TYRO3

Summary

TYRO3 (TYRO3 protein tyrosine kinase, HGNC:12446) is a protein-coding gene on chromosome 15q15.1, encoding Tyrosine-protein kinase receptor TYRO3 (Q06418). Receptor tyrosine kinase that transduces signals from the extracellular matrix into the cytoplasm by binding to several ligands including TULP1 or GAS6.

The gene is part of a 3-member transmembrane receptor kinase receptor family with a processed pseudogene distal on chromosome 15. The encoded protein is activated by the products of the growth arrest-specific gene 6 and protein S genes and is involved in controlling cell survival and proliferation, spermatogenesis, immunoregulation and phagocytosis. The encoded protein has also been identified as a cell entry factor for Ebola and Marburg viruses.

Source: NCBI Gene 7301 — RefSeq curated summary.

At a glance

• GWAS associations: 11
• Clinical variants (ClinVar): 137 total
• GTEx eGene: eQTL in 22 tissues, sQTL in 1 (q < 0.05)
• ChEMBL bioactivity: 30 clinical-phase molecules tested; no curated mechanism-of-action drug
• Constraint (gnomAD): pLI 0.05 (LoF-tolerant), LOEUF 0.56 (moderately constrained)
• MANE Select transcript: NM_006293
• Notable: 137 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:12446
Approved symbol	TYRO3
Name	TYRO3 protein tyrosine kinase
Location	15q15.1
Locus type	gene with protein product
Status	Approved
Aliases	Dtk, Brt, Tif, Sky, Etk-2, Rek
Ensembl gene	ENSG00000092445
Ensembl biotype	protein_coding
OMIM	600341
Entrez	7301

Gene structure

Transcript identifiers

Ensembl transcripts: 34 — 17 protein_coding, 13 nonsense_mediated_decay, 4 retained_intron

MANE Select: ENST00000263798

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1, TSL 2: 1, TSL 4: 2, TSL 5: 4

ENST00000263798, ENST00000559066, ENST00000559815, ENST00000559851, ENST00000560162, ENST00000560227, ENST00000560992, ENST00000568343, ENST00000568490, ENST00000869538, ENST00000869539, ENST00000869540, ENST00000869541, ENST00000938082, ENST00000938083, ENST00000938084, ENST00000941856, ENST00000941857, ENST00000941858, ENST00000941859, ENST00000988629, ENST00001035455, ENST00001035456, ENST00001035457, ENST00001035458, ENST00001060367, ENST00001060368, ENST00001122280, ENST00001122281, ENST00001122282, ENST00001122283, ENST00001122284, ENST00001122285, ENST00001137956

RefSeq mRNA: 2 — MANE Select: NM_006293 NM_001330264, NM_006293

CCDS: CCDS10080, CCDS81866

Canonical transcript exons

ENST00000263798 — 19 exons

Exon	Start	End
ENSE00000586436	41568878	41569022
ENSE00000586447	41570240	41570340
ENSE00000586453	41570604	41570699
ENSE00000586489	41561539	41561639
ENSE00000586496	41564184	41564270
ENSE00000676763	41562548	41562718
ENSE00000676767	41565026	41565141
ENSE00000676806	41568217	41568362
ENSE00000676824	41571038	41571118
ENSE00000676867	41573679	41573815
ENSE00001152503	41577886	41583589
ENSE00001152512	41559212	41559381
ENSE00003466090	41571595	41571687
ENSE00003476947	41573002	41573111
ENSE00003617228	41572443	41572564
ENSE00003625993	41567360	41567537
ENSE00003636584	41570027	41570156
ENSE00003658223	41561127	41561310
ENSE00003683162	41573308	41573467

Expression profiles

Bgee: expression breadth ubiquitous, 252 present calls, max score 98.74.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 13.2896 / max 166.0870, expressed in 1529 samples.

Highest expression (Bgee): frontal pole, Brodmann (1909) area 10, paraflocculus, prefrontal cortex, middle frontal gyrus.

Genetic regulation across tissues (GTEx eQTL / sQTL)

TYRO3 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 22 tissues and its splicing (sQTL) in 1 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 23 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Lung	eqtl	2.6e-51	-0.62	15:41554978:T:G
Thyroid	eqtl	4.3e-12	-0.30	15:41554978:T:G
Nerve Tibial	eqtl	2.9e-10	-0.67	15:41579269:C:G
Cells Cultured fibroblasts	eqtl	3.7e-10	+0.13	15:41539155:C:A
Heart Left Ventricle	eqtl	4.5e-06	+0.24	15:41588009:A:G
Esophagus Muscularis	eqtl	5.7e-05	-0.56	15:41586718:TTTTG:T
Brain Putamen basal ganglia	eqtl	3.0e-04	+0.42	15:41718427:G:A
Skin Sun Exposed Lower leg	eqtl	1.6e-03	+0.09	15:41577225:G:A
Esophagus Gastroesophageal Junction	eqtl	3.3e-03	-0.52	15:42251451:T:A
Muscle Skeletal	eqtl	6.5e-03	-0.13	15:41549880:C:G
Artery Tibial	eqtl	6.9e-03	-0.53	15:41586718:TTTTG:T
Brain Caudate basal ganglia	eqtl	7.1e-03	+0.32	15:41600221:A:T
Brain Cortex	eqtl	1.9e-02	-0.30	15:41496245:G:A
Brain Hypothalamus	eqtl	2.1e-02	+0.16	15:41809496:G:A
Prostate	eqtl	2.1e-02	+0.54	15:40677440:G:A
Pancreas	eqtl	2.8e-02	-0.70	15:41832127:G:A
Skin Not Sun Exposed Suprapubic	eqtl	3.4e-02	-0.09	15:41567875:A:G
Artery Aorta	sqtl	3.7e-02	+0.73	15:41113119:T:C
Stomach	eqtl	3.7e-02	+0.72	15:42464116:C:CAGATCACAAGGTCAGGAGTTCAAGATCAGTCTGACCAACATGGTGAAAACCCGTCTCTACTAAAATTACTAAAATT
Small Intestine Terminal Ileum	eqtl	4.3e-02	-1.03	15:42025265:C:T

FANTOM5 promoters

5 alternative TSS:

Promoter ID	TPM avg	Samples expressed
146197	8.8164	1459
146194	2.5007	953
146195	1.8439	638
146196	0.0709	34
207479	0.0577	28

