACIN ANHYDROUS	4	43,403
CHEMBL3545252	DOCETAXEL	4	1,009
CHEMBL364713	NOSCAPINE	4	14,987
CHEMBL378544	VINBLASTINE SULFATE	4	32,829
CHEMBL428647	PACLITAXEL	4	332,542
CHEMBL5315124	LEVOFLOXACIN	4	189
CHEMBL553025	VINORELBINE	4	142,159
CHEMBL571546	TIRBANIBULIN	4	1,192
CHEMBL61	PODOFILOX	4	37,640
CHEMBL90555	VINCRISTINE	4	268,031
CHEMBL92	DOCETAXEL ANHYDROUS	4	196,686
CHEMBL94657	PATUPILONE	3	14,934
CHEMBL20684	ABT-751	2	2,238
CHEMBL292702	MAYTANSINE	2	9,300
CHEMBL39541	DOLASTATIN-10	2	1,380
CHEMBL49642	INDIBULIN	2	963
CHEMBL528271	PARBENDAZOLE	2	6,102
CHEMBL9514	NOCODAZOLE	2	29,245
CHEMBL246600	COMBRETASTATIN	1

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: other protein — Tubulins

ChEMBL bioactivities

1170 potent at pChembl≥5 of 1321 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
10.26	IC50	0.0551	nM	CHEMBL5194719
9.75	IC50	0.176	nM	CHEMBL5203711
9.51	IC50	0.308	nM	VINORELBINE
9.30	IC50	0.5	nM	DOLASTATIN-10
8.92	IC50	1.2	nM	CHEMBL5169466
8.85	IC50	1.4	nM	CHEMBL4575066
8.74	IC50	1.8	nM	PATUPILONE
8.59	IC50	2.6	nM	CHEMBL2024544
8.52	Ki	3	nM	COMBRETASTATIN A4
8.52	IC50	3	nM	COMBRETASTATIN A4
8.52	IC50	3	nM	DOLASTATIN-10
8.52	Kd	3	nM	CHEMBL5410715
8.52	IC50	3	nM	COLCHICINE
8.46	IC50	3.5	nM	PATUPILONE
8.38	IC50	4.2	nM	CHEMBL5197739
8.27	IC50	5.4	nM	CHEMBL5280519
8.22	IC50	6	nM	CHEMBL498271
8.05	EC50	9	nM	COMBRETASTATIN A4
8.01	EC50	9.8	nM	COMBRETASTATIN A4
8.01	IC50	9.77	nM	CHEMBL4778826
8.00	Ki	10	nM	CHEMBL381852
8.00	IC50	10	nM	CHEMBL204241
7.96	Kd	11	nM	CHEMBL5611905
7.89	IC50	12.9	nM	COMBRETASTATIN A4
7.85	Kd	14	nM	MAYTANSINE
7.70	IC50	20	nM	CHEMBL2369093
7.70	Ki	20	nM	CHEMBL369927
7.70	IC50	20	nM	CHEMBL5183440
7.70	Kd	20	nM	CHEMBL5613121
7.67	Kd	21.5	nM	CHEMBL4797381
7.64	IC50	23	nM	COMBRETASTATIN A4
7.62	EC50	24	nM	CHEMBL4250191
7.60	IC50	25	nM	CHEMBL552462
7.52	IC50	30	nM	CHEMBL381122
7.52	IC50	30	nM	COMBRETASTATIN A4
7.52	IC50	30	nM	CHEMBL203062
7.52	IC50	30	nM	CHEMBL204710
7.51	EC50	31	nM	PACLITAXEL
7.43	Kd	36.9	nM	CHEMBL4756812
7.40	EC50	40	nM	CHEMBL1688184
7.35	EC50	45	nM	CHEMBL4239716
7.34	IC50	46	nM	CHEMBL374257
7.33	Kd	47	nM	CHEMBL5542101
7.30	Ki	50	nM	CHEMBL196966
7.30	EC50	50	nM	CHEMBL1688183
7.30	EC50	50	nM	CHEMBL1688189
7.29	Kd	51	nM	CHEMBL5614306
7.28	EC50	53	nM	CHEMBL4241638
7.24	Kd	58	nM	COLCHICINE
7.22	Ki	60	nM	CHEMBL198522

PubChem BioAssay actives

1098 with measured affinity, of 5889 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
(Z)-1-[4-bromo-2-(4-fluorophenyl)-1-benzofuran-7-yl]-3-(4-methoxyphenyl)prop-2-en-1-one	1882651: Inhibition of tubulin polymerization (unknown origin) measured every 3 secs for 1 hr by spectroflourimetric analysis	ic50	0.0001	uM
