TYMS

Summary

TYMS (thymidylate synthetase, HGNC:12441) is a protein-coding gene on chromosome 18p11.32, encoding Thymidylate synthase (P04818). Catalyzes the reductive methylation of 2’-deoxyuridine 5’-monophosphate (dUMP) to thymidine 5’-monophosphate (dTMP), using the cosubstrate, 5,10- methylenetetrahydrofolate (CH2H4folate) as a 1-carbon donor and reductant and contributes to the mitochondrial and nuclear de novo th…. In precision oncology, TYMS Underexpression confers sensitivity to Pemetrexed in Lung Non-small Cell Carcinoma (CIViC Level B); 7 further curated variant–drug associations are listed below. It is a selective cancer dependency (DepMap: 50.8% of cell lines).

Thymidylate synthase catalyzes the methylation of deoxyuridylate to deoxythymidylate using, 10-methylenetetrahydrofolate (methylene-THF) as a cofactor. This function maintains the dTMP (thymidine-5-prime monophosphate) pool critical for DNA replication and repair. The enzyme has been of interest as a target for cancer chemotherapeutic agents. It is considered to be the primary site of action for 5-fluorouracil, 5-fluoro-2-prime-deoxyuridine, and some folate analogs. Expression of this gene and that of a naturally occurring antisense transcript, mitochondrial enolase superfamily member 1 (GeneID:55556), vary inversely when cell-growth progresses from late-log to plateau phase. Polymorphisms in this gene may be associated with etiology of neoplasia, including breast cancer, and response to chemotherapy.

Source: NCBI Gene 7298 — RefSeq curated summary.

At a glance

• GWAS associations: 10
• Clinical variants (ClinVar): 41 total — 5 pathogenic
• Regional missense constraint (gnomAD): 1 of 3 regions constrained (≈9% of expected missense variation)
• Expression (HPA): Tissue enhanced — highest in thymus, bone marrow, tonsil
• GTEx eGene: eQTL in 18 tissues, sQTL in 3 (q < 0.05)
• Phenotypes (HPO): 84
• Drug target: yes — 9 curated mechanism-of-action drugs; 9 molecules with ChEMBL bioactivity
• Approved drugs (ChEMBL mechanism of action): 6 — Capecitabine, Floxuridine, Fluorouracil, +3 more
• Precision-oncology evidence (CIViC): 8 curated variant–drug associations
• Cancer dependency (DepMap): dependent in 50.8% of screened cell lines
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 0.88 (unconstrained)
• MANE Select transcript: NM_001071
• Interaction hub: 3,392 STRING partners (top 2% of genes corpus-wide)

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:12441
Approved symbol	TYMS
Name	thymidylate synthetase
Location	18p11.32
Locus type	gene with protein product
Status	Approved
Aliases	Tsase, TMS, HsT422
Ensembl gene	ENSG00000176890
Ensembl biotype	protein_coding
OMIM	188350
Entrez	7298

Gene structure

Transcript identifiers

Ensembl transcripts: 14 — 7 protein_coding, 4 nonsense_mediated_decay, 2 protein_coding_CDS_not_defined, 1 retained_intron

MANE Select: ENST00000323274

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 3, TSL 2: 1, TSL 4: 1, TSL 5: 1

ENST00000323274, ENST00000323224, ENST00000323250, ENST00000579128, ENST00000581920, ENST00000584122, ENST00000918013, ENST00000918014, ENST00001086243, ENST00001086244, ENST00001086246, ENST00001086247, ENST00001086248, ENST00001131929

RefSeq mRNA: 3 — MANE Select: NM_001071 NM_001071, NM_001354867, NM_001354868

CCDS: CCDS11821, CCDS86658, CCDS86659

Canonical transcript exons

ENST00000323274 — 7 exons

Exon	Start	End
ENSE00001753233	657653	657947
ENSE00002689316	672860	673578
ENSE00003483247	662146	662320
ENSE00003511087	671380	671451
ENSE00003521550	670692	670867
ENSE00003556949	659641	659714
ENSE00003679046	669072	669173

Expression profiles

Bgee: expression breadth ubiquitous, 262 present calls, max score 98.54.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 40.8936 / max 411.1924, expressed in 1722 samples.

Highest expression (Bgee): ventricular zone, embryo, trabecular bone tissue, ganglionic eminence, secondary oocyte.

Genetic regulation across tissues (GTEx eQTL / sQTL)

TYMS is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 18 tissues and its splicing (sQTL) in 3 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 21 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Esophagus Muscularis	eqtl	5.6e-24	+0.50	18:673443:TTTAAAG:T
Testis	eqtl	2.8e-18	-0.24	18:671520:C:T
Esophagus Gastroesophageal Junction	eqtl	2.4e-12	+0.46	18:665156:T:C
Cells EBV-transformed lymphocytes	eqtl	2.6e-12	-0.24	18:658423:A:G
Esophagus Mucosa	eqtl	2.7e-08	-0.14	18:658423:A:G
Skin Not Sun Exposed Suprapubic	eqtl	3.2e-08	-0.19	18:658423:A:G
Skin Sun Exposed Lower leg	eqtl	1.7e-07	-0.16	18:658423:A:G
Whole Blood	eqtl	2.1e-06	-0.10	18:658423:A:G
Testis	sqtl	6.8e-06	-1.10	18:658170:G:T
Pituitary	eqtl	1.4e-04	-0.35	18:672043:A:G
Brain Hippocampus	eqtl	2.2e-04	+0.28	18:688139:T:C
Cells Cultured fibroblasts	eqtl	6.1e-04	+0.11	18:658332:C:T
Artery Aorta	eqtl	1.0e-03	+0.33	18:658332:C:T
Brain Caudate basal ganglia	eqtl	1.3e-03	+0.24	18:642307:T:C
Muscle Skeletal	eqtl	8.2e-03	-0.25	18:940478:G:T
Esophagus Mucosa	sqtl	1.0e-02	+0.31	18:676789:A:T
Brain Anterior cingulate cortex BA24	eqtl	1.4e-02	-1.41	18:591076:G:A
Nerve Tibial	eqtl	1.6e-02	-0.16	18:455588:C:T
Brain Putamen basal ganglia	eqtl	2.2e-02	+0.22	18:645947:C:A
Colon Transverse	eqtl	2.4e-02	-0.17	18:657458:A:G

FANTOM5 promoters

8 alternative TSS:

Promoter ID	TPM avg	Samples expressed
169059	32.3914	1630
169058	4.6952	1211
169057	1.8816	961
169061	0.9502	629
169060	0.6055	398
169065	0.2589	119
169063	0.0763	11
169062	0.0345	6

Top tissues by expression

showing 100 of 289 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
ventricular zone	UBERON:0003053	98.54	gold quality
embryo	UBERON:0000922	98.49	gold quality
trabecular bone tissue	UBERON:0002483	98.33	gold quality
ganglionic eminence	UBERON:0004023	98.06	gold quality
secondary oocyte	CL:0000655	97.51	gold quality
bone marrow	UBERON:0002371	96.37	gold quality
endometrium epithelium	UBERON:0004811	95.85	gold quality
adult organism	UBERON:0007023	95.64	gold quality
oocyte	CL:0000023	95.12	gold quality
cartilage tissue	UBERON:0002418	94.94	gold quality
mucosa of transverse colon	UBERON:0004991	94.57	gold quality
left testis	UBERON:0004533	94.48	gold quality
right testis	UBERON:0004534	94.33	gold quality
rectum	UBERON:0001052	93.97	gold quality
testis	UBERON:0000473	93.70	gold quality
tibia	UBERON:0000979	93.66	gold quality
ileal mucosa	UBERON:0000331	93.60	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	93.55	gold quality
vermiform appendix	UBERON:0001154	93.32	gold quality
bone marrow cell	CL:0002092	93.21	gold quality
colonic mucosa	UBERON:0000317	92.99	gold quality
mucosa of sigmoid colon	UBERON:0004993	92.90	gold quality
thymus	UBERON:0002370	92.77	gold quality
stromal cell of endometrium	CL:0002255	92.74	gold quality
oral cavity	UBERON:0000167	92.06	gold quality
amniotic fluid	UBERON:0000173	91.96	gold quality
caecum	UBERON:0001153	91.92	gold quality
esophagus squamous epithelium	UBERON:0006920	91.80	gold quality
placenta	UBERON:0001987	91.15	gold quality
epithelium of esophagus	UBERON:0001976	91.14	gold quality
gingival epithelium	UBERON:0001949	90.65	gold quality
tongue squamous epithelium	UBERON:0006919	90.48	gold quality
gingiva	UBERON:0001828	90.12	gold quality
pharyngeal mucosa	UBERON:0000355	89.57	gold quality
epithelium of nasopharynx	UBERON:0001951	89.03	gold quality
esophagus mucosa	UBERON:0002469	89.03	gold quality
squamous epithelium	UBERON:0006914	88.97	gold quality
lymph node	UBERON:0000029	88.59	gold quality
duodenum	UBERON:0002114	88.38	gold quality
sperm	CL:0000019	87.93	gold quality
male germ cell	CL:0000015	87.58	gold quality
jejunal mucosa	UBERON:0000399	87.54	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	87.47	gold quality
endometrium	UBERON:0001295	87.35	gold quality
buccal mucosa cell	CL:0002336	87.10	gold quality
smooth muscle tissue	UBERON:0001135	85.94	gold quality
transverse colon	UBERON:0001157	85.06	gold quality
tonsil	UBERON:0002372	84.65	gold quality
mammalian vulva	UBERON:0000997	84.44	gold quality
periodontal ligament	UBERON:0008266	84.36	gold quality
visceral pleura	UBERON:0002401	84.27	gold quality
pleura	UBERON:0000977	84.24	gold quality
small intestine Peyer’s patch	UBERON:0003454	84.14	gold quality
parietal pleura	UBERON:0002400	84.08	gold quality
small intestine	UBERON:0002108	83.94	gold quality
right uterine tube	UBERON:0001302	83.84	gold quality
nephron tubule	UBERON:0001231	83.74	gold quality
lower esophagus mucosa	UBERON:0035834	83.30	gold quality
spleen	UBERON:0002106	83.26	gold quality
intestine	UBERON:0000160	83.03	gold quality
pylorus	UBERON:0001166	82.99	gold quality
corpus callosum	UBERON:0002336	82.78	gold quality
oviduct epithelium	UBERON:0004804	82.67	gold quality
esophagus	UBERON:0001043	82.62	gold quality
large intestine	UBERON:0000059	82.59	gold quality
pancreatic ductal cell	CL:0002079	82.51	silver quality
metanephros	UBERON:0000081	82.28	gold quality
colon	UBERON:0001155	82.12	gold quality
hair follicle	UBERON:0002073	81.86	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	81.49	gold quality
upper leg skin	UBERON:0004262	81.15	gold quality
putamen	UBERON:0001874	81.11	gold quality
cervix epithelium	UBERON:0004801	81.00	gold quality
vagina	UBERON:0000996	80.88	gold quality
germinal epithelium of ovary	UBERON:0001304	80.85	gold quality
mouth mucosa	UBERON:0003729	80.82	gold quality
adrenal tissue	UBERON:0018303	80.70	gold quality
uterus	UBERON:0000995	80.53	gold quality
female reproductive system	UBERON:0000474	80.45	gold quality
jejunum	UBERON:0002115	80.31	gold quality
spinal cord	UBERON:0002240	80.14	gold quality
inferior olivary complex	UBERON:0002127	80.11	gold quality
cortex of kidney	UBERON:0001225	80.09	gold quality
descending thoracic aorta	UBERON:0002345	79.99	gold quality
palpebral conjunctiva	UBERON:0001812	79.89	gold quality
body of pancreas	UBERON:0001150	79.77	gold quality
zone of skin	UBERON:0000014	79.68	gold quality
minor salivary gland	UBERON:0001830	79.62	gold quality
right adrenal gland	UBERON:0001233	79.60	gold quality
skin of abdomen	UBERON:0001416	79.48	gold quality
fallopian tube	UBERON:0003889	79.44	gold quality
adult mammalian kidney	UBERON:0000082	79.34	gold quality
kidney	UBERON:0002113	79.32	gold quality
ectocervix	UBERON:0012249	79.31	gold quality
skin of leg	UBERON:0001511	79.18	gold quality
body of stomach	UBERON:0001161	79.14	gold quality
metanephros cortex	UBERON:0010533	79.04	gold quality
right adrenal gland cortex	UBERON:0035827	78.96	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	78.94	gold quality
nasal cavity mucosa	UBERON:0001826	78.62	gold quality

Single-cell (SCXA)

Detected in 48 experiment(s), a significant marker in 45.