Top tissues by expression

showing 100 of 289 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
frontal pole	UBERON:0002795	98.74	gold quality
Brodmann (1909) area 10	UBERON:0013541	98.49	gold quality
paraflocculus	UBERON:0005351	98.31	gold quality
prefrontal cortex	UBERON:0000451	98.01	gold quality
middle frontal gyrus	UBERON:0002702	97.85	gold quality
right hemisphere of cerebellum	UBERON:0014890	97.64	gold quality
cerebellar cortex	UBERON:0002129	97.60	gold quality
cerebellar hemisphere	UBERON:0002245	97.60	gold quality
right frontal lobe	UBERON:0002810	97.57	gold quality
Brodmann (1909) area 9	UBERON:0013540	97.27	gold quality
cerebellum	UBERON:0002037	97.02	gold quality
frontal cortex	UBERON:0001870	96.88	gold quality
frontal lobe	UBERON:0016525	96.88	gold quality
cerebellar vermis	UBERON:0004720	96.57	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	96.45	gold quality
cingulate cortex	UBERON:0003027	96.41	gold quality
anterior cingulate cortex	UBERON:0009835	96.39	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	96.37	gold quality
neocortex	UBERON:0001950	96.35	gold quality
left ovary	UBERON:0002119	96.25	gold quality
amygdala	UBERON:0001876	95.90	gold quality
spinal cord	UBERON:0002240	95.84	gold quality
cerebral cortex	UBERON:0000956	95.48	gold quality
right ovary	UBERON:0002118	95.42	gold quality
postcentral gyrus	UBERON:0002581	95.05	gold quality
temporal lobe	UBERON:0001871	95.04	gold quality
telencephalon	UBERON:0001893	94.86	gold quality
corpus callosum	UBERON:0002336	94.73	gold quality
superior frontal gyrus	UBERON:0002661	94.70	gold quality
parietal lobe	UBERON:0001872	94.60	gold quality
Brodmann (1909) area 46	UBERON:0006483	94.49	gold quality
Ammon’s horn	UBERON:0001954	94.31	gold quality
orbitofrontal cortex	UBERON:0004167	94.13	gold quality
lower esophagus mucosa	UBERON:0035834	93.89	gold quality
entorhinal cortex	UBERON:0002728	93.67	gold quality
nucleus accumbens	UBERON:0001882	93.52	gold quality
CA1 field of hippocampus	UBERON:0003881	93.33	gold quality
putamen	UBERON:0001874	93.32	gold quality
olfactory bulb	UBERON:0002264	93.04	gold quality
caudate nucleus	UBERON:0001873	93.03	gold quality
substantia nigra	UBERON:0002038	92.95	gold quality
inferior olivary complex	UBERON:0002127	92.94	gold quality
ovary	UBERON:0000992	92.90	gold quality
central nervous system	UBERON:0001017	92.90	gold quality
brain	UBERON:0000955	92.81	gold quality
inferior vagus X ganglion	UBERON:0005363	92.72	gold quality
midbrain	UBERON:0001891	92.65	gold quality
ventricular zone	UBERON:0003053	92.61	gold quality
forebrain	UBERON:0001890	92.32	gold quality
middle temporal gyrus	UBERON:0002771	92.25	gold quality
right testis	UBERON:0004534	92.16	gold quality
dorsal motor nucleus of vagus nerve	UBERON:0002870	92.03	gold quality
subthalamic nucleus	UBERON:0001906	91.88	gold quality
lateral globus pallidus	UBERON:0002476	91.69	gold quality
hypothalamus	UBERON:0001898	91.43	gold quality
occipital lobe	UBERON:0002021	91.40	gold quality
globus pallidus	UBERON:0001875	91.35	gold quality
substantia nigra pars reticulata	UBERON:0001966	91.30	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	91.21	gold quality
left testis	UBERON:0004533	91.21	gold quality
primary visual cortex	UBERON:0002436	91.17	gold quality
stromal cell of endometrium	CL:0002255	91.14	gold quality
cortical plate	UBERON:0005343	91.14	gold quality
medial globus pallidus	UBERON:0002477	91.08	gold quality
medulla oblongata	UBERON:0001896	90.34	gold quality
renal glomerulus	UBERON:0000074	90.03	gold quality
dorsal plus ventral thalamus	UBERON:0001897	89.85	gold quality
ventral tegmental area	UBERON:0002691	89.62	gold quality
metanephric glomerulus	UBERON:0004736	89.59	gold quality
substantia nigra pars compacta	UBERON:0001965	89.42	gold quality
ganglionic eminence	UBERON:0004023	89.36	gold quality
testis	UBERON:0000473	88.92	gold quality
omental fat pad	UBERON:0010414	88.18	gold quality
peritoneum	UBERON:0002358	88.14	gold quality
superior vestibular nucleus	UBERON:0007227	88.13	gold quality
embryo	UBERON:0000922	87.98	gold quality
adipose tissue of abdominal region	UBERON:0007808	87.67	gold quality
skin of leg	UBERON:0001511	87.59	gold quality
pons	UBERON:0000988	87.40	gold quality
adrenal tissue	UBERON:0018303	87.38	gold quality
skin of abdomen	UBERON:0001416	87.32	gold quality
peripheral nervous system	UBERON:0000010	87.23	gold quality
tibial nerve	UBERON:0001323	87.23	gold quality
Brodmann (1909) area 23	UBERON:0013554	86.02	gold quality
diaphragm	UBERON:0001103	85.89	gold quality
esophagus mucosa	UBERON:0002469	85.83	gold quality
lateral nuclear group of thalamus	UBERON:0002736	85.83	gold quality
zone of skin	UBERON:0000014	85.64	gold quality
metanephros	UBERON:0000081	85.38	gold quality
vena cava	UBERON:0004087	85.12	silver quality
sural nerve	UBERON:0015488	85.03	gold quality
adult mammalian kidney	UBERON:0000082	84.85	gold quality
type B pancreatic cell	CL:0000169	84.81	gold quality
endometrium epithelium	UBERON:0004811	84.80	gold quality
gingival epithelium	UBERON:0001949	84.66	silver quality
gingiva	UBERON:0001828	84.07	gold quality
tongue squamous epithelium	UBERON:0006919	84.05	silver quality
cortex of kidney	UBERON:0001225	83.82	gold quality
adipose tissue	UBERON:0001013	83.68	gold quality
epithelium of esophagus	UBERON:0001976	83.01	gold quality

Single-cell (SCXA)

Detected in 4 experiment(s), a significant marker in 4.

Experiment	Marker?	Max mean expression
E-GEOD-114530	yes	895.69
E-ENAD-27	yes	68.10
E-HCAD-10	yes	17.99
E-ANND-3	yes	5.57

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 79 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Frontal cortex	tissue	97.9
Caudate putamen	tissue	93.5
Corpus callosum	tissue	54.5
Spinal cord	tissue	49.8
Hippocampal formation	tissue	49.4
Postcentral gyrus	tissue	48.7
Cerebral cortex	tissue	47.0	high
Motor cortex	tissue	47.0
Hippocampus	tissue	46.5	medium
Basal ganglia	tissue	46.3	not detected
Ovary	tissue	44.4	not detected
Nucleus accumbens	tissue	44.0
Putamen	tissue	43.7
Insular cortex	tissue	41.5
Retrosplenial cortex	tissue	40.4
Entorhinal cortex	tissue	40.3
Prefrontal cortex	tissue	39.8
Medulla oblongata	tissue	39.7
Retrosplenial and cingulate cortex	tissue	39.7
Temporal cortex	tissue	38.6
Ventral forebrain	tissue	37.3
Somatosensory cortex	tissue	37.0
Midbrain	tissue	36.0
Locus coeruleus	tissue	35.5
Occipital cortex	tissue	33.6
Cerebellum	tissue	33.5	medium
Septum	tissue	30.1
Amygdala	tissue	29.8
Substantia nigra	tissue	29.8
Olfactory bulb	tissue	26.5
Pons	tissue	25.6
Thalamus	tissue	25.5
Superior colliculi	tissue	25.1
Adipose tissue	tissue	20.1	not detected
Periaqueductal gray	tissue	18.6
Testis	tissue	17.6	medium
Hypothalamus	tissue	17.2
Skin 1	tissue	13.0	medium
Esophagus	tissue	12.3	medium
Choroid plexus	tissue	12.2
Fallopian tube	tissue	10.8	not detected
Pancreas	tissue	9.2	not detected
Kidney	tissue	5.9	medium
Seminal vesicle	tissue	5.7	low
Placenta	tissue	5.4	low
Spleen	tissue	5.1	not detected
Endometrium 1	tissue	4.3	not detected
Smooth muscle	tissue	4.1	low
Vagina	tissue	3.7	low
Tonsil	tissue	3.5	medium
Epididymis	tissue	3.3	low
Adrenal gland	tissue	3.3	medium
Stomach 1	tissue	3.0	low
Lung	tissue	2.5	high
Prostate	tissue	2.5	not detected
Retina	tissue	2.4
Breast	tissue	2.3	medium
Gallbladder	tissue	2.3	medium
Small intestine	tissue	2.2	medium
Urinary bladder	tissue	1.9	medium