(Z)-1-[4-bromo-2-(4-fluorophenyl)-1-benzofuran-7-yl]-3-[4-(trifluoromethoxy)phenyl]prop-2-en-1-one	1882651: Inhibition of tubulin polymerization (unknown origin) measured every 3 secs for 1 hr by spectroflourimetric analysis	ic50	0.0002	uM
Vinorelbine	1993632: Inhibition of tubulin polymerization (unknown origin)	ic50	0.0003	uM
(2S)-2-[[(2S)-2-(dimethylamino)-3-methylbutanoyl]amino]-N-[(3R,4S,5S)-3-methoxy-1-[(2S)-2-[(1R,2R)-1-methoxy-2-methyl-3-oxo-3-[[(1S)-2-phenyl-1-(1,3-thiazol-2-yl)ethyl]amino]propyl]pyrrolidin-1-yl]-5-methyl-1-oxoheptan-4-yl]-N,3-dimethylbutanamide	270819: Inhibition of tubulin polymerization	ic50	0.0005	uM
(2S)-2-[[(2S)-2-(dimethylamino)-3-methylbutanoyl]amino]-N-[(3R,4S,5S)-3-methoxy-1-[(2S)-2-[(1R,2R)-1-methoxy-2-methyl-3-oxo-3-(2-pyridin-2-ylethylamino)propyl]pyrrolidin-1-yl]-5-methyl-1-oxoheptan-4-yl]-N,3-dimethylbutanamide	1896115: Binding affinity to tubulin (unknown origin)	ic50	0.0012	uM
(3Z,6Z)-3-[(5-tert-butyl-1H-imidazol-4-yl)methylidene]-6-phenacylidenepiperazine-2,5-dione	1587857: Inhibition of tubulin polymerization (unknown origin)	ic50	0.0014	uM
(3Z,6Z)-3-[(5-tert-butyl-1H-imidazol-4-yl)methylidene]-6-[(2,5-difluorophenyl)methylidene]piperazine-2,5-dione	1587857: Inhibition of tubulin polymerization (unknown origin)	ic50	0.0026	uM
3-hydroxy-2-[N-[2-(methoxymethyl)-1-benzofuran-7-yl]-C-methylcarbonimidoyl]-5-phenylcyclohex-2-en-1-one	2034736: Displacement of fluorescent probe (R)-(+)-ethyl 5-amino2-methyl-1,2-dihydro-3-phenylpyrido[3,4-b]pyrazin-7-ylcarbamate from tubulin colchicine binding site (unknown origin) assessed as dissociation constant	kd	0.0030	uM
2-methoxy-5-[(Z)-2-(3,4,5-trimethoxyphenyl)ethenyl]phenol	1862628: Inhibition of tubulin polymerization in human HeLa cells assessed as microtubule network polymerization after 30 mins by immunofluorescence analysis	ic50	0.0030	uM
Colchicine	2074087: Inhibition of microtubule polymerization in human K562 cells measured for 60 mins by fluorescence based analysis	ic50	0.0030	uM
(1S,3S,7S,10R,11S,12S,16R)-7,11-dihydroxy-8,8,10,12,16-pentamethyl-3-[(E)-1-(2-methyl-1,3-thiazol-4-yl)prop-1-en-2-yl]-4,17-dioxabicyclo[14.1.0]heptadecane-5,9-dione	1408257: Inhibition of tubulin polymerization in human MCF7 cells assessed as induction of mitotic arrest	ic50	0.0035	uM
tert-butyl (3R,4S,5S)-4-[[(2S)-2-[[(2S)-2-(dimethylamino)-3-methylbutanoyl]amino]-3-methylbutanoyl]-methylamino]-3-methoxy-5-methylheptanoate	1896110: Inhibition of tubulin (unknown origin) polymerization assessed as reduction in microtubule formation measured for 20 mins by spectrophotometric analysis	ic50	0.0042	uM
3-methoxy-6-[4-(3,4,5-trimethoxyphenyl)-1H-pyrazol-5-yl]benzene-1,2-diol	1929685: Inhibition of tubulin polymerization in human SH-SY5Y cells incubated for 24 hrs by SDS-PAGE based analysis	ic50	0.0054	uM