Experiment	Marker?	Max mean expression
E-HCAD-6	yes	920.59
E-MTAB-8221	yes	802.15
E-MTAB-10432	yes	797.80
E-MTAB-9906	yes	796.41
E-MTAB-10662	yes	792.53
E-MTAB-11121	yes	784.44
E-MTAB-10485	yes	713.90
E-MTAB-6505	yes	698.18
E-GEOD-114530	yes	691.97
E-HCAD-15	yes	684.48
E-MTAB-9435	yes	662.89
E-MTAB-10553	yes	641.49
E-MTAB-8894	yes	637.77
E-MTAB-8142	yes	625.19
E-GEOD-149689	yes	561.00

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 77 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Thymus	tissue	105.9
Bone marrow	tissue	83.5	high
Tonsil	tissue	41.6	high
Lymph node	tissue	33.7	high
Testis	tissue	32.1	high
Rectum	tissue	25.5	medium
Appendix	tissue	22.8	medium
Colon	tissue	21.5	low
Placenta	tissue	21.0	low
Small intestine	tissue	14.0	low
Smooth muscle	tissue	11.8	low
Liver	tissue	11.1	not detected
Duodenum	tissue	9.9	low
Esophagus	tissue	8.5	low
Stomach 1	tissue	8.3	medium
Urinary bladder	tissue	7.9	low
Ovary	tissue	7.8	not detected
Breast	tissue	6.3	low
Nucleus accumbens	tissue	6.1
Kidney	tissue	6.1	low
Skin 1	tissue	5.8	low
Spleen	tissue	5.3	low
Fallopian tube	tissue	5.3	not detected
Olfactory bulb	tissue	5.0
Vagina	tissue	4.9	not detected
Endometrium 1	tissue	4.8	not detected
Cerebellum	tissue	4.4
Adipose tissue	tissue	4.2	not detected
Retina	tissue	3.9
Cervix	tissue	3.5	low
Gallbladder	tissue	3.5	medium
Hippocampus	tissue	3.5	low
Lung	tissue	3.3	low
Prostate	tissue	2.9	not detected
Locus coeruleus	tissue	2.8
Pancreas	tissue	2.3	low
Postcentral gyrus	tissue	2.0
Seminal vesicle	tissue	1.8	low
Parathyroid gland	tissue	1.7	low
Thyroid gland	tissue	1.5	not detected
Choroid plexus	tissue	1.3
Spinal cord	tissue	1.3
Epididymis	tissue	1.2	low
Superior colliculi	tissue	1.2
Adrenal gland	tissue	1.2	low
Salivary gland	tissue	1.1	not detected
Pons	tissue	1.0
Substantia nigra	tissue	1.0
Medulla oblongata	tissue	0.9
Thalamus	tissue	0.9
Hippocampal formation	tissue	0.8
Heart muscle	tissue	0.7	not detected
Midbrain	tissue	0.7
Pituitary gland	tissue	0.6
Amygdala	tissue	0.6
Hypothalamus	tissue	0.6
Ventral forebrain	tissue	0.6
Caudate putamen	tissue	0.6
Cerebral cortex	tissue	0.5	medium
Frontal cortex	tissue	0.5

Brain sub-regions (HPA Brain Atlas): detected in 191; highest nTPM — Corpus callosum, genu (white matter) (17.9), Area striata (white matter) (15.6), Temporal white matter (14.0), Parieto-temporal junction (white matter) (13.7), Parahippocampal cortex (white matter) (13.5).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): APBB2, APBB3, CHD8, E2F1, E2F4, ESR1, MYC, NFE2, SMARCA1, SP1, TFCP2, TFDP1, TP53, USF1, YBX1

miRNA regulators (miRDB)

Targeting TYMS by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

17 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-3688-3P	99.97	72.02	2834
HSA-MIR-9983-3P	99.94	71.48	3631
HSA-MIR-129-5P	99.88	70.26	3273
HSA-MIR-3133	99.81	70.92	3506
HSA-MIR-4639-5P	99.81	67.37	1028
HSA-MIR-4310	99.59	68.84	2527
HSA-MIR-203A-3P	99.49	70.56	2806
HSA-MIR-3978	99.24	68.39	2201
HSA-MIR-4279	99.19	66.70	2437
HSA-MIR-935	98.82	69.36	1072
HSA-MIR-1248	98.47	67.54	1314
HSA-MIR-6736-3P	96.98	65.22	1342
HSA-MIR-6834-5P	96.25	64.88	823
HSA-MIR-4513	95.04	67.06	727
HSA-MIR-6855-3P	95.04	66.57	725
HSA-MIR-5195-5P	90.84	65.09	287

Functional genomics

gnomAD constraint: pLI 0.00026, LOEUF 0.882, missense Z 1.57 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD)

ENST00000323274 splits into 3 regions with different missense tolerance; 1 is missense-constrained (≈9% of the expected missense variation). Missense variants in a constrained region (low observed/expected) are more likely to be pathogenic. gnomAD

Region (GRCh38)	Missense obs / exp	o/e	Constrained
18:657,743–671,386	228 / 326.1	0.70	no
18:671,387–672,889	10 / 38.2	0.26	yes (p 5.0e-06)
18:672,890–672,994	35 / 42.4	0.83	no

DepMap (CRISPR cell-line fitness): dependent in 50.8% of screened cell lines.

Most-dependent cell lines (DepMap gene-effect, lower = stronger; ≤ −0.5 shown): AsPC-1 (-4.119), Panc 04.03 (-3.625), SW 1990 (-3.543), SK-MES-1 (-3.338), HCC70 (-3.333), MDA-MB-157 (-3.29), Capan-1 (-3.287), Panc 03.27 (-3.266), SNU-61 (-3.062), JHH-6 (-3.018), HCC1806 (-2.968), MDA-MB-436 (-2.856), AML-193 (-2.822), LUDLU-1 (-2.81), KP-3 (-2.79).

Literature-anchored findings (GeneRIF, showing 40)

• liganded crystal structures with pyrrolo(2,3-d)pyrimidine-based antifolate compounds (PMID:11697906)
• high level of expression associated with poor prognosis in p-stage I adenocarcinoma of the lung (PMID:11804689)
• Length polymorphism of thymidylate synthase regulatory region in Chinese populations and evolution of the novel alleles (PMID:11989786)
• TK1 gene expression together with TS, TP and DPD gene expression may play important roles in influencing the malignant behavior of epithelial ovarian cancer. (PMID:11992400)
• Mutants of TS that confer resistance to MTX as well as 5-FU by random as well as site-directed mutagenesis. Review. (PMID:12084458)
• Thymidylate synthase as a translational regulator of cellular gene expression. Review. (PMID:12084459)
• rTS gene expression likely plays a role in down-regulating TS through a natural RNA-based antisense mechanism. Review. (PMID:12084460)
• Induction of thymidylate synthase as a 5-fluorouracil resistance mechanism. Review. (PMID:12084461)
• Structure-based studies on species-specific inhibition of thymidylate synthase. Review. (PMID:12084462)
• mutations in TS result in conformational changes that confer 5-fluordeoxyuridine resistance (PMID:12147691)
• TYMS and MTHFR compete for limiting supplies of folate required for the remethylation of homocysteine. (PMID:12215845)
• the identified highly conserved protein domains, which occur at the homodimeric interface of thymidylate synthase(TS), represent potential participating sites for binding of TS protein to its mRNA. (PMID:12220503)
• Enhanced expression mediates resistance of uterine cervical cancer cells to radiation (PMID:12239455)
• cytomegalovirus infection induces cellular thymidylate synthase gene expression in quiescent human embryonic lung fibroblasts (PMID:12466474)
• Gene expression is a predictor for the efficacy of fluoropyrimidine-based chemotherapy for metastatic colorectal cancer. (PMID:12576451)
• Expression predicts the reponse of metastatic colorectal cancer to raltitrexel. (PMID:12576452)
• Associations between polymorphisms in the thymidylate synthase and serine hydroxymethyltransferase genes and susceptibility to malignant lymphoma. (PMID:12604405)
• polymorphism and overexpression of Thymidylate synthase mrna is associated with non-small-cell lung cancer (PMID:12640689)
• Results suggest that the genotyping for thymidylate synthase and methylenetetrahydrofolate reductase polymorphisms may be a useful indicator in determining the appropriate dose of methotrexate in patients with rheumatoid arthritis. (PMID:12684695)
• Overexpression of thymidylate synthase mediates desensitization for 5-fluorouracil of cervical cancer cells (PMID:12845668)
• Results describe the kinetic parameters of human recombinant thymidylate synthase (hrTS) with its natural substrate, dUMP, and E-5-(2-bromovinyl)-2(’)-deoxyuridine monophosphate (BVdUMP). (PMID:12859954)
• Findings identify Cys-180 as a critical residue for the in vitro and in vivo translational regulatory effects of human thymidylate synthase. (PMID:12907731)
• TS and DPD quantitation may be helpful to evaluate prognosis of patients receiving adjuvant 5-FU and that patients with high TS and low DPD may benefit from adjuvant 5-FU chemotherapy in colorectal cancer. (PMID:14519634)
• High TS expression is a marker of poor prognosis in resected pancreatic cancer. Patients with high intratumoral TS expression benefit from adjuvant therapy. (PMID:14519641)
• These results indicate that postoperative chemotherapy with 5-FU could be effective for patients with the G-phenotype tumor, since the incidence of intratumoral expression of TS, the target enzyme of 5-FU, is significantly low in G-phenotype tumors (PMID:14576935)
• There is prognostic significance to TS mRNA expression in breast neoplasms. (PMID:14702180)
• thymidylate synthase loss of heterozygosity has a role in progression of colorectal cancer (PMID:14760062)
• Molecular features of thymidylate synthase that control its degradation are examined; the carboxyl-terminal conformational shift is not required for ligand-mediated stabilization; the amino-terminus governs TS stability and its response to ligands. (PMID:14967037)
• TYMS gene amplification in 23% of 31 5-FU-treated cancers, whereas no amplification was observed in metastases of patients that had not been treated with 5-FU. (PMID:14970324)
• Over expression of Thymidylate synthase exhibits oncogene-like activity and suggest a link between DNA synthesis and the induction of a neoplastic phenotype (PMID:15093541)
• 6 bp/1494 polymorphism varies greatly within different ethnic populations and is in linkage disequilibrium with the thymidylate synthase 5’ tandem repeat enhancer polymorphism (PMID:15115918)
• thymidylate synthase and p53 have roles in regulating Fas-mediated apoptosis in response to antimetabolites (PMID:15161716)
• Polymorphism of TYMS partially modifies the risk of esophageal and stomach cancer in patients with smoking habit. (PMID:15244514)
• Thymidylate synthase inhibition triggers glucose-dependent apoptosis in p53-negative leukemic cells (PMID:15251465)
• The combination of low expression of TS and induction of p16(INK4a) after chemotherapy can be important indicators of the sensitivity to 5-FU-based chemotherapy in colorectal cancers. (PMID:15260847)
• Thymidylate synthase polymorphisms are associated with esophageal squamous cell carcinoma and gastric cardiac adenocarcinoma (PMID:15284183)
• TS in malignant tissue was statistically higher than in normal stromal tissue in both differentiated and undifferentiated types (p < 0.0001). (PMID:15316940)
• Polymorphisms in the TS gene may contribute to gastric cancer susceptibility. (PMID:15386366)
• Polymorphisms of reduced folate carrier,aminoimidazole carboxamide ribonucleotide transformylase,and thymidylate synthase genes contribute to the therapeutic response in rheumatoid arthritis patients to methotrexate. (PMID:15457444)
• The common MTHFR C677T and TS enhancer region polymorphisms were not risk factors for breast cancer in this patient cohort nor were they associated with phenotypic features or with prognosis. (PMID:15510613)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	tyms	ENSDARG00000042894
mus_musculus	Tyms	ENSMUSG00000025747
rattus_norvegicus	Tyms	ENSRNOG00000037225
drosophila_melanogaster	Ts	FBGN0024920
caenorhabditis_elegans	tyms-1	WBGENE00022455

Paralogs (2): DHFR2 (ENSG00000178700), DHFR (ENSG00000228716)