Brain sub-regions (HPA Brain Atlas): detected in 190; highest nTPM — Parieto-temporal junction (white matter) (89.0), Claustrum (88.3), Dorsal funiculus (white matter) (83.6), Perirhinal gyrus (82.6), Entorhinal gyrus (81.3).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): DNMT3B

Functional genomics

gnomAD constraint: pLI 0.0529, LOEUF 0.565, missense Z 2.95 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000263798 — one region, missense o/e 0.73.

Literature-anchored findings (GeneRIF, showing 40)

• Gas6 receptors were not upregulated in any of the allograft groups, except for the Axl receptor, which increased only in acute tubular necrosis. (PMID:12768229)
• Tyro3 may have roles in signal transduction and cell adhesion (PMID:14623883)
• Axl, Sky and Mer are Gas6 receptors that enhance platelet activation and regulate thrombotic responses (PMID:15733062)
• Results identify and characterise a novel interaction between RanBPM and the related receptor tyrosine kinases, Axl and Sky. (PMID:15964779)
• Here we show the involvement of members of the Tyro3 receptor tyrosine kinase family-Axl, Dtk, and Mer-in cell entry of filoviruses. (PMID:17005688)
• Possible strategies for targeted inhibition of the TAM family in the treatment of human cancer. (PMID:18620092)
• Results identified the receptor protein tyrosine kinase TYRO3 as an upstream regulator of MITF expression by a genome-wide gain-of-function cDNA screen. (PMID:19805117)
• Protein S controls hypoxic/ischemic blood-brain barrier disruption through the TAM receptor Tyro3 and sphingosine 1-phosphate receptor. (PMID:20348395)
• Gas6 and Tyro3, Axl and Mer (TAM) receptors have roles in human and murine platelet activation and thrombus stabilization (PMID:20546121)
• correlation of decreased protein S levels with lupus disease activity is consistent with a role for the TAM receptors in scavenging apoptotic cells and controlling inflammation (PMID:20637106)
• Findings indicate genetic association between MERTK and TYRO3 allelic variants and carotid atherosclerosis. (PMID:20664904)
• Our findings suggest that a TYRO3/AXL-GAS6 autocrine circuit sustains the malignant features of thyroid cancer cells (PMID:21343401)
• expression is downregulated in atherosclerotic carotid plaque (PMID:21384080)
• plasma concentrations of sMer and sTyro3 were significantly increased in patients with active systemic lupus erythematosis and Rheumatoid arthritis (PMID:21496228)
• analysis of novel and selective spiroindoline-based inhibitors of Sky kinase (PMID:22119469)
• Axl,Tyro3,DC-SIGN and LSECtin are identified as new virus receptors for Lassa virus cell entry. (PMID:22156524)
• Gas6, a ligand of Tyro3, exerts an autocrine activities though Tyro3 and Axl in a subgroup of leiomyosarcoma. (PMID:23354874)
• data indicate that Tyro3 may confer increased survival signals in melanoma cells and can be stymied using inhibitory mAbs (PMID:23570341)
• These findings indicate that Tyro3 is a critical signal for synovial hyperplasia, osteoclast differentiation and bone erosion during arthritis. (PMID:23632195)
• [review] Receptor tyrosine kinases Tyro-3, Axl and Mer, collectively designated as TAM, are involved in the clearance of apoptotic cells. (PMID:23662598)
• Low expression of the Syk gene may play an important role in tumorigenesis in esophageal cancer. (PMID:23865365)
• The effects of TYRO3-knockdown by small interfering RNA (siRNA) on proliferation, cell-cycle distribution, and cell signaling in different breast neoplasm cell lines were compared. (PMID:24982338)
• These studies demonstrate that, despite their similarity, TYRO3, AXL, and MER are likely to perform distinct functions in both immunoregulation and the recognition and removal of ACs. (PMID:25074926)
• Tetherin phosphorylation induces the recruitment of Syk which is required for downstream NF-kappaB activation. (PMID:25211072)
• the results of the present study demonstrated that the acquired taxol resistance of ovarian cancer cells was associated with ROS-dependent upregulation in the expression of Tyro3 RTK and the subsequent activation of Akt. (PMID:25815442)
• Significantly increased levels of sMer, sTyro3 and sAxl may be important factors contributing to the deficit in phagocytosis ability in systemic lupus erythematosus . (PMID:25878564)
• The mRNA expression levels of Tyro-3, Axl were decreased in pSS patients. When considering the plasma level, increased levels of soluble Mer was observed with statistically significant difference. (PMID:25881761)
• these data suggest that Tyro3 contributes significantly to tumor growth, aggressiveness and liver dysfunction (PMID:26573872)
• Tyro3 gene dosage modulates Mertk-associated retinal degeneration, provide strong evidence for a direct role for TYRO3 in RPE phagocytosis, and suggest that an eQTL can modify a recessive Inherited photoreceptor degenerations. (PMID:26656104)
• genetic ablation of a receptor tyrosine kinase encoded byTyro3in mice or the functional neutralization of its ortholog in human dendritic cells resulted in enhanced type 2 immunity. (PMID:27034374)
• TYRO3 is overexpressed in the early stage of colon cancer development and aberrant expression of TYRO3 promotes tumorigenesis and induces EMT through the regulation of SNAI1. (PMID:27132510)
• Study identified the Gas6/TAM receptor pathway with Tyro3 and Mer as novel targets in colorectal cancer. (PMID:27486820)
• In this paper, we review the biology of the Gas6/Tyro3, Axl, and MerTK(collectively named TAM system)and the current evidence supporting its potential role in the pathogenesis of multiple sclerosis . (PMID:27801848)
• Phosphatidylserine mediated hyperactivation of TYRO3.TYRO3 promotes epithelial cell efferocytosis in a tyrosine kinase-dependent manner.TYRO3 role in AKT-dependent drug resistance. (PMID:28184013)
• Taken together, our data indicate that elevated plasma Gas6 levels is associated with the severity of disease during HTNV infection in humans, suggesting that Gas6 may play an important role by binding with Tyro3 on monocytes. (PMID:28537534)
• Patients with macroalbuminuria diabetes had higher circulating levels of sMer and more urinary soluble Tyro3 and sMer than normoalbuminuric diabetics. Increased clearance of sTyro3 and sMer was associated with loss of tubular Tyro3 and Mer expression in diabetic nephropathy tissue. During in vitro diabetes, human kidney cells had down-regulation of Tyro3 and Mer mRNA and increased shedding of sTyro3 and sMer. (PMID:28668213)
• These results show that TYRO3, AXL and GAS6 are expressed at higher levels in LMS and expression of its ligands correlates to a worse PFS in LMS patients. (PMID:29024938)
• Serum sTyro3 levels were elevated in rheumatoid arthritis patients and correlated positively with disease activity and bone destruction, which may serve as an important participant in rheumatoid arthritis pathogenesis. (PMID:29148078)
• Data suggest that TYRO3-mediated phosphorylation of ACTN4 is involved in invasiveness of melanoma cells; TYRO3-mediated phosphorylation of ACTN4 requires FAK activation at tyrosine 397. (TYRO3 = TYRO3 protein tyrosine kinase; ACTN4 = actinin alpha 4; FAK = focal adhesion kinase isoform FAK1) (PMID:29274473)
• A meta-analysis of 3 Japanese populations (a total of 2403 Japanese adults) revealed that TYRO3 rs2297377 was associated with atopy and allergic rhinitis (OR = 1.29 and 1.31; P = 0.00041 and 0.0010, respectively). (PMID:30082152)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	tyro3	ENSDARG00000005356
mus_musculus	Tyro3	ENSMUSG00000027298
rattus_norvegicus	Tyro3	ENSRNOG00000058586