2-methoxy-5-[1-(3,4,5-trimethoxyphenyl)ethenyl]phenol	1862628: Inhibition of tubulin polymerization in human HeLa cells assessed as microtubule network polymerization after 30 mins by immunofluorescence analysis	ic50	0.0060	uM
(E)-1-[1-(4-chlorophenyl)-5-methyltriazol-4-yl]-3-(3,4-dimethoxyphenyl)prop-2-en-1-one	1689700: Inhibition of Tubulin in human RPMI-8226 cells incubated for 2 hrs by ELISA	ic50	0.0098	uM
N-(1,3-benzodioxol-5-yl)-5-[2-(3,5-dimethoxyphenoxy)-3-pyridinyl]-1H-1,2,4-triazol-3-amine	256882: Displacement of [3H]colchicine from tubulin	ki	0.0100	uM
N-(2,3-dihydro-1,4-benzodioxin-6-yl)-5-[2-(pyridin-2-ylmethylamino)phenyl]-1,3-oxazol-2-amine	261214: Displacement of [3H]colchicine from tubulin at 65 nM	ic50	0.0100	uM
[(1S,2R,3S,5R,6S,16E,18E,20R,21S)-11-chloro-21-hydroxy-12,20-dimethoxy-2,5,9,16-tetramethyl-8,23-dioxo-4,24-dioxa-9,22-diazatetracyclo[19.3.1.110,14.03,5]hexacosa-10,12,14(26),16,18-pentaen-6-yl] acetate	2126113: Displacement of fluorescent Maytansine probe from tubulin (unknown origin) assessed as dissociation constant by competitive binding based fluorescence anisotropy	kd	0.0110	uM
[(1S,2R,3S,5S,6S,16E,18E,20R,21S)-11-chloro-21-hydroxy-12,20-dimethoxy-2,5,9,16-tetramethyl-8,23-dioxo-4,24-dioxa-9,22-diazatetracyclo[19.3.1.110,14.03,5]hexacosa-10,12,14(26),16,18-pentaen-6-yl] (2S)-2-[acetyl(methyl)amino]propanoate	2126113: Displacement of fluorescent Maytansine probe from tubulin (unknown origin) assessed as dissociation constant by competitive binding based fluorescence anisotropy	kd	0.0140	uM
N-(2,3-dihydro-1,4-benzodioxin-6-yl)-5-[2-(3,5-dimethoxyphenoxy)-3-pyridinyl]-1H-1,2,4-triazol-3-amine	256882: Displacement of [3H]colchicine from tubulin	ki	0.0200	uM
methyl (13S,15S,17S)-13-[(1R,9R,10S,11R,12R,19R)-10-(1-diethoxyphosphorylhexylcarbamoyl)-12-ethyl-10,11-dihydroxy-5-methoxy-8-methyl-8,16-diazapentacyclo[10.6.1.01,9.02,7.016,19]nonadeca-2,4,6,13-tetraen-4-yl]-17-ethyl-17-hydroxy-1,11-diazatetracyclo[13.3.1.04,12.05,10]nonadeca-4(12),5,7,9-tetraene-13-carboxylate	214333: The compound tested for the inhibition of tubulin polymerization.	ic50	0.0200	uM
(E)-3-[5-[(2-cyanoquinolin-4-yl)-methylamino]-2-methoxyphenyl]-N-hydroxyprop-2-enamide	1862628: Inhibition of tubulin polymerization in human HeLa cells assessed as microtubule network polymerization after 30 mins by immunofluorescence analysis	ic50	0.0200	uM
[(1S,2R,3S,5R,6S,16E,18E,20R,21S)-11-chloro-21-hydroxy-12,20-dimethoxy-2,5,9,16-tetramethyl-8,23-dioxo-4,24-dioxa-9,22-diazatetracyclo[19.3.1.110,14.03,5]hexacosa-10,12,14(26),16,18-pentaen-6-yl] hept-6-ynoate	2126113: Displacement of fluorescent Maytansine probe from tubulin (unknown origin) assessed as dissociation constant by competitive binding based fluorescence anisotropy	kd	0.0200	uM