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Histophilus somni 2336	B0UWT7	100.0%	Diamond
Vibrio cholerae M66-2	C3LST0	100.0%	Diamond
Vibrio cholerae O1 biovar El Tor str. N16961	O66108	100.0%	Diamond
Cryptococcus deneoformans JEC21	P0CS12	100.0%	Diamond
Cryptococcus deneoformans B-3501A	P0CS13	100.0%	Diamond
Histophilus somni 129PT	Q0I563	100.0%	Diamond
Bordetella parapertussis 12822	Q7W1A9	100.0%	Diamond
Bordetella bronchiseptica RB50	Q7WP13	100.0%	Diamond
Encephalitozoon cuniculi GB-M1	O62584	99.7%	Diamond
Vibrio cholerae O395	A5F8Y6	99.6%	Diamond
Haemophilus influenzae PittEE	A5UDH0	99.6%	Diamond
Haemophilus influenzae Rd KW20	P44420	99.6%	Diamond
Haemophilus influenzae 86-028NP	Q4QM04	99.3%	Diamond
Bordetella pertussis Tohama I	Q7VUE3	98.8%	Diamond
Vibrio parahaemolyticus RIMD 2210633	Q87SA0	97.5%	Diamond
Vibrio campbellii ATCC BAA-1116	A7MXJ9	95.1%	Diamond
Actinobacillus succinogenes 130Z	A6VMA0	92.9%	Diamond
[Mannheimia] succiniciproducens MBEL55E	Q65VJ8	92.9%	Diamond
Vibrio atlanticus LGP32	B7VJ78	91.5%	Diamond
Shewanella piezotolerans WP3	B8CQK7	91.5%	Diamond
Leishmania major	P07382	91.2%	Diamond
Leishmania amazonensis	P16126	91.2%	Diamond
Plasmodium chabaudi	P20712	90.7%	Diamond
Methanothermobacter marburgensis str. Marburg	P80305	87.8%	Diamond
Plasmodium berghei ANKA	Q27713	87.5%	Diamond
Arabidopsis thaliana	Q05762	87.2%	Diamond
Shewanella loihica PV-4	A3QBR4	86.6%	Diamond
Shewanella sediminis HAW-EB3	A8FSC3	86.6%	Diamond
Glaesserella parasuis SH0165	B8F6S2	85.5%	Diamond
Zea mays	O81395	84.6%	Diamond
Oryza sativa Japonica Group	Q2QRX6	84.6%	Diamond
Psychromonas ingrahamii 37	A1SS96	83.4%	Diamond
Tolumonas auensis DSM 9187	C4LD19	83.0%	Diamond
Photobacterium profundum SS9	Q6LUM1	82.7%	Diamond
Pseudomonas syringae pv. tomato str. DC3000	Q87UL4	82.7%	Diamond
Bos taurus	Q2TA32	82.4%	Diamond
Crithidia fasciculata	Q23695	80.8%	Diamond
Glycine max	P51820	77.0%	Diamond
Daucus carota	P45350	75.1%	Diamond
Saccharomyces cerevisiae S288C	P06785	74.2%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
ADCYAP1	protein-coding	116
ENOSF1	protein-coding	55556
YES1	protein-coding	7525
CETN1	protein-coding	1068
CLUL1	protein-coding	27098
TYMSOS	ncRNA	494514
LINC01925	ncRNA	105376854

Protein

Protein identifiers

Thymidylate synthase — P04818 (reviewed: P04818)

All UniProt accessions (2): P04818, Q53Y97

UniProt curated annotations — full annotation on UniProt →

Function. Catalyzes the reductive methylation of 2’-deoxyuridine 5’-monophosphate (dUMP) to thymidine 5’-monophosphate (dTMP), using the cosubstrate, 5,10- methylenetetrahydrofolate (CH2H4folate) as a 1-carbon donor and reductant and contributes to the mitochondrial and nuclear de novo thymidylate biosynthesis pathway.

Subunit / interactions. Homodimer. Part of the de novo thymidylate synthesis complex composed at least by SHMT1, DHFR and TYMS. Interacts with SHMT1; this interaction is DNA-dependent and mediates TYMS co-localization with LMNB1.

Subcellular location. Nucleus. Cytoplasm. Mitochondrion. Mitochondrion matrix. Mitochondrion inner membrane.

Post-translational modifications. Sumoylated by UBE2I/UBC9.

Disease relevance. Dyskeratosis congenita, digenic (DKCD) [MIM:620040] A form of dyskeratosis congenita, a rare multisystem disorder caused by defective telomere maintenance. It is characterized by progressive bone marrow failure, and the clinical triad of reticulated skin hyperpigmentation, nail dystrophy, and mucosal leukoplakia. Common but variable features include premature graying, aplastic anemia, low platelets, osteoporosis, pulmonary fibrosis, and liver fibrosis among others. Early mortality is often associated with bone marrow failure, infections, fatal pulmonary complications, or malignancy. DKCD transmission pattern is consistent with digenic inheritance. The disease is caused by variants affecting distinct genetic loci, including the gene represented in this entry. TYMS germline variants in the presence of a common ENOSF1 haplotype (defined by rs699517, rs2790 and rs1512643) result in severe thymidylate synthase deficiency and disease. The pathogenic mechanism involves increased expression of ENOSF1 relative to TYMS, and post-transcriptional inhibition of TYMS translation through ENOSF1-TYMS RNA-RNA interactions.

Pathway. Pyrimidine metabolism; dTTP biosynthesis.

Miscellaneous. Expressed both in normal and cancerous tissues. Expressed only in cancerous tissues.

Similarity. Belongs to the thymidylate synthase family.

Isoforms (3)

UniProt ID	Names	Canonical?
P04818-1	1	yes
P04818-2	2, delta4
P04818-3	3, delta2+3

RefSeq proteins (3): NP_001062, NP_001341796, NP_001341797 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000398	Thymidylate_synthase	Family
IPR020940	Thymidylate_synthase_AS	Active_site
IPR023451	Thymidate_synth/dCMP_Mease_dom	Domain
IPR036926	Thymidate_synth/dCMP_Mease_sf	Homologous_superfamily
IPR045097	Thymidate_synth/dCMP_Mease	Family

Pfam: PF00303

Enzyme classification (BRENDA)

• EC 2.1.1.45 — thymidylate synthase (BRENDA: 178 organisms, 81 substrates, 400 inhibitors, 176 Km, 23 kcat entries)

Substrate kinetics (BRENDA)

34 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
2’-DEOXYURIDYLATE	0.0007–0.0981	56
5,10-METHYLENETETRAHYDROFOLATE	0.0015–0.3125	25
DUMP	0.0008–0.179	22
METHYLENETETRAHYDROFOLATE	0.008–0.13	22
5-BROMO-2’-DEOXYURIDYLATE	0.0057–0.046	12
METHYLENETETRAHYDROPTEROYLGLUAMATE	0.001–0.0118	5
5-BROMO-2’-DEOXYURIDINE	0.0097–0.514	3
2’-DEOXYURIDYLATE 5’-DITHIOPHOSPHATE	0.0137–0.0155	2
2’-DEOXYURIDYLATE 5’-THIOPHOSPHATE	0.0063–0.037	2
2’-FLUORO-2’-DEOXYURIDINE 5’-PHOSPHATE	0.11–0.113	2
(-)-5,10-METHYLENE-TETRAHYDROPTEROYLGLUTAMATE	0.07	1
(6S)-TETRAHYDROPTEROYLGLUTAMATE	0.061	1
(L)-TETRAHYDROPTEROYLTRIGLUTAMATE	0.025	1
(R)-5,10-METHYLENE-5,6,7,8-TETRAHYDROFOLATE	0.3	1
(R)-5,10-METHYLENETETRAHYDROFOLATE	0.3	1

Catalyzed reactions (Rhea)

• dUMP + (6R)-5,10-methylene-5,6,7,8-tetrahydrofolate = 7,8-dihydrofolate + dTMP (RHEA:12104)

UniProt features (64 total): helix 21, strand 14, binding site 8, turn 6, sequence variant 4, cross-link 3, splice variant 2, initiator methionine 1, chain 1, modified residue 1, region of interest 1, compositionally biased region 1, active site 1

Structure

Experimental structures (PDB)

showing 30 of 61 structures by resolution:

PDB	Title	Method	Resolution (Å)
3ED7	Replacement of Val3 in Human Thymidylate Synthase Affects Its Kinetic Properties and …	X-RAY DIFFRACTION	1.56
3GH0	Replacement of Val3 in Human Thymidylate Synthase Affects Its Kinetic Properties and …	X-RAY DIFFRACTION	1.56
3EDW	Replacement of Val3 in Human Thymidylate Synthase Affects Its Kinetic Properties and …	X-RAY DIFFRACTION	1.75
3GH2	Replacement of Val3 in Human Thymidylate Synthase Affects Its Kinetic Properties and …	X-RAY DIFFRACTION	1.75
1YPV	Structure of human thymidylate synthase at low salt conditions	X-RAY DIFFRACTION	1.8
3EAW	Replacement of Val3 in Human Thymidylate Synthase Affects Its Kinetic Properties and …	X-RAY DIFFRACTION	1.86
1HVY	Human thymidylate synthase complexed with dUMP and Raltitrexed, an antifolate drug, is in …	X-RAY DIFFRACTION	1.9
5X66	Human thymidylate synthase in complex with dUMP and methotrexate	X-RAY DIFFRACTION	1.99
1HW3	STRUCTURE OF HUMAN THYMIDYLATE SYNTHASE SUGGESTS ADVANTAGES OF CHEMOTHERAPY WITH …	X-RAY DIFFRACTION	2
1HZW	CRYSTAL STRUCTURE OF HUMAN THYMIDYLATE SYNTHASE	X-RAY DIFFRACTION	2
3EHI	Crystal Structure of Human Thymidyalte Synthase M190K with Loop 181-197 stabilized in the …	X-RAY DIFFRACTION	2
4FGT	Allosteric peptidic inhibitor of human thymidylate synthase that stabilizes inactive …	X-RAY DIFFRACTION	2
5X5D	Human thymidylate synthase bound with dUMP	X-RAY DIFFRACTION	2
4KPW	Crystal structure of His-tagged human thymidylate synthase R175A mutant	X-RAY DIFFRACTION	2.03
6QXH	Crystal structure of His-tag human thymidylate synthase (HT-hTS) in complex with dUMP	X-RAY DIFFRACTION	2.04
3EBU	Replacement of Val3 in Human Thymidylate Synthase Affects Its Kinetic Properties and …	X-RAY DIFFRACTION	2.05
1HW4	STRUCTURE OF THYMIDYLATE SYNTHASE SUGGESTS ADVANTAGES OF CHEMOTHERAPY WITH NONCOMPETITIVE …	X-RAY DIFFRACTION	2.06
6QXG	Crystal structure of His-tag human thymidylate synthase (HT-hTS) in complex with FdUMP	X-RAY DIFFRACTION	2.08
5X4W	Mutant human thymidylate synthase A191K crystallized in a sulfate-free condition	X-RAY DIFFRACTION	2.1
5X67	Human thymidylate synthase in complex with dUMP and nolatrexed	X-RAY DIFFRACTION	2.13
3EGY	Crystal Structure of Human Thymidyalte Synthase A191K with Loop 181-197 stabilized in the …	X-RAY DIFFRACTION	2.18
5X4Y	Mutant human thymidylate synthase M190K crystallized in a sulfate-containing condition	X-RAY DIFFRACTION	2.2
4G2O	Human Thymidylate Synthase M190K with bound Purpurogallin	X-RAY DIFFRACTION	2.25
6QYQ	Crystal structure of human thymidylate synthase (hTS) variant R175C	X-RAY DIFFRACTION	2.25
3N5E	Crystal Structure of human thymidylate synthase bound to a peptide inhibitor	X-RAY DIFFRACTION	2.26
4O1U	Crystal structure of human thymidylate synthase mutant Y202C	X-RAY DIFFRACTION	2.26
3N5G	Crystal Structure of histidine-tagged human thymidylate synthase	X-RAY DIFFRACTION	2.27
4GD7	Wild-Type Human Thymidylate Synthase with bound Purpurogallin	X-RAY DIFFRACTION	2.29
4G6W	Human Thymidylate Synthase M190K with bound 4-Bromobenzene-1,2,3-triol	X-RAY DIFFRACTION	2.3
4E28	Structure of human thymidylate synthase in inactive conformation with a novel …	X-RAY DIFFRACTION	2.3

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P04818-F1	94.05	0.90

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Transferases, Metabolic proteins, Predicted intracellular proteins, Plasma proteins, Cancer-related genes, Candidate cancer biomarkers, FDA approved drug targets, Small molecule drugs

Protein evidence: Evidence at protein level

Antibody reliability (HPA): IH enhanced

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1)

Position	Role
195	nucleophile

Ligand- & substrate-binding residues (8)

Position	Role
226	dUMP
256–258	dUMP
312	(6R)-5,10-methylene-5,6,7,8-tetrahydrofolate
50	dUMP
175–176	dUMP
195–196	dUMP
215–218	dUMP
218	(6R)-5,10-methylene-5,6,7,8-tetrahydrofolate

Post-translational modifications (4)

Type	Positions
Phosphoserine	114
Glycyl lysine isopeptide (lys-gly) (interchain with g-cter in sumo2)	287, 292, 308

Function

Pathways and Gene Ontology

Reactome pathways

2 curated (TAS) of 8; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

8 pathways:

ID	Pathway	Evidence
R-HSA-69205	G1/S-Specific Transcription	curated
R-HSA-499943	Interconversion of nucleotide di- and triphosphates	curated
R-HSA-1640170	Cell Cycle	—
R-HSA-69278	Cell Cycle, Mitotic	—
R-HSA-69206	G1/S Transition	—
R-HSA-1430728	Metabolism	—
R-HSA-15869	Metabolism of nucleotides	—
R-HSA-453279	Mitotic G1 phase and G1/S transition	—