Paralogs (53): INSRR (ENSG00000027644), MUSK (ENSG00000030304), FLT4 (ENSG00000037280), EPHA3 (ENSG00000044524), ROS1 (ENSG00000047936), LTK (ENSG00000062524), ERBB3 (ENSG00000065361), TIE1 (ENSG00000066056), FGFR2 (ENSG00000066468), FGFR3 (ENSG00000068078), EPHA8 (ENSG00000070886), FGFR1 (ENSG00000077782), EPHA6 (ENSG00000080224), FLT1 (ENSG00000102755), MET (ENSG00000105976), EPHB6 (ENSG00000106123), PDGFRB (ENSG00000113721), EPHA4 (ENSG00000116106), TEK (ENSG00000120156), FLT3 (ENSG00000122025), KDR (ENSG00000128052), EPHB2 (ENSG00000133216), PDGFRA (ENSG00000134853), EPHA7 (ENSG00000135333), IGF1R (ENSG00000140443), NTRK3 (ENSG00000140538), ERBB2 (ENSG00000141736), EPHA2 (ENSG00000142627), EPHA5 (ENSG00000145242), EGFR (ENSG00000146648), EPHA1 (ENSG00000146904), NTRK2 (ENSG00000148053), MERTK (ENSG00000153208), EPHB1 (ENSG00000154928), KIT (ENSG00000157404), FGFR4 (ENSG00000160867), DDR2 (ENSG00000162733), RYK (ENSG00000163785), MST1R (ENSG00000164078), LMTK2 (ENSG00000164715), RET (ENSG00000165731), AXL (ENSG00000167601), ROR2 (ENSG00000169071), ALK (ENSG00000171094), INSR (ENSG00000171105), ERBB4 (ENSG00000178568), CSF1R (ENSG00000182578), EPHB3 (ENSG00000182580), EPHA10 (ENSG00000183317), ROR1 (ENSG00000185483), EPHB4 (ENSG00000196411), NTRK1 (ENSG00000198400), DDR1 (ENSG00000204580)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:104294) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 16 distinct phenotype terms.

Mouse phenotype (MP)	Records
abnormal heart morphology	1
enlarged heart	1
abnormal thymus morphology	1
enlarged thymus	1
abnormal testis morphology	1
small testis	1
abnormal lung morphology	1
abnormal skin morphology	1
abnormal eye morphology	1
abnormal tooth morphology	1
abnormal digit morphology	1
abnormal lymph node morphology	1
polysyndactyly	1
increased eosinophil cell number	1
abnormal seizure response to inducing agent	1
increased circulating creatine kinase level	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Felis catus	A0M8S8	100.0%	Diamond
Neofelis nebulosa	Q07E37	100.0%	Diamond
Pan troglodytes	Q2QLF1	99.8%	Diamond
Gorilla gorilla gorilla	Q2IBF2	99.7%	Diamond
Pongo abelii	Q2IBD8	99.5%	Diamond
Papio anubis	A0M8R7	99.3%	Diamond
Colobus guereza	Q07DZ1	99.3%	Diamond
Chlorocebus aethiops	Q2IBA6	99.3%	Diamond
Aotus nancymaae	Q07DV8	99.1%	Diamond
Nomascus leucogenys	Q07DY1	99.1%	Diamond
Ateles geoffroyi	Q09YL1	99.1%	Diamond
Saimiri boliviensis boliviensis	Q09YH7	99.0%	Diamond
Gallus gallus	P08941	98.7%	Diamond
Plecturocebus moloch	Q2QLC0	98.6%	Diamond
Callithrix jacchus	Q2QLG5	97.7%	Diamond
Ovis aries	Q09YI9	97.5%	Diamond
Bos taurus	Q769I5	97.5%	Diamond
Muntiacus muntjak	Q09YK0	97.4%	Diamond
Eulemur macaco macaco	Q2IBG7	97.4%	Diamond
Microcebus murinus	Q2QL89	97.4%	Diamond
Mustela putorius furo	Q07E24	96.4%	Diamond
Canis lupus familiaris	Q75ZY9	96.4%	Diamond
Xenopus tropicalis	A0JM20	95.5%	Diamond
Xenopus laevis	Q8QFP9	95.5%	Diamond
Equus caballus	Q2QLA9	94.9%	Diamond
Sus scrofa	Q2QLE0	94.9%	Diamond
Otolemur garnettii	Q2QLH6	94.0%	Diamond
Atelerix albiventris	Q00PJ8	92.0%	Diamond
Loxodonta africana	Q108U6	91.8%	Diamond
Dasypus novemcinctus	Q07E48	91.4%	Diamond
Oryctolagus cuniculus	Q09YN5	91.2%	Diamond
Rhinolophus ferrumequinum	Q2IBC0	90.1%	Diamond
Echinops telfairi	A1X150	87.8%	Diamond
Caenorhabditis briggsae	Q61G93	84.2%	Diamond
Ornithorhynchus anatinus	Q07E01	79.2%	Diamond
Drosophila melanogaster	P13368	62.3%	Diamond
Drosophila virilis	P20806	62.3%	Diamond
Dictyostelium discoideum	Q6XHA5	55.1%	Diamond
Caenorhabditis elegans	P24348	41.7%	Diamond
UR2 sarcoma virus	P00529	98.7%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
MAPKBP1	protein-coding	23005
MGA	protein-coding	23269
MIR626	ncRNA	693211
RPAP1	protein-coding	26015
ITPKA	protein-coding	3706
LTK	protein-coding	4058
JMJD7	protein-coding	100137047
JMJD7-PLA2G4B	protein-coding	8681

Protein

Protein identifiers

Tyrosine-protein kinase receptor TYRO3 — Q06418 (reviewed: Q06418)

Alternative names: Tyrosine-protein kinase BYK, Tyrosine-protein kinase DTK, Tyrosine-protein kinase RSE, Tyrosine-protein kinase SKY, Tyrosine-protein kinase TIF

All UniProt accessions (5): Q06418, H0YKZ2, H0YN24, H0YNK6, H3BPR7

UniProt curated annotations — full annotation on UniProt →

Function. Receptor tyrosine kinase that transduces signals from the extracellular matrix into the cytoplasm by binding to several ligands including TULP1 or GAS6. Regulates many physiological processes including cell survival, migration and differentiation. Ligand binding at the cell surface induces dimerization and autophosphorylation of TYRO3 on its intracellular domain that provides docking sites for downstream signaling molecules. Following activation by ligand, interacts with PIK3R1 and thereby enhances PI3-kinase activity. Activates the AKT survival pathway, including nuclear translocation of NF-kappa-B and up-regulation of transcription of NF-kappa-B-regulated genes. TYRO3 signaling plays a role in various processes such as neuron protection from excitotoxic injury, platelet aggregation and cytoskeleton reorganization. Also plays an important role in inhibition of Toll-like receptors (TLRs)-mediated innate immune response by activating STAT1, which selectively induces production of suppressors of cytokine signaling SOCS1 and SOCS3. (Microbial infection) Acts as a receptor for lassa virus and lymphocytic choriomeningitis virus, possibly through GAS6 binding to phosphatidyl-serine at the surface of virion envelope. (Microbial infection) Acts as a receptor for Ebolavirus, possibly through GAS6 binding to phosphatidyl-serine at the surface of virion envelope.