(3S)-3-[(5R)-6-[[1-(4-fluorophenyl)triazol-4-yl]methyl]-4-methoxy-7,8-dihydro-5H-[1,3]dioxolo[4,5-g]isoquinolin-5-yl]-6,7-dimethoxy-3H-2-benzofuran-1-one	1675128: Binding affinity to CM5 chip immobilized beta tubulin (unknown origin) assessed as thermodynamic constants by SPR assay	kd	0.0215	uM
N-(4-methoxyphenyl)-N,5-dimethylfuro[2,3-d]pyrimidin-4-amine	1635267: Induction of microtubule depolymerization in human A10 cells incubated for 18 hrs by indirect immunofluorescence analysis	ec50	0.0240	uM
[4-amino-2-(4-methoxyanilino)-1,3-thiazol-5-yl]-(3,4-dimethoxyphenyl)methanone	1674862: Binding affinity to beta tubulin in HEK293 cells assessed as disruption of microtubule polymerization by ITDRF-CETSA assay	ic50	0.0250	uM
N-(2,3-dihydro-1,4-benzodioxin-6-yl)-5-[2-(pyridin-3-ylmethylamino)-3-pyridinyl]-1,3,4-oxadiazol-2-amine	261214: Displacement of [3H]colchicine from tubulin at 65 nM	ic50	0.0300	uM
N-(1,3-benzodioxol-5-yl)-5-[2-(pyridin-4-ylmethylamino)-3-pyridinyl]-1,3,4-oxadiazol-2-amine	261214: Displacement of [3H]colchicine from tubulin at 65 nM	ic50	0.0300	uM
N-(1,3-benzodioxol-5-yl)-5-[2-(pyridin-2-ylmethylamino)-3-pyridinyl]-1,3,4-oxadiazol-2-amine	261214: Displacement of [3H]colchicine from tubulin at 65 nM	ic50	0.0300	uM
Paclitaxel	260235: Effect on induction of mitotic arrest by phosphohistone H3 (pH3) assay	ec50	0.0310	uM
(3S)-3-[(5R)-9-bromo-6-[[1-(4-bromophenyl)triazol-4-yl]methyl]-4-methoxy-7,8-dihydro-5H-[1,3]dioxolo[4,5-g]isoquinolin-5-yl]-6,7-dimethoxy-3H-2-benzofuran-1-one	1675128: Binding affinity to CM5 chip immobilized beta tubulin (unknown origin) assessed as thermodynamic constants by SPR assay	kd	0.0369	uM
6-(3-chloro-6,11,11-trioxobenzo[b][1,4]benzothiazepin-5-yl)-N-hydroxyhexanamide	580932: Inhibition of HDAC activity in human NB4 cells assessed as acetylated tubulin after 24 hrs by Western blot analysis	ec50	0.0400	uM
N,5-dimethyl-N-(4-methylsulfanylphenyl)furo[2,3-d]pyrimidin-4-amine	1635267: Induction of microtubule depolymerization in human A10 cells incubated for 18 hrs by indirect immunofluorescence analysis	ec50	0.0450	uM
[7-(3-hydroxyprop-1-ynyl)-6-methoxy-2H-indazol-3-yl]-(3,4,5-trimethoxyphenyl)methanone	280080: Displacement of [3H]colchicine from tubulin in MCF7 cells	ic50	0.0460	uM
(3S,10R,13E,16S)-10-[(3-chloro-4-methoxyphenyl)methyl]-6,6-dimethyl-3-(2-methylpropyl)-16-[(1S)-1-[(2R,3S)-3-phenyloxiran-2-yl]ethyl]-1,4-dioxa-8,11-diazacyclohexadec-13-ene-2,5,9,12-tetrone	2061859: Binding affinity to tubulin (unknown origin) assessed as dissociation constant by SPR analysis	kd	0.0470	uM