MSigDB gene sets: 645 (showing top): KALMA_E2F1_TARGETS, MORF_DNMT1, WU_APOPTOSIS_BY_CDKN1A_VIA_TP53, HORIUCHI_WTAP_TARGETS_DN, KANG_DOXORUBICIN_RESISTANCE_UP, REACTOME_G1_S_SPECIFIC_TRANSCRIPTION, MORF_ESPL1, GNF2_CENPF, RODRIGUES_THYROID_CARCINOMA_POORLY_DIFFERENTIATED_UP, KANG_FLUOROURACIL_RESISTANCE_UP, MODULE_56, PAL_PRMT5_TARGETS_UP, KOINUMA_COLON_CANCER_MSI_UP, CHIANG_LIVER_CANCER_SUBCLASS_UNANNOTATED_DN, MORF_RRM1

GO Biological Process (11): ‘de novo’ pyrimidine nucleobase biosynthetic process (GO:0006207), dTMP biosynthetic process (GO:0006231), dTTP biosynthetic process (GO:0006235), DNA replication (GO:0006260), negative regulation of translation (GO:0017148), methylation (GO:0032259), tetrahydrofolate interconversion (GO:0035999), DNA biosynthetic process (GO:0071897), one-carbon metabolic process (GO:0006730), nucleotide biosynthetic process (GO:0009165), tetrahydrofolate metabolic process (GO:0046653)

GO Molecular Function (9): mRNA regulatory element binding translation repressor activity (GO:0000900), thymidylate synthase activity (GO:0004799), folic acid binding (GO:0005542), sequence-specific mRNA binding (GO:1990825), dihydrofolate reductase activity (GO:0004146), protein binding (GO:0005515), methyltransferase activity (GO:0008168), transferase activity (GO:0016740), transferase activity, transferring one-carbon groups (GO:0016741)

GO Cellular Component (7): nucleus (GO:0005634), replication fork (GO:0005657), cytoplasm (GO:0005737), mitochondrion (GO:0005739), mitochondrial inner membrane (GO:0005743), mitochondrial matrix (GO:0005759), cytosol (GO:0005829)

Reactome top-level categories

6 top-level categories:

Category	Pathways
Metabolism of nucleotides	1
G1/S Transition	1
Metabolism	1
Cell Cycle, Mitotic	1
Mitotic G1 phase and G1/S transition	1
Cell Cycle	1

GO top-level categories

42 GO namespaces:

Category	Terms
cellular anatomical structure	3
pyrimidine deoxyribonucleotide biosynthetic process	2
DNA metabolic process	2
mRNA binding	2
intracellular membrane-bounded organelle	2
cytoplasm	2
pyrimidine nucleobase biosynthetic process	1
pyrimidine deoxyribonucleoside monophosphate biosynthetic process	1
dTMP metabolic process	1
deoxyribonucleoside triphosphate biosynthetic process	1
pyrimidine deoxyribonucleoside triphosphate biosynthetic process	1
dTTP metabolic process	1
DNA biosynthetic process	1
translation	1
regulation of translation	1
negative regulation of gene expression	1
negative regulation of protein metabolic process	1
metabolic process	1
one-carbon metabolic process	1
tetrahydrofolate biosynthetic process	1
nucleic acid biosynthetic process	1
small molecule metabolic process	1
nucleotide metabolic process	1
nucleoside phosphate biosynthetic process	1
folic acid-containing compound metabolic process	1
translation repressor activity	1
5,10-methylenetetrahydrofolate-dependent methyltransferase activity	1
vitamin binding	1
carboxylic acid binding	1
modified amino acid binding	1
heterocyclic compound binding	1
oxidoreductase activity, acting on the CH-NH group of donors, NAD or NADP as acceptor	1
binding	1
transferase activity, transferring one-carbon groups	1
catalytic activity	1
transferase activity	1
chromosome	1
intracellular anatomical structure	1
organelle inner membrane	1
mitochondrial membrane	1
mitochondrion	1
intracellular organelle lumen	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 14 of 27 annotations. The rest are phylogenetic / computational / electronic (IEA).

14 experimentally-supported GO terms:

GO term	NS	Evidence
‘de novo’ pyrimidine nucleobase biosynthetic process	BP	direct assay
DNA replication	BP	direct assay
dTMP biosynthetic process	BP	direct assay
negative regulation of translation	BP	direct assay
tetrahydrofolate interconversion	BP	direct assay
cytoplasm	CC	direct assay
mitochondrial inner membrane	CC	direct assay
mitochondrial matrix	CC	direct assay
mitochondrion	CC	direct assay
nucleus	CC	direct assay
replication fork	CC	direct assay
mRNA regulatory element binding translation repressor activity	MF	direct assay
sequence-specific mRNA binding	MF	direct assay
thymidylate synthase activity	MF	direct assay

Protein interactions and networks

STRING

showing 15 of 3,392 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TYMS	DPYD	Q12882	970
TYMS	ENOSF1	Q7L5Y1	932
TYMS	DHFR	P00374	921
TYMS	DHFR2	Q86XF0	920
TYMS	DCTD	P32321	911
TYMS	MTHFR	P42898	899
TYMS	UPRT	Q96BW1	894
TYMS	TYMP	P19971	879
TYMS	GART	P22102	838
TYMS	TFCP2	Q12800	837
TYMS	UMPS	P11172	802
TYMS	FPGS	Q05932	800
TYMS	SHMT1	P34896	796
TYMS	MTDH	Q86UE4	778
TYMS	MTR	Q99707	776

IntAct

Human interaction partners of TYMS in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

2 partners by confidence:

Partner	Interaction type	MIscore	Records
EFHD2	physical association	0.400	1
SH3GL2	physical association	0.370	1

BioGRID (123 interactions; top human partners by supporting records): LIMS1 (Affinity Capture-MS; 3 records), PKIG (Affinity Capture-MS; 2 records), ADSL (Co-fractionation), AHCYL1 (Co-fractionation), AMBRA1 (Proximity Label-MS), ARHGEF35 (Affinity Capture-MS), ATG5 (Proximity Label-MS), ATIC (Co-fractionation), ATP6V1C1 (Co-fractionation), ATP6V1E1 (Co-fractionation), BFAR (Affinity Capture-MS), C9orf72 (Affinity Capture-MS), CDC42 (Reconstituted Complex), CHEK1 (Negative Genetic), CHPF (Affinity Capture-MS)

SIGNOR signaling

17 signaling interactions:

A	Effect	B	Mechanism
pemetrexed	down-regulates	TYMS	“chemical inhibition”
“ICI D1694”	down-regulates	TYMS	“chemical inhibition”
TYMS	up-regulates	Purine_biosynthesis
TFDP1	“up-regulates quantity by expression”	TYMS	“transcriptional regulation”
E2F1	“up-regulates quantity by expression”	TYMS	“transcriptional regulation”
YBX1	“down-regulates quantity by repression”	TYMS	“transcriptional regulation”
“pemetrexed disodium”	“down-regulates activity”	TYMS	“chemical inhibition”
gemcitabine	“down-regulates activity”	TYMS	“chemical inhibition”
2’,2’-difluoro-2’-deoxyuridine	“down-regulates activity”	TYMS	“chemical inhibition”
pralatrexate	“down-regulates activity”	TYMS	“chemical inhibition”
capecitabine	“down-regulates activity”	TYMS	“chemical inhibition”
MYC	“up-regulates quantity by expression”	TYMS	“transcriptional regulation”
TYMS	“down-regulates quantity”	(6R)-5,10-methylenetetrahydrofolate(2-)	“chemical modification”
TYMS	“up-regulates quantity”	dihydrofolate(2-)	“chemical modification”
TYMS	“down-regulates quantity”	dUMP(2-)	“chemical modification”
TYMS	“up-regulates quantity”	dTMP(2-)	“chemical modification”
CHD8	“up-regulates quantity by expression”	TYMS	“transcriptional regulation”

Protein complexes (CORUM) (3)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

3 complexes by size:

Complex	Subunits	Members
★ DHFR-SHMT1-TYMS complex	3	DHFR, SHMT1, TYMS
★ DHFR-TYMS complex	2	DHFR, TYMS
★ TYMS homodimer	1	TYMS

Disease & clinical

Genetic variants

Variant evidence for TYMS: 41 ClinVar records (5 pathogenic / likely pathogenic); 5 CIViC cancer variants; 18 PharmGKB clinical annotations; 10 GWAS associations. Per-variant detail is on Sugi Variant.

ClinVar

41 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	5
Likely pathogenic	0
Uncertain significance	12
Likely benign	12
Benign	2

Top pathogenic / likely-pathogenic (5)

Showing all 5 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
1693535	NM_001071.4(TYMS):c.343C>T (p.Arg115Ter)	Pathogenic	criteria provided, single submitter	2
1693537	NM_001071.4(TYMS):c.486_487del (p.Arg163fs)	Pathogenic	criteria provided, single submitter	2
1693538	NM_001071.4(TYMS):c.534_535insTG (p.Met179Ter)	Pathogenic	criteria provided, single submitter	2
1693539	NM_001071.4(TYMS):c.556+1G>A	Pathogenic	criteria provided, single submitter	1
1693540	NM_001071.4(TYMS):c.811C>T (p.Arg271Ter)	Pathogenic	criteria provided, single submitter	1

Per-variant reference — Sugi Variant

Explore TYMS’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 28 predictions of 580):

Position(s)	Effect	Δscore	Sites
18:662321–662322	donor_loss	1.0000	5
18:671369–671370	acceptor_gain	1.0000	2
18:671378–671379	acceptor_loss	1.0000	6
18:671452–671453	donor_loss	1.0000	4
18:662144–662145	acceptor_loss	0.9900	6
18:670681	acceptor_gain	0.9900
18:657881	donor_gain	0.9800
18:662136	acceptor_gain	0.9800
18:662309	donor_gain	0.9800
18:670822	donor_gain	0.9800

AlphaMissense

937 missense substitutions predicted likely pathogenic (of 2,047 scored), across 218 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
D218	8	0.992	0.997
H196	8	0.985	0.998
H256	8	0.985	0.997
H261	8	0.972	0.986
D254	8	0.953	0.984
F225	8	0.945	0.995
F59	8	0.934	0.991
N226	8	0.929	0.997
F91	8	0.927	0.984
D159	8	0.926	0.973
D49	8	0.913	0.969
F201	8	0.911	0.990
M190	8	0.894	0.964
D130	8	0.889	0.950
S229	8	0.866	0.996
D295	8	0.856	0.910
N183	8	0.855	0.980
M311	8	0.839	0.965
F248	8	0.749	0.984
W109	7	0.995	0.999

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

6 prognostic cancer types:

Cancer	Prognostic	p-value
Liver Hepatocellular Carcinoma (validation)	unfavorable	9.99e-07
Lung Adenocarcinoma (TCGA)	unfavorable	1.45e-06
Pancreatic Adenocarcinoma (TCGA)	unfavorable	1.81e-06
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	8.73e-06
Liver Hepatocellular Carcinoma (TCGA)	unfavorable	8.34e-05
Pancreatic Adenocarcinoma (validation)	unfavorable	0.000964

Disease associations

OMIM: gene MIM:188350 | disease phenotypes: MIM:127550 (Dyskeratosis congenita, autosomal dominant, 1), MIM:620040 (Dyskeratosis congenita, digenic)

GenCC curated gene-disease

Mondo (2): dyskeratosis congenita (MONDO:0015780), dyskeratosis congenita, digenic (MONDO:0031057)

Orphanet (1): Dyskeratosis congenita (Orphanet:1775)

HPO phenotypes

showing 60 of 84 phenotypes (HPO-id order):