Subunit / interactions. Monomer and homodimer. Interacts (via N-terminus) with extracellular ligands TULP1 and GAS6. Interacts with PIK3R1; this interaction increases PI3-kinase activity.

Subcellular location. Cell membrane.

Tissue specificity. Abundant in the brain and lower levels in other tissues.

Post-translational modifications. Autophosphorylated.

Similarity. Belongs to the protein kinase superfamily. Tyr protein kinase family. AXL/UFO subfamily.

RefSeq proteins (2): NP_001317193, NP_006284* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000719	Prot_kinase_dom	Domain
IPR001245	Ser-Thr/Tyr_kinase_cat_dom	Domain
IPR003598	Ig_sub2	Domain
IPR003599	Ig_sub	Domain
IPR003961	FN3_dom	Domain
IPR007110	Ig-like_dom	Domain
IPR008266	Tyr_kinase_AS	Active_site
IPR011009	Kinase-like_dom_sf	Homologous_superfamily
IPR013098	Ig_I-set	Domain
IPR013783	Ig-like_fold	Homologous_superfamily
IPR017441	Protein_kinase_ATP_BS	Binding_site
IPR020635	Tyr_kinase_cat_dom	Domain
IPR036116	FN3_sf	Homologous_superfamily
IPR036179	Ig-like_dom_sf	Homologous_superfamily
IPR050122	RTK	Family

Pfam: PF00041, PF07679, PF07714

Enzyme classification (BRENDA)

• EC 2.7.10.1 — receptor protein-tyrosine kinase (BRENDA: 44 organisms, 214 substrates, 574 inhibitors, 11 Km, 0 kcat entries)

Substrate kinetics (BRENDA)

4 substrates with measured Km, best-characterized 4. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
ATP	0.0011–0.129	4
AC-DYFE-6-CHLORO-W-NHME	0.0051	1
AC-DYFGW-NHME	0.07	1
YFEW	0.232	1

Catalyzed reactions (Rhea)

• L-tyrosyl-[protein] + ATP = O-phospho-L-tyrosyl-[protein] + ADP + H(+) (RHEA:10596)

UniProt features (63 total): strand 16, modified residue 7, glycosylation site 7, sequence variant 7, sequence conflict 5, domain 5, helix 3, region of interest 2, binding site 2, topological domain 2, disulfide bond 2, signal peptide 1, chain 1, active site 1, transmembrane region 1, mutagenesis site 1

Structure

Experimental structures (PDB)

1 structures by resolution:

PDB	Title	Method	Resolution (Å)
1RHF	Crystal Structure of human Tyro3-D1D2	X-RAY DIFFRACTION	1.96

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q06418-F1	75.25	0.34

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Transferases, Kinases, Tyr protein kinases, Predicted membrane proteins, Predicted intracellular proteins, Plasma proteins, Cancer-related genes, Candidate cancer biomarkers

Protein evidence: Evidence at protein level

Antibody reliability (HPA): IH approved

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1)

Position	Role
655	proton acceptor

Ligand- & substrate-binding residues (2)

Position	Role
524–532	ATP
550	ATP

Post-translational modifications (7)

Type	Positions
Phosphoserine	466, 818, 869
Phosphotyrosine	681, 685, 686, 804

Disulfide bonds (2)

Type	Positions
Disulfide bond	64–117, 160–203

Glycosylation sites (7)

Type	Positions
N-linked (glcnac…) asparagine	63, 191, 230, 240, 293, 366, 380

Mutagenesis-validated functional residues (1)

Position	Phenotype
99	abolishes dimerization.

Function

Pathways and Gene Ontology

Reactome pathways

1 curated (TAS) of 1; 1 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

1 pathways:

ID	Pathway	Evidence
R-HSA-9918485	Dengue Virus Attachment and Entry ⚕	curated

MSigDB gene sets: 307 (showing top): GOBP_REGULATION_OF_CELL_ACTIVATION, E2F_Q4, MODULE_52, GOBP_NEGATIVE_REGULATION_OF_NEURON_APOPTOTIC_PROCESS, MODY_HIPPOCAMPUS_POSTNATAL, GOBP_NATURAL_KILLER_CELL_DIFFERENTIATION, HNF3ALPHA_Q6, E2F4DP1_01, MORF_BUB1, GOBP_INFLAMMATORY_RESPONSE, CMYB_01, GOBP_PLATELET_ACTIVATION, GOBP_NEGATIVE_REGULATION_OF_INNATE_IMMUNE_RESPONSE, GOBP_NEGATIVE_REGULATION_OF_TOLL_LIKE_RECEPTOR_SIGNALING_PATHWAY, GOCC_CELL_SURFACE

GO Biological Process (24): phagocytosis (GO:0006909), cell adhesion (GO:0007155), signal transduction (GO:0007165), cell surface receptor protein tyrosine kinase signaling pathway (GO:0007169), spermatogenesis (GO:0007283), nervous system development (GO:0007399), cell migration (GO:0016477), forebrain cell migration (GO:0021885), platelet activation (GO:0030168), secretion by cell (GO:0032940), negative regulation of toll-like receptor signaling pathway (GO:0034122), substrate adhesion-dependent cell spreading (GO:0034446), ovulation cycle (GO:0042698), apoptotic cell clearance (GO:0043277), phosphatidylinositol 3-kinase/protein kinase B signal transduction (GO:0043491), negative regulation of neuron apoptotic process (GO:0043524), negative regulation of innate immune response (GO:0045824), negative regulation of inflammatory response (GO:0050728), positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction (GO:0051897), neuron cellular homeostasis (GO:0070050), platelet aggregation (GO:0070527), positive regulation of viral life cycle (GO:1903902), protein phosphorylation (GO:0006468), symbiont entry into host cell (GO:0046718)

GO Molecular Function (11): virus receptor activity (GO:0001618), protein tyrosine kinase activity (GO:0004713), transmembrane receptor protein tyrosine kinase activity (GO:0004714), ATP binding (GO:0005524), phosphatidylinositol 3-kinase binding (GO:0043548), nucleotide binding (GO:0000166), protein kinase activity (GO:0004672), protein binding (GO:0005515), kinase activity (GO:0016301), transferase activity (GO:0016740), metal ion binding (GO:0046872)