N-hydroxy-6-(3-methoxy-6,11,11-trioxobenzo[b][1,4]benzothiazepin-5-yl)hexanamide	580932: Inhibition of HDAC activity in human NB4 cells assessed as acetylated tubulin after 24 hrs by Western blot analysis	ec50	0.0500	uM
N-hydroxy-6-(6,11,11-trioxobenzo[b][1,4]benzothiazepin-5-yl)hexanamide	580932: Inhibition of HDAC activity in human NB4 cells assessed as acetylated tubulin after 24 hrs by Western blot analysis	ec50	0.0500	uM
5-[2-(3,5-dimethoxyphenoxy)-3-pyridinyl]-N-(3-methoxyphenyl)-1H-1,2,4-triazol-3-amine	256882: Displacement of [3H]colchicine from tubulin	ki	0.0500	uM
[(1S,2R,3S,5R,6S,16E,18E,20R,21S)-11-chloro-21-hydroxy-12,20-dimethoxy-2,5,9,16-tetramethyl-8,23-dioxo-4,24-dioxa-9,22-diazatetracyclo[19.3.1.110,14.03,5]hexacosa-10,12,14(26),16,18-pentaen-6-yl] benzoate	2126113: Displacement of fluorescent Maytansine probe from tubulin (unknown origin) assessed as dissociation constant by competitive binding based fluorescence anisotropy	kd	0.0510	uM
N-ethyl-N-(4-methoxyphenyl)-5-methylfuro[2,3-d]pyrimidin-4-amine	1635267: Induction of microtubule depolymerization in human A10 cells incubated for 18 hrs by indirect immunofluorescence analysis	ec50	0.0530	uM
3-[3-(1,3-benzodioxol-5-ylamino)-1H-1,2,4-triazol-5-yl]-N-(3,5-dimethoxyphenyl)pyridin-2-amine	256882: Displacement of [3H]colchicine from tubulin	ki	0.0600	uM
Vinblastine	214333: The compound tested for the inhibition of tubulin polymerization.	ic50	0.0700	uM
methyl (13S,15S,17S)-13-[(1R,9R,10S,11R,12R,19R)-10-[(1-diethoxyphosphoryl-2-phenylethyl)carbamoyl]-12-ethyl-10,11-dihydroxy-5-methoxy-8-methyl-8,16-diazapentacyclo[10.6.1.01,9.02,7.016,19]nonadeca-2,4,6,13-tetraen-4-yl]-17-ethyl-17-hydroxy-1,11-diazatetracyclo[13.3.1.04,12.05,10]nonadeca-4(12),5,7,9-tetraene-13-carboxylate	214333: The compound tested for the inhibition of tubulin polymerization.	ic50	0.0700	uM
N-(2,3-dihydro-1,4-benzodioxin-6-yl)-5-[3-(pyridin-2-ylmethylamino)thiophen-2-yl]-1,3,4-oxadiazol-2-amine	261214: Displacement of [3H]colchicine from tubulin at 65 nM	ic50	0.0750	uM
methyl (13S,15S,17S)-13-[(1R,9R,10S,11R,12R,19R)-10-[[(1S)-1-diethoxyphosphorylethyl]carbamoyl]-12-ethyl-10,11-dihydroxy-5-methoxy-8-methyl-8,16-diazapentacyclo[10.6.1.01,9.02,7.016,19]nonadeca-2,4,6,13-tetraen-4-yl]-17-ethyl-17-hydroxy-1,11-diazatetracyclo[13.3.1.04,12.05,10]nonadeca-4(12),5,7,9-tetraene-13-carboxylate	214333: The compound tested for the inhibition of tubulin polymerization.	ic50	0.0800	uM
4-methoxy-2-[(Z)-2-(3,4,5-trimethoxyphenyl)ethenyl]thiophene	1267532: Inhibition of Tubulin polymerization in human HeLa cells assessed as decrease in dynamic tyrosinated microtubules after 2 hrs by microplate reader analysis	ec50	0.0810	uM