HPO	Term
HP:0000008	Abnormal morphology of female internal genitalia
HP:0000035	Abnormal testis morphology
HP:0000164	Abnormality of the dentition
HP:0000252	Microcephaly
HP:0000327	Hypoplasia of the maxilla
HP:0000365	Hearing impairment
HP:0000498	Blepharitis
HP:0000499	Abnormal eyelash morphology
HP:0000518	Cataract
HP:0000534	Abnormal eyebrow morphology
HP:0000600	Abnormality of the pharynx
HP:0000653	Sparse eyelashes
HP:0000668	Hypodontia
HP:0000670	Carious teeth
HP:0000679	Taurodontia
HP:0000704	Periodontitis
HP:0000819	Diabetes mellitus
HP:0000939	Osteoporosis
HP:0000975	Hyperhidrosis
HP:0000982	Palmoplantar keratoderma
HP:0001000	Abnormal skin pigmentation
HP:0001018	Abnormal palmar dermatoglyphics
HP:0001034	Hypermelanotic macule
HP:0001053	Hypopigmented skin patches
HP:0001231	Abnormal fingernail morphology
HP:0001263	Global developmental delay
HP:0001394	Cirrhosis
HP:0001399	Hepatic failure
HP:0001488	Bilateral ptosis
HP:0001508	Failure to thrive
HP:0001511	Intrauterine growth retardation
HP:0001596	Alopecia
HP:0001744	Splenomegaly
HP:0001873	Thrombocytopenia
HP:0001874	Abnormality of neutrophils
HP:0001903	Anemia
HP:0001928	Abnormality of coagulation
HP:0002015	Dysphagia
HP:0002020	Gastroesophageal reflux
HP:0002024	Malabsorption
HP:0002205	Recurrent respiratory infections
HP:0002216	Premature graying of hair
HP:0002240	Hepatomegaly
HP:0002514	Cerebral calcification
HP:0002575	Tracheoesophageal fistula
HP:0002650	Scoliosis
HP:0002664	Neoplasm
HP:0002665	Lymphoma
HP:0002671	Basal cell carcinoma
HP:0002719	Recurrent infections
HP:0002720	Decreased circulating IgA concentration
HP:0002745	Oral leukoplakia
HP:0002757	Recurrent fractures
HP:0002850	Decreased circulating IgM concentration
HP:0002861	Melanoma
HP:0002894	Neoplasm of the pancreas
HP:0003577	Congenital onset
HP:0003593	Infantile onset
HP:0003621	Juvenile onset
HP:0004315	Decreased circulating IgG concentration

GWAS associations

10 associations:

Study	Trait	p-value
GCST009733_120	Urinary metabolite levels in chronic kidney disease	4e-15
GCST90002397_800	Mean spheric corpuscular volume	4e-14
GCST90002392_290	Mean corpuscular volume	3e-13
GCST90002396_197	Mean reticulocyte volume	8e-13
GCST90002390_313	Mean corpuscular hemoglobin	1e-11
GCST004635_37	Testicular germ cell tumor	4e-10
GCST004602_206	Mean corpuscular volume	1e-9
GCST004630_273	Mean corpuscular hemoglobin	6e-9
GCST008366_23	Leukocyte telomere length	1e-8
GCST009856_25	Leukocyte telomere length	2e-7

EFO canonical traits (from GWAS)

3 canonical traits:

EFO ID	Trait name
EFO:0004527	mean corpuscular hemoglobin
EFO:0005116	urinary metabolite measurement
EFO:0010701	mean reticulocyte volume

MeSH disease descriptors

1 disease descriptors:

Descriptor	Name	Tree numbers
D019871	Dyskeratosis Congenita	C15.378.190.223.500.750; C16.131.831.150; C16.320.322.108; C16.320.850.235; C17.800.804.150; C17.800.827.235

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (3): CHEMBL1952 (SINGLE PROTEIN), CHEMBL3885527 (PROTEIN FAMILY), CHEMBL3885528 (PROTEIN FAMILY)

Drugs by curated mechanism of action (ChEMBL)

Drugs whose curated ChEMBL mechanism of action targets the TYMS protein itself — single-protein targets only (drugs acting on a protein family or complex that merely includes it are excluded). Includes antibodies and oligonucleotides that bioactivity screening does not capture.

9 curated-mechanism drugs:

Drug	Modality	Max phase
CAPECITABINE	Small molecule	4
FLOXURIDINE	Small molecule	4
FLUOROURACIL	Small molecule	4
PEMETREXED	Small molecule	4
RALTITREXED	Small molecule	4
TEGAFUR	Small molecule	4
DOXIFLURIDINE	Small molecule	3
NOLATREXED	Small molecule	3
OSI-7904	Small molecule	2

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 1,177,224 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

9 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL225072	PEMETREXED	4	56,714
CHEMBL2360464	PEMETREXED DISODIUM	4	21,873
CHEMBL225071	RALTITREXED	4	97,728
CHEMBL1622	FOLIC ACID	4	530,391
CHEMBL34259	METHOTREXATE	4	402,177
CHEMBL63857	PHENOLPHTHALEIN	4	57,983
CHEMBL320775	NOLATREXED	3	10,047
CHEMBL169896	OSI-7904	2	253
CHEMBL9440	METESIND	2	58

Clinical evidence (CIViC)

Drug × variant × indication, from 10 curated evidence items. CIViC evidence level: A (validated) → B (clinical) → C (case study) → D (preclinical) → E (inferential).

8 predictive associations by evidence level:

Variant	Therapy	Indication	Effect	Level	CIViC
TYMS Underexpression	Pemetrexed	Lung Non-small Cell Carcinoma	Sensitivity/Response	CIViC B	EID907
TYMS Amplification	5-Fluorouracil/Salicylic Acid Topical Solution	Colorectal Cancer	Resistance	CIViC B	EID12097 +1
TYMS Overexpression	Pemetrexed	Lung Non-small Cell Carcinoma	Resistance	CIViC B	EID832 +1
TYMS 3TRP/3TRP genotype	Fluorouracil + Irinotecan	Colorectal Cancer	Resistance	CIViC B	EID678
TYMS Amplification	Pemetrexed	Lung Adenocarcinoma	Resistance	CIViC B	EID903
TYMS Overexpression	Raltitrexed	Gastric Adenocarcinoma	Resistance	CIViC B	EID929
TYMS RS34743033	Methotrexate	Cancer	Adverse Response	CIViC B	EID1843
TYMS Underexpression	Pemetrexed	Prostate Cancer	Sensitivity/Response	CIViC C	EID908

CIViC column: a representative evidence item (EID); +N = additional CIViC items supporting the same association.

CIViC curated variants (5)

Named clinical variants curated in CIViC for this gene (the catalogue beneath the predictive evidence above):

3TRP/3TRP genotype (5 prime UTR variant,short tandem repeat variation), Overexpression, Amplification (transcript amplification), Underexpression, RS34743033.

PharmGKB: 1 entry (CPIC guideline: no)

PharmGKB clinical annotations

18 annotations by evidence level (1 strongest → 4):

Variant	Association	Level	Drugs	Phenotypes
rs11280056	Toxicity	3	methotrexate	Acute lymphoblastic leukemia;Gastrointestinal toxicity;Mucositis;Neutropenia
rs11280056	Efficacy	3	methotrexate	Acute lymphoblastic leukemia;Rheumatoid arthritis
rs11280056	Efficacy	3	fluorouracil	Colorectal Neoplasms
rs11280056	Efficacy	3	pemetrexed	Mesothelioma
rs11280056	Toxicity	3	fluorouracil;FOLFOX	Neoplasms
rs183205964	Toxicity	3	capecitabine;fluorouracil;tegafur	Neoplasms
rs2847153	Efficacy	3	fluorouracil	Pancreatic Neoplasms
rs2853539	Efficacy	3	methotrexate	Rheumatoid arthritis
rs2853741	Toxicity	3	capecitabine	Diarrhea;Neoplasms
rs45445694	Efficacy	3	methotrexate	Rheumatoid arthritis
rs45445694	Efficacy	3	fluorouracil;FOLFIRI;FOLFOX	Overall survival;Progression-free survival
rs45445694	Toxicity	3	fluorouracil	Drug Toxicity
rs45445694	Toxicity	3	irinotecan;raltitrexed	Colorectal Neoplasms
rs45445694	Efficacy	3	methotrexate	Acute lymphoblastic leukemia;Neoplasms
rs45445694	Toxicity	3	methotrexate	Acute lymphoblastic leukemia;Non-Hodgkin Lymphoma
rs699517	Toxicity	3	capecitabine	Asthenia;Nausea;Neoplasms;Vomiting
rs11280056	Toxicity	4	methotrexate	Drug Toxicity;Hematopoietic stem cell transplantation;Psoriasis;Rheumatoid arthritis;Toxic liver disease
rs45445694	Metabolism/PK	4	methotrexate	Acute lymphoblastic leukemia

PharmGKB variants

7 variants:

Variant	Genes	Level	Score	#Clin annots	Drugs
rs2847153	TYMS	3	2.50	1	fluorouracil
rs2853539	C18orf56, TYMS	3	3.25	1	methotrexate
rs45445694	C18orf56, TYMS	3	7.50	7	irinotecan;raltitrexed;methotrexate;fluorouracil;FOLFIRI;FOLFOX;fluorouracil
rs183205964	TYMS	3	3.00	1	capecitabine;fluorouracil;tegafur
rs699517	ENOSF1, TYMS	3	5.50	1	capecitabine
rs2853741	TYMS	3	3.25	1	capecitabine
rs11280056	ENOSF1, TYMS	3	3.50	6	methotrexate;fluorouracil;fluorouracil;FOLFOX;pemetrexed

PharmGKB variant annotations

Per-publication pharmacogenomic findings for this gene (significant associations).

showing 60 of 72 published findings:

Variant	Drug(s)	Category	Finding	PMID
rs45445694	methotrexate	Toxicity	Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 is associated with increased risk of Stomatitis when treated with methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.	PMID:23652803
rs45445694	capecitabine	Toxicity	Allele (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 is associated with increased likelihood of Diarrhea, Drug Toxicity or hand-foot syndrome when treated with capecitabine in people with Colorectal Neoplasms as compared to allele (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.	PMID:24590654
rs45445694	fluorouracil	Efficacy	Genotypes (CCGCGCCACTTCGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTCGCCTGCCTCCGTCCCG)2 + (CCGCGCCACTTCGCCTGCCTCCGTCCCG)2/3 is associated with increased response to fluorouracil in people with Rectal Neoplasms as compared to genotype 33.	PMID:20165956
rs45445694	fluorouracil, leucovorin, oxaliplatin	Efficacy	Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 is associated with increased response to fluorouracil, leucovorin and oxaliplatin in people with Esophageal Neoplasms and Stomach Neoplasms as compared to genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.	PMID:25232828
rs45445694	methotrexate	Toxicity	Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 is associated with increased likelihood of Myelosuppression when treated with methotrexate in people with Arthritis, Rheumatoid.	PMID:26616421
rs183205964	capecitabine, fluorouracil, tegafur	Toxicity	Allele C is associated with increased discontinuation of capecitabine, fluorouracil or tegafur in people with Neoplasms as compared to allele G.	PMID:26189437
rs45445694	capecitabine, platinum	Efficacy	Genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with decreased progression-free survival when treated with capecitabine and platinum in people with Colorectal Neoplasms or gastroesophageal cancer as compared to genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2.	PMID:25677447
rs45445694	azathioprine	Toxicity	Allele (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 is associated with increased likelihood of Neutropenia when treated with azathioprine in children with Inflammatory Bowel Diseases as compared to allele CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3.	PMID:26332308
rs45445694	capecitabine, fluorouracil	Efficacy	Genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 is associated with increased response to capecitabine or fluorouracil in people with Rectal Neoplasms.	PMID:27001118
rs45445694	capecitabine	Toxicity	Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 is associated with increased risk of Drug Toxicity when treated with capecitabine in people with Gastrointestinal Neoplasms.	PMID:27557140
rs45445694	bevacizumab, capecitabine, cisplatin, docetaxel, epirubicin, oxaliplatin, trastuzumab	Efficacy	Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with decreased response to bevacizumab, capecitabine, cisplatin, docetaxel, epirubicin, oxaliplatin or trastuzumab in people with Stomach Neoplasms as compared to genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.	PMID:27995989
rs45445694	methotrexate	Efficacy	Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with decreased response to methotrexate in people with Arthritis, Rheumatoid as compared to genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.	PMID:27992285
rs699517	capecitabine	Toxicity	Genotype TT is associated with increased likelihood of Nausea and Vomiting when treated with capecitabine in people with as compared to genotypes CC + CT.	PMID:28347776
rs699517	capecitabine	Toxicity	Genotypes CT + TT are associated with decreased likelihood of Asthenia when treated with capecitabine in people with Colorectal Neoplasms as compared to genotype CC.	PMID:28347776
rs2853741	capecitabine	Toxicity	Genotypes CT + TT are associated with decreased likelihood of Diarrhea when exposed to capecitabine in people with Colorectal Neoplasms as compared to genotype CC.	PMID:28347776
rs45445694	cisplatin, epirubicin, fluorouracil	Efficacy	Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 is associated with increased overall survival when treated with cisplatin, epirubicin and fluorouracil in people with Esophageal Neoplasms or Stomach Neoplasms as compared to genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.	PMID:28972045
rs45445694	cyclophosphamide, doxorubicin, fluorouracil	Toxicity	Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with increased risk of Neutropenia when treated with cyclophosphamide, doxorubicin and fluorouracil in women with Breast Neoplasms as compared to genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.	PMID:29507678
rs11280056	azacitidine	Efficacy	Genotype del/del is associated with decreased overall survival when treated with azacitidine in people with Myelodysplastic Syndromes as compared to genotypes AAGTTA/AAGTTA + AAGTTA/del.	PMID:29205204
rs3786362	risperidone	Toxicity	Allele A is associated with increased risk of Hyperprolactinemia when treated with risperidone in children with Autism Spectrum Disorder as compared to allele G.	PMID:29955115
rs11280056	capecitabine	Toxicity	Allele TTAAAGTTA is associated with increased severity of Diarrhea, Drug Toxicity and hand-foot syndrome when treated with capecitabine in people with Colorectal Neoplasms as compared to allele del.	PMID:24590654
rs11280056	fluorouracil, irinotecan, leucovorin	Efficacy	Genotype TTAAAGTTA/TTAAAGTTA is associated with increased risk of Disease Progression when treated with fluorouracil, irinotecan and leucovorin in people with Colorectal Neoplasms as compared to genotypes TTAAAGTTA/del + del/del.	PMID:17549067
rs11280056	capecitabine, fluorouracil	Toxicity	Genotype TTA/TTA is associated with increased risk of Drug Toxicity when treated with capecitabine or fluorouracil in people with Neoplasms.	PMID:23736036
rs11280056	capecitabine, paclitaxel	Efficacy	Genotype TTAAAGTTA/TTAAAGTTA is associated with decreased overall survival when treated with capecitabine and paclitaxel in people with Stomach Neoplasms as compared to genotypes TTAAAGTTA/del + del/del.	PMID:23263912
rs11280056	fluorouracil	Efficacy	Genotype TTAAAGTTA/TTAAAGTTA is associated with decreased event-free survival and overall survival when treated with fluorouracil in people with Rectal Neoplasms as compared to genotypes TTAAAGTTA/del + del/del.	PMID:25041994
rs11280056	methotrexate	Toxicity	Allele del is associated with increased risk of Toxic liver disease when exposed to methotrexate in people with Psoriasis.	PMID:17410198
rs11280056	methotrexate	Toxicity	Genotype del/del is associated with increased severity of mucositis when treated with methotrexate in people with hematopoietic stem cell transplantation as compared to genotype TTAAAGTTA/TTAAAGTTA.	PMID:16501586
rs11280056	fluorouracil	Efficacy	Genotype TTAAAGTTA/del is associated with decreased response to fluorouracil in people with Colorectal Neoplasms as compared to genotype del/del.	PMID:21919605
rs11280056	pemetrexed	Efficacy	Genotype TTAAAGTTA/TTAAAGTTA is associated with decreased progression-free survival when treated with pemetrexed in people with Mesothelioma as compared to genotypes TTAAAGTTA/del + del/del.	PMID:25246386
rs11280056	methotrexate	Toxicity	Genotype del/del is associated with decreased likelihood of Drug Toxicity when treated with methotrexate in people with Arthritis, Rheumatoid as compared to genotypes TTAAAGTTA/TTAAAGTTA + TTAAAGTTA/del.	PMID:27992285
rs11280056	methotrexate	Toxicity	Genotype TTAAAGTTA/TTAAAGTTA is associated with increased likelihood of Drug Toxicity when treated with methotrexate in people with Arthritis, Rheumatoid as compared to genotypes TTAAAGTTA/del + del/del.	PMID:26616421
rs11280056	carboplatin, gemcitabine	Toxicity	Genotype TTAAAGTTA/TTAAAGTTA is associated with increased likelihood of Thrombocytopenia when treated with carboplatin and gemcitabine in women Breast Neoplasms as compared to allele del.	PMID:21980041
rs2853542	methotrexate	Efficacy	Genotype GG is associated with decreased response to methotrexate in people with Arthritis, Rheumatoid as compared to genotypes CC + CG.	PMID:22763757
rs11280056	FOLFOX	Toxicity	Genotype TTA/TTA is associated with increased severity of Neurotoxicity Syndromes when treated with FOLFOX in people with Neoplasms as compared to genotypes TTA/TTAAAGTTA + TTAAAGTTA/TTAAAGTTA.	PMID:32695278
rs45445694	FOLFOX	Toxicity	Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 is associated with increased severity of Anemia when treated with FOLFOX in people with Neoplasms as compared to genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.	PMID:32695278
rs11280056	methotrexate	Toxicity	Genotype TTA/TTA is associated with increased likelihood of gastrointestinal toxicity when treated with methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes TTA/TTAAAGTTA + TTAAAGTTA/TTAAAGTTA.	PMID:32344632
rs45445694	capecitabine, fluorouracil, FOLFOX, XELOX	Toxicity	Genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with increased likelihood of adverse events when treated with capecitabine, fluorouracil, FOLFOX or XELOX in women with Breast Neoplasms, Colorectal Neoplasms or Neoplasms.	PMID:34100299
rs45445694	capecitabine, fluorouracil, FOLFOX, XELOX	Toxicity	Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 is associated with increased likelihood of discontinuation when treated with capecitabine, fluorouracil, FOLFOX or XELOX in women with Breast Neoplasms, Colorectal Neoplasms or Neoplasms.	PMID:34100299
rs45445694	methotrexate	Toxicity	Genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 are associated with decreased risk of Drug Toxicity due to methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2.	PMID:22074251
rs11280056	methotrexate	Toxicity	Genotypes TTA/TTA + TTA/TTAAAGTTA are associated with increased risk of Neutropenia due to methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotype TTAAAGTTA/TTAAAGTTA.	PMID:30684021
rs45445694	fluorouracil	Efficacy	Allele (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 is associated with decreased overall survival when treated with fluorouracil in people with Stomach Neoplasms as compared to allele (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.	PMID:36172660
rs11280056	antineoplastic agents	Toxicity	Allele TTA is associated with decreased likelihood of gastrointestinal toxicity when treated with antineoplastic agents in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to allele TTAAAGTTA.	PMID:36952646
rs2853539	antineoplastic agents	Toxicity	Genotypes AG + GG is associated with increased likelihood of Drug Toxicity when treated with antineoplastic agents in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotype AA.	PMID:36952646
rs11280056	cisplatin, docetaxel, fluorouracil	Toxicity	Genotype TTA/TTA is associated with increased severity of Hyponatremia when treated with cisplatin, docetaxel and fluorouracil in people with Carcinoma, Squamous Cell, Adenocarcinoma, Carcinoma, Adenosquamous or Esophageal Neoplasms as compared to genotypes TTA/TTAAAGTTA + TTAAAGTTA/TTAAAGTTA.	PMID:37898586
rs11280056	FOLFIRI, FOLFOX, XELOX	Efficacy	Genotype del/del is associated with decreased overall survival when treated with FOLFIRI, FOLFOX or XELOX in people with Colorectal Neoplasms as compared to genotypes TTAAAGTTA/del + TTAAAGTTAAAGTTA/TTAAAGTTAAAGTTA.	PMID:38248103
rs45445694	methotrexate	Efficacy	Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with increased clinical benefit to methotrexate in people with Arthritis, Rheumatoid as compared to genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2.	PMID:38311638
rs3786362	capecitabine	Toxicity	Allele G is associated with decreased likelihood of Hand-foot syndrome when treated with capecitabine in people with Colorectal Neoplasms as compared to allele A.	PMID:33285053
rs699517	capecitabine	Toxicity	Allele C is associated with increased likelihood of Hand-foot syndrome when treated with capecitabine in people with Colorectal Neoplasms as compared to allele T.	PMID:33285053
rs45445694	capecitabine	Toxicity	Allele (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 is associated with increased likelihood of Hand-foot syndrome when treated with capecitabine in people with Colorectal Neoplasms.	PMID:33285053
rs2790	capecitabine	Toxicity	Allele G is associated with decreased likelihood of Hand-foot syndrome when treated with capecitabine in people with Colorectal Neoplasms as compared to allele A.	PMID:33285053
rs11280056	capecitabine	Toxicity	Allele TTAAAGTTA is associated with increased likelihood of Hand-foot syndrome when treated with capecitabine in people with Colorectal Neoplasms as compared to allele TTA.	PMID:33285053
rs45445694	FOLFOX, XELOX	Toxicity	Genotype (GGCCTGCCTCCGTCCCGCCGCGCCACTT)3/(GGCCTGCCTCCGTCCCGCCGCGCCACTT)3 is associated with increased likelihood of Hand-foot syndrome, Exanthema or Drug Toxicity when treated with FOLFOX or XELOX in people with Colorectal Neoplasms.	PMID:40786508
rs11280056	FOLFOX, XELOX	Toxicity	Genotypes TTA/TTA + TTA/TTAAAGTTA is associated with decreased likelihood of Peripheral Nervous System Diseases or Myelosuppression when treated with FOLFOX or XELOX in people with Colorectal Neoplasms.	PMID:40786508
rs45445694	methotrexate	Toxicity	Allele CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC is associated with increased risk of Drug Toxicity when exposed to methotrexate in people with Psoriasis.	PMID:17410198
rs2853539	methotrexate	Efficacy	Genotype AA is associated with decreased response to methotrexate in people with Arthritis, Rheumatoid as compared to allele G.	PMID:19902562
rs45445694	fluorouracil	Efficacy	Genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with increased response to fluorouracil in people with Rectal Neoplasms as compared to genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2.	PMID:21167658
rs45445694	capecitabine, raltitrexed	Efficacy	Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with decreased response to capecitabine and raltitrexed in people with Colorectal Neoplasms as compared to genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2.	PMID:17203168
rs45445694	fluorouracil	Efficacy	Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 is associated with increased overall survival when treated with fluorouracil in people with Colorectal Neoplasms as compared to genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.	PMID:14522928
rs45445694	fluorouracil	Efficacy	Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 is associated with increased response to fluorouracil in people with Colorectal Neoplasms as compared to genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.	PMID:11913730
rs45445694	fluorouracil	Toxicity	Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with decreased severity of side effects when treated with fluorouracil in people with Colorectal Neoplasms as compared to genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.	PMID:11913730
rs45445694	fluorouracil	Metabolism/PK	Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with increased expression of TYMS when treated with fluorouracil in colonic mucosa of colorectal cancer patients as compared to genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.	PMID:16182121

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — Methyltransferases

Most potent curated ligand interactions (4 total), top 4:

Ligand	Action	Affinity	Parameter
plevitrexed	Inhibition	9.36	pKi
ONX-0801	Inhibition	8.92	pKi
pemetrexed	Inhibition	6.96	pKi
raltitrexed	Inhibition	6.54	pIC50

Binding affinities (BindingDB)