GO Cellular Component (6): nucleus (GO:0005634), nuclear envelope (GO:0005635), endoplasmic reticulum membrane (GO:0005789), plasma membrane (GO:0005886), cell surface (GO:0009986), signaling receptor complex (GO:0043235)

Reactome top-level categories

1 top-level categories:

Category	Pathways
Dengue Virus Infection	1

GO top-level categories

showing 60 of 71 GO namespaces:

Category	Terms
cellular process	2
negative regulation of defense response	2
negative regulation of response to external stimulus	2
endocytosis	1
cell communication	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
enzyme-linked receptor protein signaling pathway	1
developmental process involved in reproduction	1
male gamete generation	1
system development	1
animal gross anatomical part developmental process	1
cell motility	1
cell migration	1
forebrain development	1
cell activation	1
blood coagulation	1
secretion	1
export from cell	1
toll-like receptor signaling pathway	1
negative regulation of immune system process	1
negative regulation of signal transduction	1
regulation of toll-like receptor signaling pathway	1
cell-substrate adhesion	1
rhythmic process	1
multicellular organismal reproductive process	1
phagocytosis	1
intracellular signaling cassette	1
negative regulation of apoptotic process	1
regulation of neuron apoptotic process	1
neuron apoptotic process	1
negative regulation of response to biotic stimulus	1
innate immune response	1
regulation of innate immune response	1
negative regulation of immune response	1
inflammatory response	1
regulation of inflammatory response	1
phosphatidylinositol 3-kinase/protein kinase B signal transduction	1
regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction	1
positive regulation of intracellular signal transduction	1
cellular homeostasis	1
symbiont entry into host cell	1
exogenous protein binding	1
protein kinase activity	1
protein tyrosine kinase activity	1
transmembrane receptor protein kinase activity	1
adenyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
anion binding	1
protein binding	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
kinase activity	1
phosphotransferase activity, alcohol group as acceptor	1
catalytic activity, acting on a protein	1
binding	1
transferase activity, transferring phosphorus-containing groups	1
catalytic activity	1
cation binding	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 5 of 41 annotations. The rest are phylogenetic / computational / electronic (IEA).

5 experimentally-supported GO terms:

GO term	NS	Evidence
positive regulation of viral life cycle	BP	mutant phenotype
cell surface	CC	direct assay
phosphatidylinositol 3-kinase binding	MF	physical interaction
protein tyrosine kinase activity	MF	direct assay
virus receptor activity	MF	direct assay

Protein interactions and networks

STRING

showing 15 of 1,022 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
TYRO3	GAS6	Q14393	970
TYRO3	PROS1	P07225	920
TYRO3	SOCS1	O15524	774
TYRO3	IFNAR1	P17181	693
TYRO3	SOCS3	O14543	677
TYRO3	PIK3CB	P42338	656
TYRO3	PIK3CD	O00329	655
TYRO3	PIK3CA	P42336	653
TYRO3	PIK3CG	P48736	637
TYRO3	TIMD4	Q96H15	596
TYRO3	STAT1	P42224	590
TYRO3	CAPN3	P20807	559
TYRO3	ADGRB1	O14514	551
TYRO3	CD209	Q9NNX6	538
TYRO3	CD4	P01730	513

IntAct

Human interaction partners of TYRO3 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

showing 30 of 103 partners by confidence:

Partner	Interaction type	MIscore	Records
KRTAP5-9	physical association	0.740	5
GRB2	physical association	0.670	3
KLK4	physical association	0.560	3
KRT40	physical association	0.560	3
KRTAP10-7	physical association	0.560	3
KRTAP10-8	physical association	0.560	3
KRTAP10-9	physical association	0.560	3
KRTAP4-2	physical association	0.560	3
KRTAP9-2	physical association	0.560	3
MDFI	physical association	0.560	3
VWC2L	physical association	0.560	3
HSP90AB1	physical association	0.560	1
TNIP1	physical association	0.550	2
CHRNB3	association	0.530	2
PATJ	direct interaction	0.440	9
GRIP1	direct interaction	0.440	5
GRIP2	direct interaction	0.440	5
MAGI2	direct interaction	0.440	5
DLG1	direct interaction	0.440	3
DLG3	direct interaction	0.440	3
DLG4	direct interaction	0.440	3
FRMPD2	direct interaction	0.440	3
IL16	direct interaction	0.440	3
LNX1	direct interaction	0.440	3
PDZK1	direct interaction	0.440	3
SCRIB	direct interaction	0.440	3
WHRN	direct interaction	0.440	3
APBA1	direct interaction	0.440	2
APBA2	direct interaction	0.440	2
DLG2	direct interaction	0.440	2

BioGRID (177 interactions; top human partners by supporting records): CHRNB3 (Affinity Capture-MS; 3 records), GRB2 (Two-hybrid; 3 records), LPAR1 (Affinity Capture-MS; 3 records), CANX (Proximity Label-MS; 2 records), CTNNB1 (Affinity Capture-MS; 2 records), GAS6 (Reconstituted Complex; 2 records), HSP90AA1 (Affinity Capture-MS; 2 records), HSPA1B (Proximity Label-MS; 2 records), IPPK (Affinity Capture-MS; 2 records), KRTAP5-9 (Two-hybrid; 2 records), PIK3R1 (Two-hybrid; 2 records), SRPRB (Proximity Label-MS; 2 records), STT3B (Proximity Label-MS; 2 records), SUPV3L1 (Proximity Label-MS; 2 records), TMEM30B (Affinity Capture-MS; 2 records)

SIGNOR signaling

showing 6 of 7 signaling interactions:

A	Effect	B	Mechanism
N-[4-[(2-amino-3-chloro-4-pyridinyl)oxy]-3-fluorophenyl]-4-ethoxy-1-(4-fluorophenyl)-2-oxo-3-pyridinecarboxamide	down-regulates	TYRO3	“chemical inhibition”
TYRO3	“up-regulates quantity by stabilization”	MLKL	phosphorylation
CBLB	“up-regulates activity”	TYRO3	ubiquitination
TYRO3	“up-regulates activity”	CBLB	phosphorylation
TYRO3	“down-regulates activity”	FOXO3	phosphorylation
GAS6	up-regulates	TYRO3	binding

Ligand–receptor pairs (CellPhoneDB) (2)

Curated ligand–receptor partners (cell-cell communication), distinct from the protein–protein interactions above.

2 ligand–receptor pairs:

Partner	This gene’s role	Signaling class
GAS6	receptor	Signaling by Growth arrest
TULP1	receptor

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 103 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Ras activation upon Ca2+ influx through NMDA receptor	5	39.6×	1e-05
Unblocking of NMDA receptors, glutamate binding and activation	5	37.8×	1e-05
Negative regulation of NMDA receptor-mediated neuronal transmission	5	37.8×	1e-05
Assembly and cell surface presentation of NMDA receptors	10	35.2×	3e-11
Dopamine Neurotransmitter Release Cycle	5	34.5×	2e-05
Long-term potentiation	5	33.0×	2e-05
Neurexins and neuroligins	11	30.1×	2e-11
Protein-protein interactions at synapses	7	25.8×	1e-06

GO biological processes:

GO term	Partners	Fold	FDR
establishment or maintenance of epithelial cell apical/basal polarity	11	65.9×	3e-15
protein localization to synapse	6	47.4×	3e-07
receptor clustering	7	45.0×	4e-08
regulation of postsynaptic membrane neurotransmitter receptor levels	7	35.8×	2e-07
protein-containing complex assembly	10	11.7×	1e-06
cell-cell adhesion	10	10.5×	4e-06
chemical synaptic transmission	7	5.6×	8e-03

Disease & clinical

Genetic variants

Variant evidence for TYRO3: 137 ClinVar records (0 pathogenic / likely pathogenic); 11 GWAS associations.