N-[2-[[(E)-(2,4-dihydroxyphenyl)methylideneamino]carbamoyl]phenyl]furan-2-carboxamide	1882654: Inhibition of tubulin polymerization (unknown origin)	ic50	0.0876	uM
N-hydroxy-6-(3-methoxy-6-oxobenzo[b][1,4]benzoxazepin-5-yl)hexanamide	580932: Inhibition of HDAC activity in human NB4 cells assessed as acetylated tubulin after 24 hrs by Western blot analysis	ec50	0.0900	uM
N-(3,5-dimethoxyphenyl)-3-[3-(3-methoxyanilino)-1H-1,2,4-triazol-5-yl]pyridin-2-amine	256882: Displacement of [3H]colchicine from tubulin	ki	0.1000	uM
methyl (13S,15S,17S)-13-[(1R,9R,10S,11R,12R,19R)-10-[[(1R)-1-diethoxyphosphoryl-2-(1H-indol-3-yl)ethyl]carbamoyl]-12-ethyl-10,11-dihydroxy-5-methoxy-8-methyl-8,16-diazapentacyclo[10.6.1.01,9.02,7.016,19]nonadeca-2,4,6,13-tetraen-4-yl]-17-ethyl-17-hydroxy-1,11-diazatetracyclo[13.3.1.04,12.05,10]nonadeca-4(12),5,7,9-tetraene-13-carboxylate	214333: The compound tested for the inhibition of tubulin polymerization.	ic50	0.1000	uM

CTD chemical–gene interactions

30 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	increases expression, affects cotreatment, decreases expression	2
Benzo(a)pyrene	affects methylation, decreases expression	2
bisphenol F	affects cotreatment, decreases expression	1
propionaldehyde	increases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
sodium arsenite	increases abundance, increases expression	1
manganese chloride	increases abundance, increases expression	1
epigallocatechin gallate	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
nutlin 3	affects cotreatment, increases secretion	1
LDN 193189	affects cotreatment, increases expression	1
theaflavin-3,3’-digallate	affects expression	1
Leflunomide	decreases expression	1
Arsenic	increases abundance, increases expression	1
Cadmium	increases abundance, increases expression	1
Caffeine	increases expression	1
Clozapine	increases expression	1
Dactinomycin	affects cotreatment, increases secretion	1
Dexamethasone	affects cotreatment, decreases expression	1
Indomethacin	affects cotreatment, decreases expression	1
Ivermectin	decreases expression	1
Malathion	decreases expression	1
Manganese	increases abundance, increases expression	1
Tunicamycin	decreases expression	1
Valproic Acid	increases methylation	1
1-Methyl-3-isobutylxanthine	affects cotreatment, decreases expression	1
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	increases expression	1
Cadmium Chloride	increases expression, increases abundance	1
Thapsigargin	decreases expression	1
Permethrin	decreases expression	1

ChEMBL screening assays

1757 unique, capped per target: 1717 binding, 34 functional, 6 admet