362 measured of 395 human assays (641 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value
LY-298207	KI	0.005 nM
CHEMBL290277	KI	0.041 nM
CHEMBL406575	KI	0.042 nM
CHEMBL295708	KI	0.072 nM
CHEMBL4177183	IC50	0.078 nM
(S)-2-{2-Fluoro-4-[(3-methyl-1-oxo-1,2-dihydro-benzo[f]quinazolin-9-ylmethyl)-amino]-benzoylamino}-pentanedioic acid	KI	0.09 nM
(S)-2-{(S)-4-[3-(2,4-Diamino-pyrimidin-5-yl)-propyl]-benzoylamino}-pentanedioic acid	KI	0.12 nM
2-[4-(2-Amino-6-methyl-4-oxo-3,4-dihydro-quinazolin-5-ylsulfanyl)-benzoylamino]-pentanedioic acid	KI	0.124 nM
CHEMBL4162649	IC50	0.14 nM
CHEMBL295681	KI	0.224 nM
(R)-2-{4-[2-(2,4-Diamino-5,6,7,8-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl)-ethyl]-benzoylamino}-2-methyl-pentanedioic acid	KI	0.29 nM
TCMDC-137629	KI	0.44 nM
LY-335580	KI	0.69 nM
CB-30685	IC50	1 nM
2(R)-[4(S)-carboxy-4-[4-[N-(2-hydroxymethyl-4-oxo-4,6,7,8-tetrahydro-3H-cyclopenta[g]quinazolin-6-yl)-N-(2-propynyl)amino]-benzamido]butyramido]pentanedioic acid	IC50	1 nM
(S)-2-({5-[(3-Methyl-1-oxo-1,2-dihydro-benzo[f]quinazolin-9-ylmethyl)-amino]-thiophene-2-carbonyl}-amino)-pentanedioic acid	KI	1.1 nM
(S)-2-{4-[(3-Amino-1-oxo-1,2-dihydro-benzo[f]quinazolin-9-ylmethyl)-amino]-benzoylamino}-pentanedioic acid	KI	1.2 nM
2-[4-(2,6-Dimethyl-4-oxo-3,4-dihydro-quinazolin-5-ylsulfanyl)-benzoylamino]-pentanedioic acid	KI	1.31 nM
(1,5-Dimethyl-2-methylimino-1,2-dihydro-benzo[cd]indol-6-yl)-methyl-[4-(morpholine-4-sulfonyl)-benzyl]-amine	KI	2 nM
(S)-2-{5-[Methyl-(3-methyl-1-oxo-1,2-dihydro-benzo[f]quinazolin-9-ylmethyl)-amino]-1-oxo-1,3-dihydro-isoindol-2-yl}-pentanedioic acid	KI	2.5 nM
2-[4-(3-Amino-1-oxo-1,2,5,6-tetrahydro-benzo[f]quinazoline-9-sulfonylamino)-benzoylamino]-pentanedioic acid	KI	2.5 nM
CHEMBL321678	IC50	3 nM
CHEMBL5267424	IC50	3 nM
CHEMBL111859	IC50	3 nM
CHEMBL113019	IC50	3 nM
CHEMBL109881	IC50	3 nM
CHEMBL320036	IC50	3 nM
CHEMBL264198	IC50	3 nM
CHEMBL5289121	IC50	3 nM
CHEMBL5289689	IC50	3 nM
CHEMBL5283610	IC50	3 nM
CHEMBL5287291	IC50	3 nM
CHEMBL5288172	IC50	3 nM
CHEMBL5268759	IC50	3 nM
CHEMBL5286548	IC50	3 nM
CHEMBL5282201	IC50	3 nM
CHEMBL5266971	IC50	3 nM
CHEMBL5271165	IC50	3 nM
CHEMBL5273148	IC50	3 nM
5,N*6*-Dimethyl-N*6*-(2-methyl-pyridin-4-ylmethyl)-benzo[cd]indole-2,6-diamine	KI	4 nM
(S)-2-{6-[(3-Methyl-1-oxo-1,2-dihydro-benzo[f]quinazolin-9-ylmethyl)-amino]-3-oxo-3H-benzo[d]isothiazol-2-yl}-pentanedioic acid	KI	4 nM
2-[4-(3-Methyl-1-oxo-1,2-dihydro-benzo[f]quinazoline-9-sulfonylamino)-benzoylamino]-pentanedioic acid	KI	5.5 nM
CHEMBL4170578	IC50	7.5 nM
(S)-2-(4-(((2-amino-4-oxo-3,4-dihydroquinazolin-6-yl)methyl)(prop-2-ynyl)amino)-2-fluorobenzamido)pentanedioic acid	IC50	8.9 nM
(R)-2-({5-[2-(2,4-Diamino-5,6,7,8-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl)-ethyl]-furan-2-carbonyl}-amino)-2-methyl-pentanedioic acid	KI	9.9 nM
5,N*6*-Dimethyl-N*6*-pyridazin-4-ylmethyl-benzo[cd]indole-2,6-diamine	KI	10 nM
5,N*2*,N*6*-Trimethyl-N*6*-pyridin-4-ylmethyl-benzo[cd]indole-2,6-diamine	KI	14 nM
CHEMBL5630186	IC50	17 nM
CHEMBL5624973	IC50	17 nM
(4-{[(2-Amino-benzo[cd]indol-6-yl)-methyl-amino]-methyl}-pyridin-2-yl)-methanol	KI	18 nM

ChEMBL bioactivities

717 potent at pChembl≥5 of 882 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
10.39	Ki	0.041	nM	CHEMBL290277
10.38	Ki	0.042	nM	CHEMBL406575
10.14	Ki	0.072	nM	CHEMBL295708
10.11	IC50	0.078	nM	CHEMBL4177183
10.05	Ki	0.09	nM	OSI-7904
10.05	Ki	0.09	nM	CHEMBL355323
9.91	Ki	0.124	nM	CHEMBL166027
9.85	IC50	0.14	nM	CHEMBL4162649
9.65	Ki	0.224	nM	CHEMBL295681
9.36	Ki	0.44	nM	CHEMBL168907
8.96	Ki	1.1	nM	CHEMBL169506
8.92	IC50	1.2	nM	CHEMBL1253498
8.92	Ki	1.2	nM	CHEMBL355662
8.89	Ki	1.3	nM	PEMETREXED
8.88	Ki	1.31	nM	CHEMBL166369
8.82	Ki	1.5	nM	CHEMBL179448
8.70	Ki	2	nM	CHEMBL9671
8.70	Ki	2	nM	METESIND
8.62	IC50	2.4	nM	CHEMBL4531593
8.60	Ki	2.5	nM	CHEMBL325972
8.60	Ki	2.5	nM	CHEMBL355616
8.52	IC50	3	nM	CHEMBL321678
8.52	IC50	3	nM	CHEMBL5267424
8.52	IC50	3	nM	CHEMBL111859
8.52	IC50	3	nM	CHEMBL113019
8.52	IC50	3	nM	CHEMBL109881
8.52	IC50	3	nM	CHEMBL320036
8.52	IC50	3	nM	CHEMBL264198
8.52	IC50	3	nM	CHEMBL5289121
8.52	IC50	3	nM	CHEMBL5289689
8.52	IC50	3	nM	CHEMBL5283610
8.52	IC50	3	nM	CHEMBL5287291
8.52	IC50	3	nM	CHEMBL5288172
8.52	IC50	3	nM	CHEMBL5268759
8.52	IC50	3	nM	CHEMBL5286548
8.52	IC50	3	nM	CHEMBL5282201
8.52	IC50	3	nM	CHEMBL5266971
8.52	IC50	3	nM	CHEMBL5271165
8.52	IC50	3	nM	CHEMBL5273148
8.48	Ki	3.3	nM	CHEMBL3099582
8.40	Ki	4	nM	CHEMBL55263
8.40	Ki	4	nM	CHEMBL167164
8.39	Ki	4.1	nM	CHEMBL362606
8.35	Ki	4.5	nM	CHEMBL422395
8.33	IC50	4.7	nM	CHEMBL1160192
8.32	Ki	4.77	nM	CHEMBL253954
8.26	Ki	5.5	nM	CHEMBL324739
8.26	IC50	5.5	nM	CHEMBL1160188
8.22	Ki	6	nM	CHEMBL56523
8.22	Ki	6	nM	CHEMBL168524

PubChem BioAssay actives

771 with measured affinity, of 1796 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
2-[[4-[[4-[[4-[[4-[(2-amino-4-oxo-3H-quinazolin-6-yl)methyl-prop-2-ynylamino]benzoyl]amino]-4-carboxybutanoyl]amino]-4-carboxybutanoyl]amino]-4-carboxybutanoyl]amino]pentanedioic acid	212471: Compound was tested for inhibition of human (WI-L2) thymidylate synthase	ki	<0.0001	uM
2-[[4-[[4-[[4-[[4-[[4-[(2-amino-4-oxo-3H-quinazolin-6-yl)methyl-prop-2-ynylamino]benzoyl]amino]-4-carboxybutanoyl]amino]-4-carboxybutanoyl]amino]-4-carboxybutanoyl]amino]-4-carboxybutanoyl]amino]pentanedioic acid	212471: Compound was tested for inhibition of human (WI-L2) thymidylate synthase	ki	<0.0001	uM
(2S)-2-[6-[(3-methyl-1-oxo-2H-benzo[f]quinazolin-9-yl)methylamino]-3-oxo-1H-isoindol-2-yl]pentanedioic acid	212325: The compound was tested for inhibitory activity against thymidylate synthase (purified recombinant human gene) from Escherichia coli	ki	0.0001	uM
(2S)-2-[[2-fluoro-4-[(3-methyl-1-oxo-2H-benzo[f]quinazolin-9-yl)methylamino]benzoyl]amino]pentanedioic acid	212325: The compound was tested for inhibitory activity against thymidylate synthase (purified recombinant human gene) from Escherichia coli	ki	0.0001	uM
(2R)-2-[[4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]benzoyl]amino]pentanedioic acid	221979: Compound was tested for TS activity against human Thymidylate synthase by tight binding kinetics	ki	0.0001	uM
2-[[4-[[4-[[4-[(2-amino-4-oxo-3H-quinazolin-6-yl)methyl-prop-2-ynylamino]benzoyl]amino]-4-carboxybutanoyl]amino]-4-carboxybutanoyl]amino]pentanedioic acid	212471: Compound was tested for inhibition of human (WI-L2) thymidylate synthase	ki	0.0001	uM
(2S)-2-[6-[[2-(2-amino-4-oxo-3,7-dihydropyrrolo[2,3-d]pyrimidin-6-yl)acetyl]amino]hexanoylamino]pentanedioic acid	1501141: Inhibition of TS/AICARFTase/GARFTase in human KB cells assessed as reduction in cell proliferation in folate free medium after 72 hrs in presence of leucovorin by MTT assay	ic50	0.0001	uM
(2S)-2-[[2-[[2-(2-amino-4-oxo-3,7-dihydropyrrolo[2,3-d]pyrimidin-6-yl)acetyl]amino]acetyl]amino]pentanedioic acid	1501141: Inhibition of TS/AICARFTase/GARFTase in human KB cells assessed as reduction in cell proliferation in folate free medium after 72 hrs in presence of leucovorin by MTT assay	ic50	0.0001	uM
2-[[4-[[4-[(2-amino-4-oxo-3H-quinazolin-6-yl)methyl-prop-2-ynylamino]benzoyl]amino]-4-carboxybutanoyl]amino]pentanedioic acid	212471: Compound was tested for inhibition of human (WI-L2) thymidylate synthase	ki	0.0002	uM
(2S)-2-[[4-[(3-methyl-1-oxo-2H-benzo[f]quinazolin-9-yl)methylamino]benzoyl]amino]pentanedioic acid	212326: The compound was tested for inhibitory activity against thymidylate synthase (purified recombinant human gene) from Escherichia coli.	ki	0.0004	uM
(2S)-2-[[5-[(3-methyl-1-oxo-2H-benzo[f]quinazolin-9-yl)methylamino]thiophene-2-carbonyl]amino]pentanedioic acid	212325: The compound was tested for inhibitory activity against thymidylate synthase (purified recombinant human gene) from Escherichia coli	ki	0.0011	uM
(2S)-2-[[4-[(3-amino-1-oxo-2H-benzo[f]quinazolin-9-yl)methylamino]benzoyl]amino]pentanedioic acid	212326: The compound was tested for inhibitory activity against thymidylate synthase (purified recombinant human gene) from Escherichia coli.	ki	0.0012	uM
(2R)-2-[[(4S)-4-carboxy-4-[[4-[[2-(hydroxymethyl)-4-oxo-3,6,7,8-tetrahydrocyclopenta[g]quinazolin-6-yl]-prop-2-ynylamino]benzoyl]amino]butanoyl]amino]pentanedioic acid	513674: Inhibition of thymine synthase	ic50	0.0012	uM
Pemetrexed	1894188: Inhibition of thymidylate synthase (unknown origin) assessed as inhibition constant	ki	0.0013	uM
(2R)-2-[[4-[(2,6-dimethyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]benzoyl]amino]pentanedioic acid	221979: Compound was tested for TS activity against human Thymidylate synthase by tight binding kinetics	ki	0.0013	uM
(2S)-2-(benzo[g][1,2,3]benzoxadiazol-5-ylsulfonylamino)-3-[4-[5-(dimethylamino)naphthalen-1-yl]sulfonyloxyphenyl]propanoic acid	238383: Inhibitory constant against human thymidylate synthase	ki	0.0015	uM
N,5-dimethyl-2-methylimino-N-[(4-morpholin-4-ylsulfonylphenyl)methyl]-1H-benzo[cd]indol-6-amine	212333: Compound was evaluated for the inhibitory constant of human thymidylate synthase	ki	0.0020	uM
6-N-methyl-6-N-[(4-morpholin-4-ylsulfonylphenyl)methyl]benzo[cd]indole-2,6-diamine	212333: Compound was evaluated for the inhibitory constant of human thymidylate synthase	ki	0.0020	uM
(2S)-4-[1-(carboxymethyl)tetrazol-5-yl]-2-[[4-[(2,7-dimethyl-4-oxo-3H-quinazolin-6-yl)methyl-ethynylamino]-2-fluorobenzoyl]amino]butanoic acid	1567370: Inhibition of thymidylate synthase (unknown origin)	ic50	0.0024	uM
(2S)-2-[6-[methyl-[(3-methyl-1-oxo-2H-benzo[f]quinazolin-9-yl)methyl]amino]-3-oxo-1H-isoindol-2-yl]pentanedioic acid	212325: The compound was tested for inhibitory activity against thymidylate synthase (purified recombinant human gene) from Escherichia coli	ki	0.0025	uM
(2S)-2-[[4-[(3-amino-1-oxo-5,6-dihydro-2H-benzo[f]quinazolin-9-yl)sulfonylamino]benzoyl]amino]pentanedioic acid	212336: Inhibition of purified human thymidylate synthase isolated from an Escherichia coli harboring thy A gene cloned from SV40 transformed human fibroblast cells	ki	0.0025	uM
methyl 3-[(1S)-1-[[4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]benzoyl]amino]-2-methoxy-2-oxoethyl]benzoate	1959939: Inhibition of human TS	ic50	0.0030	uM
methyl (2S)-2-[[4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]benzoyl]amino]-2-phenylacetate	1959939: Inhibition of human TS	ic50	0.0030	uM
(2S)-2-[[4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]benzoyl]amino]-2-phenylacetic acid	1959939: Inhibition of human TS	ic50	0.0030	uM
(2S)-2-[[4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]benzoyl]amino]-2-(3-hydroxyphenyl)acetic acid	1959939: Inhibition of human TS	ic50	0.0030	uM
3-[(S)-[[4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]benzoyl]amino]-carboxymethyl]benzoic acid	1959939: Inhibition of human TS	ic50	0.0030	uM
methyl (2S)-2-[[4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]benzoyl]amino]-2-(3-hydroxyphenyl)acetate	1959939: Inhibition of human TS	ic50	0.0030	uM
methyl (2S)-2-[[4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]benzoyl]amino]-3-(4-hydroxyphenyl)propanoate	1959939: Inhibition of human TS	ic50	0.0030	uM
methyl 3-[[4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]benzoyl]amino]benzoate	1959939: Inhibition of human TS	ic50	0.0030	uM
methyl (2S)-2-[[4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]benzoyl]amino]-3-phenylpropanoate	1959939: Inhibition of human TS	ic50	0.0030	uM
methyl (2S)-2-[[4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]benzoyl]amino]-3-(3,4-dihydroxyphenyl)propanoate	1959939: Inhibition of human TS	ic50	0.0030	uM
methyl (2S)-2-[[5-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]thiophene-2-carbonyl]amino]-2-phenylacetate	1959939: Inhibition of human TS	ic50	0.0030	uM
3-[[4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]benzoyl]amino]benzoic acid	1959939: Inhibition of human TS	ic50	0.0030	uM
(2S)-2-[[4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]benzoyl]amino]-3-phenylpropanoic acid	1959939: Inhibition of human TS	ic50	0.0030	uM
4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]-N-[(1S)-2-hydroxy-1-phenylethyl]benzamide	1959939: Inhibition of human TS	ic50	0.0030	uM
4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]-N-[(1R)-1-phenylethyl]benzamide	1959939: Inhibition of human TS	ic50	0.0030	uM
methyl (2S)-2-[[4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]benzoyl]amino]-3-(1H-indol-3-yl)propanoate	1959939: Inhibition of human TS	ic50	0.0030	uM
methyl (2R)-2-[[4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]benzoyl]amino]-2-phenylacetate	1959939: Inhibition of human TS	ic50	0.0030	uM
methyl (2S)-2-[[4-[(2-amino-6-methyl-4-oxo-3H-quinazolin-5-yl)sulfanyl]benzoyl]amino]-3-(4-aminophenyl)propanoate	1959939: Inhibition of human TS	ic50	0.0030	uM
2-amino-5-naphthalen-2-ylsulfanyl-3,9-dihydropyrimido[4,5-b]indol-4-one	1059662: Inhibition of human TS using dUMP and methylene-THF as substrate by kaleidagraph analysis	ki	0.0033	uM
6-N,5-dimethyl-6-N-[(2-methyl-4-pyridinyl)methyl]benzo[cd]indole-2,6-diamine	212458: Inhibitory effect against recombinant human thymidylate synthase	ki	0.0040	uM
(2S)-2-[6-[(3-methyl-1-oxo-2H-benzo[f]quinazolin-9-yl)methylamino]-3-oxo-1,2-benzothiazol-2-yl]pentanedioic acid	212325: The compound was tested for inhibitory activity against thymidylate synthase (purified recombinant human gene) from Escherichia coli	ki	0.0040	uM
(2S)-3-[4-[5-(dimethylamino)naphthalen-1-yl]sulfonyloxyphenyl]-2-[(6-nitronaphthalen-1-yl)sulfonylamino]propanoic acid	238383: Inhibitory constant against human thymidylate synthase	ki	0.0041	uM
2-[[4-[(2-amino-4-oxo-3H-quinazolin-6-yl)methyl-prop-2-ynylamino]benzoyl]amino]pentanedioic acid	212331: Binding affinity against human thymidylate synthase	ki	0.0045	uM
2-[[4-[[4-[[2-[[4-[(2-amino-4-oxo-3H-quinazolin-6-yl)methyl-ethynylamino]benzoyl]amino]-4-carboxybutanoyl]amino]-4-carboxybutanoyl]amino]-4-carboxybutanoyl]amino]pentanedioic acid	211796: Inhibitory activity against thymidylate synthase of Streptococcus faecium	ic50	0.0047	uM
[(2R,3R,4S,5R)-4-fluoro-5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl dihydrogen phosphate	328153: Binding affinity to human recombinant thymidylate synthase	ki	0.0048	uM
2-[[4-[[4-[[4-[(2-amino-4-oxo-3H-quinazolin-6-yl)methyl-ethynylamino]benzoyl]amino]-4-carboxybutanoyl]amino]-4-carboxybutanoyl]amino]pentanedioic acid	211796: Inhibitory activity against thymidylate synthase of Streptococcus faecium	ic50	0.0055	uM
(2S)-2-[[4-[(3-methyl-1-oxo-2H-benzo[f]quinazolin-9-yl)sulfonylamino]benzoyl]amino]pentanedioic acid	212325: The compound was tested for inhibitory activity against thymidylate synthase (purified recombinant human gene) from Escherichia coli	ki	0.0055	uM
6-N,5-dimethyl-6-N-(pyridin-4-ylmethyl)benzo[cd]indole-2,6-diamine	212458: Inhibitory effect against recombinant human thymidylate synthase	ki	0.0060	uM
5-[(4-morpholin-4-ylsulfonylphenyl)methyl]-1,6,7,8-tetrahydroimidazo[4,5-g]quinolin-2-amine	212334: Inhibition of human Thymidylate synthase (TS)	ki	0.0060	uM