ClinVar

137 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	92
Likely benign	3
Benign	6

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 32 predictions of 2,074):

Position(s)	Effect	Δscore	Sites
15:41559382–41559383	donor_loss	1.0000	3
15:41561125–41561126	acceptor_loss	1.0000	4
15:41561311–41561312	donor_loss	1.0000	5
15:41568363–41568364	donor_loss	1.0000	4
15:41570140	donor_gain	1.0000
15:41570238–41570239	acceptor_loss	1.0000	5
15:41570341–41570342	donor_loss	1.0000	4
15:41570588	acceptor_gain	1.0000
15:41570601	acceptor_gain	1.0000
15:41570602–41570603	acceptor_loss	1.0000	4

AlphaMissense

1,881 missense substitutions predicted likely pathogenic (of 5,761 scored), across 435 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M643	9	0.986	0.999
M572	9	0.978	0.999
M765	9	0.944	0.994
M662	9	0.936	0.999
M606	9	0.882	0.994
M551	9	0.873	0.987
M636	9	0.841	0.987
N660	8	1.000	1.000
D673	8	1.000	1.000
D655	8	0.999	1.000
H653	8	0.998	1.000
D714	8	0.998	0.999
F674	8	0.996	1.000
F529	8	0.994	1.000
F575	8	0.990	0.999
D610	8	0.988	0.998
F779	8	0.983	0.999
H577	8	0.980	0.997
D706	8	0.971	0.994
F718	8	0.968	0.999

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

2 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Papillary Cell Carcinoma (TCGA)	unfavorable	1.93e-07
Liver Hepatocellular Carcinoma (TCGA)	unfavorable	0.000298

Disease associations

OMIM: gene MIM:600341 | disease phenotypes:

GWAS associations

11 associations:

Study	Trait	p-value
GCST010242_480	HDL cholesterol levels	6e-20
GCST002463_20	Systemic lupus erythematosus	1e-14
GCST010241_403	Apolipoprotein A1 levels	3e-14
GCST008794_63	Urinary albumin-to-creatinine ratio	9e-14
GCST008790_47	Urinary albumin-to-creatinine ratio	2e-13
GCST009640_55	Urinary albumin-to-creatinine ratio	1e-11
GCST009602_17	Metabolic syndrome	2e-10
GCST90002403_657	Red blood cell count	3e-10
GCST006585_1030	Blood protein levels	2e-9
GCST008791_11	Microalbuminuria	4e-9
GCST006585_157	Blood protein levels	2e-7

EFO canonical traits (from GWAS)

5 canonical traits:

EFO ID	Trait name
EFO:0007778	urinary albumin to creatinine ratio
EFO:0000195	metabolic syndrome
EFO:0004614	apolipoprotein A 1 measurement
EFO:0004612	high density lipoprotein cholesterol measurement
EFO:0004305	erythrocyte count

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL5314 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 324,446 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

30 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL288441	BOSUTINIB	4	12,869
CHEMBL2105717	CABOZANTINIB	4	11,799
CHEMBL601719	CRIZOTINIB	4	15,133
CHEMBL553	ERLOTINIB	4	109,860
CHEMBL608533	MIDOSTAURIN	4	7,641
CHEMBL502835	NINTEDANIB	4	8,978
CHEMBL535	SUNITINIB	4	80,232
CHEMBL24828	VANDETANIB	4	43,290
CHEMBL31965	CANERTINIB	3	8,307
CHEMBL491473	CEDIRANIB	3	9,464
CHEMBL522892	DOVITINIB	3	5,162
CHEMBL3622820	ITACITINIB	3	2,400
CHEMBL603469	LESTAURTINIB	3
CHEMBL5095079	POVORCITINIB	3	237
CHEMBL1976040	ADAVOSERTIB	2	1,844
CHEMBL3809489	BEMCENTINIB	2	1,381
CHEMBL460702	BMS-777607	2	260
CHEMBL103667	DORAMAPIMOD	2	1,746
CHEMBL1230609	FORETINIB	2	3,230
CHEMBL1980297	ILORASERTIB	2	613
CHEMBL607707	PELITINIB	2
CHEMBL475251	R-406	2
CHEMBL1738757	REBASTINIB	2
CHEMBL1721885	SU-014813	2
CHEMBL572878	TOZASERTIB	2
CHEMBL574738	AST-487	1
CHEMBL259084	MLN-8054	1
CHEMBL49120	PD-0166285	1
CHEMBL6060997	PF-07265807	1
CHEMBL482767	SNS-314	1

PharmGKB: 1 entry (CPIC guideline: no)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: catalytic receptor — Type XI RTKs: TAM (TYRO3-, AXL- and MER-TK) receptor family

Most potent curated ligand interactions (8 total), top 8:

Ligand	Action	Affinity	Parameter
compound 21 [PMID: 23312943]	Inhibition	9.15	pIC50
UNC4203	Inhibition	8.41	pKi
BMS-777607	Inhibition	8.37	pIC50
LDC1267	Inhibition	8.1	pIC50
UNC8969	Inhibition	7.18	pIC50
SLC-391	Inhibition	6.3	pIC50
A-910	Inhibition	6.26	pIC50
MerTK inhibitor 11	Inhibition	6.0	pIC50

Binding affinities (BindingDB)