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1009021	Binding	Inhibition of tubulin polymerization in human MCF7 cells at 1 uM after 2 hrs by SDS-PAGE	A new cytotoxic epothilone from modified polyketide synthases heterologously expressed in Myxococcus xanthus. — J Nat Prod
CHEMBL4146506	ADMET	Inhibition of tubulin polymerization in human HaCaT cells assessed as chromatin condensation at 1 uM after 24 hrs by Hoechst 33258 staining-based fluorescence microscopic analysis	Design, synthesis, and biological evaluation of novel combretastatin A-4 thio derivatives as microtubule targeting agents. — Eur J Med Chem
CHEMBL5056161	Functional	Inhibition of tubulin polymerization (unknown origin) assessed as fluorescence intensity measured for 90 mins by DAPI based microplate reader	Design, synthesis and biological evaluation of indole-based [1,2,4]triazolo[4,3-a] pyridine derivatives as novel microtubule polymerization inhibitors. — Eur J Med Chem

Clinical trials (associated diseases)

109 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT01577472	PHASE4	COMPLETED	Efficacy Study Comparing the Effect of Clomiphencitrate to an Antagonist Protocol
NCT01791751	PHASE4	COMPLETED	Impact of Clomiphene Citrate Administration During the Early Luteal Phase on Endocrine Profile in IVF Cycles
NCT02070198	PHASE4	UNKNOWN	Long Acting FSH Plus Antagonist Versus Daily FSH Plus Antagonist Versus Short Agonist Protocol in Poor Responders Undergoing IVF
NCT02328924	PHASE4	COMPLETED	There is a Value of Luteinizing Hormone Predictive of in Vitro Fertilization Treatment Outcome in Antagonist Protocols?
NCT03057574	PHASE4	UNKNOWN	Gonapure® in Multifollicular Stimulation in Egyptian Women Undergoing IVF/ICSI
NCT05197374	PHASE4	COMPLETED	Effect of Estradiol Pretreatment on Antagonist ICSI Cycles
NCT05281341	PHASE4	COMPLETED	Effect of GH Administration in Poor Responders Undergoing Intracytoplasmic Sperm Injection (ICSI)
NCT05286554	PHASE4	COMPLETED	Addition of Gonadotropin Releasing Hormone Agonist to Luteal Phase Support
NCT05608590	PHASE4	UNKNOWN	What is the Best Moment for Performing an HSG in Women With a Unfulfilled Childwish
NCT05753098	PHASE4	COMPLETED	Effect of Sildenafil Citrate Compared to Estrogen as Adjuvant Therapy for Unexplained Infertility
NCT06434233	PHASE4	RECRUITING	Opioid Use After Laparoscopic Salpingectomy
NCT06684951	PHASE4	COMPLETED	Effects of Intrauterine Flushing With Human Chorionic Gonadotropin on ICSI Outcome
NCT06921395	PHASE4	RECRUITING	Phase IV Study to Evaluate the Efficacy and Safety of Fang Le Shu Compared to Guo Na Fen for Controlled Ovarian Stimulation in Infertile Women Undergoing in Vitro Fertilization-embryo Transfer (IVF-ET).