CTD chemical–gene interactions

185 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Fluorouracil	affects cotreatment, decreases expression, increases expression, affects expression, increases reaction (+7 more)	75
Cisplatin	decreases reaction, decreases stability, affects expression, decreases degradation, increases activity (+8 more)	8
Methotrexate	decreases response to substance, increases response to substance, decreases expression, increases expression, affects response to substance	8
Arsenic Trioxide	affects activity, affects expression, affects cotreatment, decreases expression, increases expression (+1 more)	7
sodium arsenite	affects cotreatment, increases abundance, increases expression, affects binding, increases reaction (+1 more)	5
Oxaliplatin	decreases expression, affects cotreatment, affects response to substance, increases response to substance	5
Leucovorin	decreases expression, increases response to substance, affects response to substance, affects cotreatment	5
bisphenol A	affects expression, decreases expression, increases expression	4
raltitrexed	decreases reaction, increases expression, decreases activity, affects response to substance	4
benzyloxycarbonylleucyl-leucyl-leucine aldehyde	decreases expression, decreases reaction, affects cotreatment, decreases stability	4
(+)-JQ1 compound	affects binding, decreases expression	4
Benzo(a)pyrene	increases expression, decreases expression	4
Estradiol	increases expression, decreases reaction	4
Floxuridine	affects response to substance, decreases response to substance, increases response to substance	4
Folic Acid	affects expression, decreases activity, increases expression	4
Cyclosporine	affects cotreatment, decreases expression	4
Paclitaxel	decreases reaction, affects expression, increases expression, increases response to substance, affects cotreatment (+1 more)	4
Pemetrexed	increases expression, decreases activity, affects response to substance, decreases reaction	3
Capecitabine	affects expression, affects cotreatment, affects response to substance, decreases response to substance	3
Rotenone	decreases expression	3
Tetrachlorodibenzodioxin	decreases reaction, increases expression, decreases expression	3
Tretinoin	decreases expression	3
Aflatoxin B1	affects expression, increases expression	3
Particulate Matter	increases abundance, affects cotreatment, decreases abundance, increases expression, decreases expression	3
methylselenic acid	decreases expression, affects expression	2
trichostatin A	decreases expression, decreases reaction, increases response to substance, increases degradation	2
cobaltous chloride	affects cotreatment, increases expression, decreases expression	2
doxifluridine	affects expression, affects cotreatment, decreases response to substance	2
2,3-dimethoxy-1,4-naphthoquinone	increases expression	2
palbociclib	decreases expression	2

ChEMBL screening assays

376 unique, capped per target: 373 binding, 2 admet, 1 functional

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1029822	Binding	Inhibition of human thymidylate synthase	Novel non-active site inhibitor of Cryptosporidium hominis TS-DHFR identified by a virtual screen. — *Bioorg Med Chem Lett*
CHEMBL4409186	ADMET	Inhibition of recombinant human His6-tagged TS using dUMP and 5,10-methylenetetrahydrofolate as substrate by spectrometry	Structure activity relationship towards design of cryptosporidium specific thymidylate synthase inhibitors. — *Eur J Med Chem*
CHEMBL821247	Functional	Compound was evaluated for time-dependent loss of activity with use of 15 nM of dTMP synthetase enzyme from chick embryo in the presence of 0.15 nM of CH2-H4 folate at about 20 seconds	Interaction of N4-hydroxy-2’-deoxycytidylic acid with thymidylate synthetase. — *J Med Chem*

Cellosaurus cell lines

11 cell lines: 10 cancer cell line, 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_4J75	SKG-I/TS	Cancer cell line	Female
CVCL_4J77	SKG-II/TS	Cancer cell line	Female
CVCL_B7N5	A549/TS1	Cancer cell line	Male
CVCL_B7N6	A549/TS2	Cancer cell line	Male
CVCL_B7N7	H1299/TS1	Cancer cell line	Male
CVCL_B7N8	H1299/TS2	Cancer cell line	Male
CVCL_B7N9	PC9/TS1	Cancer cell line	Male
CVCL_B7NA	PC9/TS2	Cancer cell line	Male
CVCL_D2DJ	Abcam HCT 116 TYMS KO	Cancer cell line	Male
CVCL_D2PD	Abcam THP-1 TYMS KO	Cancer cell line	Male

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

19 trials:

NCT	Phase	Status	Title
NCT00004787	Phase 2	COMPLETED	Phase II Pilot Study of Granulocyte Colony-Stimulating Factor for Inherited Bone Marrow Failure Syndromes
NCT01659606	Phase 2	ACTIVE_NOT_RECRUITING	Radiation- and Alkylator-free Bone Marrow Transplantation Regimen for Patients With Dyskeratosis Congenita
NCT03579875	Phase 2	RECRUITING	Alpha/Beta TCD HCT in Patients With Inherited BMF Disorders
NCT04232085	Phase 2	RECRUITING	Regenerative Medicine to Restore Hematopoiesis and Immune Function in Immunodeficiencies and Inherited Bone Marrow Failures
NCT04638517	Phase 2	TERMINATED	The TELO-SCOPE Study: Attenuating Telomere Attrition With Danazol. Is There Scope to Dramatically Improve Health Outcomes for Adults and Children With Pulmonary Fibrosis
NCT01917708	Phase 1	COMPLETED	Bone Marrow Transplant With Abatacept for Non-Malignant Diseases
NCT06477614	Phase 1	RECRUITING	Anti-cancer DC Cell Vaccination to Treat Solid Tumors
NCT06817590	Phase 1	RECRUITING	Nucleoside Therapy in Patients With Telomere Biology Disorders
NCT07628972	Phase 1	RECRUITING	Quercetin Dyskeratosis Congenita (DC)/Telomere Biology Disorders (TBD)
NCT00455312	Phase 2/3	COMPLETED	Stem Cell Transplant (SCT) for Dyskeratosis Congenita or SAA
NCT01001598	Phase 1/2	TERMINATED	Safety and Efficacy Trial of Danazol in Patients With Fanconi Anemia or Dyskeratosis Congenita
NCT00027274	Not specified	RECRUITING	Cancer in Inherited Bone Marrow Failure Syndromes
NCT00499070	Not specified	COMPLETED	Assessing Immune Function in Young Patients With Cytopenia That Did Not Respond to Treatment
NCT01319851	Not specified	TERMINATED	Alefacept and Allogeneic Hematopoietic Stem Cell Transplantation
NCT02162420	Not specified	COMPLETED	Hematopoietic Stem Cell Transplant for Dyskeratosis Congenita or Severe Aplastic Anemia
NCT02720679	Not specified	RECRUITING	Investigation of the Genetics of Hematologic Diseases
NCT03050268	Not specified	RECRUITING	Familial Investigations of Childhood Cancer Predisposition
NCT04959188	Not specified	COMPLETED	Needs Assessment for Individuals and Families Affected by Dyskeratosis Congenita (DC) and Related Telomere Biology Disorders (TBD)
NCT06731036	Not specified	AVAILABLE	Expanded Access to CD34+ Selection Utilizing Miltenyi CliniMACS Prodigy® for Patients Receiving Peripheral Blood Stem Cell Transplantations and Stem Cell Boosts

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for TYMS across ~30M SureChEMBL compounds — explore on Sugi Predict.