NCT01850030	PHASE3	COMPLETED	A Multicenter Study Comparing the Efficacy, Safety and Tolerability of Oral Dydrogesterone 30 mg Daily Versus Intravaginal Micronized Progesterone Capsules 600 mg Daily for Luteal Support in In-Vitro Fertilization
NCT02175498	PHASE3	COMPLETED	Effectiveness of Homeopathic Treatment in Female Infertility
NCT02491437	PHASE3	COMPLETED	A Study Comparing the Efficacy, Safety and Tolerability of Oral Dydrogesterone 30 mg Daily Versus Crinone 8% Intravaginal Progesterone Gel 90 mg Daily for Luteal Support in In-Vitro Fertilization (LOTUS II)
NCT03429621	PHASE3	COMPLETED	Effect of Simethicone on Reducing Bowel Interference During Tubal Resection
NCT03542331	PHASE3	UNKNOWN	Endometrial Effects of Lipiodol
NCT03767569	PHASE3	UNKNOWN	Myo-inositol as Pretreatment in Hyperandrogenic PCOS Patients
NCT03862586	PHASE3	COMPLETED	NAC Effect on Hox Genes Expressions in RIF
NCT05266924	PHASE3	UNKNOWN	Recombinant Follicle-stimulating Hormone in Treatment for Infertility
NCT05460858	PHASE3	UNKNOWN	NAC Effect on Infertile Women With Endometrioma
NCT02389244	PHASE2	ACTIVE_NOT_RECRUITING	A Phase II Study Evaluating Efficacy and Safety of Regorafenib in Patients With Metastatic Bone Sarcomas
NCT01354886	PHASE1	COMPLETED	Single Dose FSH-GEX™ in Healthy Volunteers
NCT01477073	PHASE1	COMPLETED	Multiple Dose FSH-GEX(TM) in Healthy Volunteers
NCT01604044	PHASE1	COMPLETED	Highly Purified Menotropin (HP-hMG) Versus Recombinant FSH (rFSH) Plus Recombinant LH (rLH) in Intrauterine Insemination Cycles in Women ≥35 Years: a Prospective Randomized Trial.
NCT03755037	PHASE1	COMPLETED	Clomiphene Citrate, Estradiol and Sildenafil for Induction of Ovulation in Unexplained Infertility
NCT06599528	PHASE1	RECRUITING	A Comparing Study Between SJ04 and Ovidrel® in Healthy Subjects
NCT06414434	PHASE1	ACTIVE_NOT_RECRUITING	BTX-A51 in Patients With Liposarcoma or CIC-rearranged Sarcoma
NCT02237755	PHASE2/PHASE3	UNKNOWN	Clomiphene Citrate in Combination With Gonadotropins for Ovarian Stimulation in Women With Poor Ovarian Response.
NCT02237781	PHASE2/PHASE3	UNKNOWN	Levels of Anti-Mullerian Hormone (AMH) During Ovarian Stimulation With Gonadotropins
NCT02741102	PHASE2/PHASE3	RECRUITING	Uterine Transplant in Absolute Uterine Infertility (AUIF)
NCT03881904	PHASE1/PHASE2	UNKNOWN	OCP Pretreatment in PCOS Patients Undergoing ICSI Using Antagonist Protocol
NCT04071574	PHASE1/PHASE2	COMPLETED	Comparative Study on the Efficacy of Ovarian Stimulation Protocols on the Success Rate of ICSI in Female Infertility
NCT06896747	PHASE1/PHASE2	RECRUITING	Evaluating Mechanically Engineered Stem Cell Exosomes for Treating Endometrial Injury: A Clinical Study
NCT03237117	EARLY_PHASE1	UNKNOWN	Effect of Growth Hormone on Uterine Receptivity in Women With RIF in an Oocyte Donation Program
NCT06778733	EARLY_PHASE1	COMPLETED	Effectiveness of Low Dose Gonadotropin Stimulation Protocol Vs High Dose Gonadotropin Protocol in Poor Responders
NCT00119925	Not specified	UNKNOWN	‘SPRING’-Study: Subfertility Guidelines: Patient Related Implementation in the Netherlands Among Gynaecologists
NCT00315029	Not specified	COMPLETED	Patient-Centered Implementation Trial for Single Embryo Transfer
NCT01331395	Not specified	TERMINATED	Effect of Traditional Chinese Medicine on In Vitro Fertilization (IVF) Success Rates