1872 measured of 2847 human assays (2848 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
1-[4-[[2-(3-chloroanilino)-5-(3,4-dimethoxyphenyl)pyrimidin-4-yl]amino]piperidin-1-yl]-2,2,2-trifluoroethanone	IC50	0.12 nM	US-11053225: Pyrimidine derivative compound, optical isomer thereof, or pharmaceutically acceptable salt thereof, and composition for preventing or treating Tyro 3 related disease comprising same as active ingredient
1-[(4-aminocyclohexyl)methyl]-N-(3-phenylpropyl)-3-(4-piperazin-1-ylphenyl)pyrazolo[3,4-d]pyrimidin-6-amine	IC50	0.15 nM	US-9744172: Pyrazolopyrimidine compounds for the treatment of cancer
CHEMBL3797579	IC50	0.24 nM
CHEMBL2036806	IC50	0.25 nM
2-[4-[2-(3-fluoroanilino)-4-(1,2,3,4-tetrahydroisoquinolin-7-ylamino)pyrimidin-5-yl]pyrazol-1-yl]ethanol	IC50	0.36 nM	US-11053225: Pyrimidine derivative compound, optical isomer thereof, or pharmaceutically acceptable salt thereof, and composition for preventing or treating Tyro 3 related disease comprising same as active ingredient
1-[2-(4-methylphenyl)-5-tert-butyl-pyrazol-3-yl]-3-[4-(2-morpholin-4-ylethoxy)naphthalen-1-yl]urea	KD	0.37 nM
4-[2-(butylamino)-5-[4-(4-methylpiperazin-1-yl)sulfonylphenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	IC50	0.42 nM	US-10004755: Therapeutic uses of selected pyrrolopyrimidine compounds with anti-mer tyrosine kinase activity
4-[2-(butylamino)-5-(4-piperidin-1-ylsulfonylphenyl)pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	IC50	0.54 nM	US-10004755: Therapeutic uses of selected pyrrolopyrimidine compounds with anti-mer tyrosine kinase activity
CHEMBL3092795	IC50	0.69 nM
CHEMBL3092793	IC50	0.69 nM
CHEMBL3092792	IC50	0.7 nM
7-(4-aminocyclohexyl)-N-butyl-5-(4-morpholin-4-ylsulfonylphenyl)pyrrolo[2,3-d]pyrimidin-2-amine	IC50	0.72 nM	US-10004755: Therapeutic uses of selected pyrrolopyrimidine compounds with anti-mer tyrosine kinase activity
7-(4-aminocyclohexyl)-N-butyl-5-(3-fluoro-4-morpholin-4-ylsulfonylphenyl)pyrrolo[2,3-d]pyrimidin-2-amine	IC50	0.73 nM	US-10004755: Therapeutic uses of selected pyrrolopyrimidine compounds with anti-mer tyrosine kinase activity
4-[[7-(4-aminocyclohexyl)-5-(4-fluorophenyl)pyrrolo[2,3-d]pyrimidin-2-yl]amino]butan-1-ol	IC50	0.75 nM	US-10004755: Therapeutic uses of selected pyrrolopyrimidine compounds with anti-mer tyrosine kinase activity
CHEMBL2036805	IC50	0.76 nM
2-N-(3,5-difluorophenyl)-5-(1-methylpyrazol-4-yl)-4-N-(1,2,3,4-tetrahydroisoquinolin-7-yl)pyrimidine-2,4-diamine	IC50	0.78 nM	US-11053225: Pyrimidine derivative compound, optical isomer thereof, or pharmaceutically acceptable salt thereof, and composition for preventing or treating Tyro 3 related disease comprising same as active ingredient
methyl N-[4-[5-[(2S)-2-amino-2,4-dimethylpentoxy]-6-(difluoromethyl)-2-pyridinyl]-2-pyridinyl]carbamate	IC50	0.8 nM	US-10155760: Biaryl kinase inhibitors
CHEMBL3092797	IC50	0.81 nM
1-[4-[[5-(3,4-dimethoxyphenyl)-2-(2-methoxyanilino)pyrimidin-4-yl]amino]piperidin-1-yl]-2,2,2-trifluoroethanone	IC50	0.82 nM	US-11053225: Pyrimidine derivative compound, optical isomer thereof, or pharmaceutically acceptable salt thereof, and composition for preventing or treating Tyro 3 related disease comprising same as active ingredient
CHEMBL4284541	IC50	0.9 nM
N-[4-[[2-(3,5-difluoroanilino)-5-[1-(2-hydroxyethyl)pyrazol-4-yl]pyrimidin-4-yl]amino]cyclohexyl]-2,2,2-trifluoroacetamide	IC50	0.9 nM	US-11053225: Pyrimidine derivative compound, optical isomer thereof, or pharmaceutically acceptable salt thereof, and composition for preventing or treating Tyro 3 related disease comprising same as active ingredient
1-cyclobutyl-N-[3-fluoro-4-[[3-[[(2R)-1-hydroxypropan-2-yl]amino]-1H-pyrazolo[3,4-b]pyridin-4-yl]oxy]phenyl]-3-(4-fluorophenyl)-2,4-dioxo-1,3-diazinane-5-carboxamide	IC50	0.9 nM	US-11104676
N-[3-fluoro-4-[[3-[[(2R)-1-hydroxypropan-2-yl]amino]-1H-pyrazolo[3,4-b]pyridin-4-yl]oxy]phenyl]-1-(4-fluorophenyl)-5-methyl-2-oxopyridine-3-carboxamide	IC50	0.9 nM	US-11104676
N-[4-[[2-(3-chloroanilino)-5-[1-(2-hydroxyethyl)pyrazol-4-yl]pyrimidin-4-yl]amino]cyclohexyl]-2,2,2-trifluoroacetamide	IC50	0.91 nM	US-11053225: Pyrimidine derivative compound, optical isomer thereof, or pharmaceutically acceptable salt thereof, and composition for preventing or treating Tyro 3 related disease comprising same as active ingredient
4-[2-(butylamino)-5-[4-(piperazin-1-ylmethyl)phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	IC50	0.97 nM	US-10004755: Therapeutic uses of selected pyrrolopyrimidine compounds with anti-mer tyrosine kinase activity
7-(4-aminocyclohexyl)-N-(2-cyclopropylethyl)-5-(4-fluorophenyl)pyrrolo[2,3-d]pyrimidin-2-amine	IC50	1 nM	US-10004755: Therapeutic uses of selected pyrrolopyrimidine compounds with anti-mer tyrosine kinase activity
CHEMBL3326007	IC50	1 nM
2-[4-[4-[(4-aminocyclohexyl)amino]-2-(3,5-difluoroanilino)pyrimidin-5-yl]pyrazol-1-yl]ethanol	IC50	1 nM	US-11053225: Pyrimidine derivative compound, optical isomer thereof, or pharmaceutically acceptable salt thereof, and composition for preventing or treating Tyro 3 related disease comprising same as active ingredient
1-(cyclopropylmethyl)-N-[3-fluoro-4-[[3-[[(2R)-1-hydroxypropan-2-yl]amino]-1H-pyrazolo[3,4-b]pyridin-4-yl]oxy]phenyl]-3-(4-fluorophenyl)-2,4-dioxo-1,3-diazinane-5-carboxamide	IC50	1 nM	US-11104676
CHEMBL3092790	IC50	1.1 nM
4-[[2-(4-methylanilino)-5-[5-(pyrrolidin-1-ylmethyl)-2-pyridinyl]pyrimidin-4-yl]amino]cyclohexan-1-ol	IC50	1.2 nM	US-9649309: Therapeutic uses of selected pyrimidine compounds with anti-Mer tyrosine kinase activity
4-[2-(2-cyclopropylethylamino)-5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	IC50	1.2 nM	US-10004755: Therapeutic uses of selected pyrrolopyrimidine compounds with anti-mer tyrosine kinase activity
4-[2-(butylamino)-5-[3-fluoro-4-(4-methylpiperazin-1-yl)sulfonylphenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	IC50	1.2 nM	US-9795606: Pyrrolopyrimidine compounds for the treatment of cancer
CHEMBL5639725	IC50	1.2 nM
N-[3-fluoro-4-[[3-[[(2R)-1-hydroxypropan-2-yl]amino]-1H-pyrazolo[3,4-b]pyridin-4-yl]oxy]phenyl]-1-(4-fluorophenyl)-6-methyl-2-oxopyridine-3-carboxamide	IC50	1.2 nM	US-11104676
4-[[5-[5-[(1-adamantylmethylamino)methyl]-2-pyridinyl]-2-(butylamino)pyrimidin-4-yl]amino]cyclohexan-1-ol	IC50	1.3 nM	US-9649309: Therapeutic uses of selected pyrimidine compounds with anti-Mer tyrosine kinase activity
4-[[2-(3-fluoroanilino)-5-[5-(pyrrolidin-1-ylmethyl)-2-pyridinyl]pyrimidin-4-yl]amino]cyclohexan-1-ol	IC50	1.3 nM	US-9649309: Therapeutic uses of selected pyrimidine compounds with anti-Mer tyrosine kinase activity
4-[2-(butylamino)-5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	IC50	1.3 nM	US-10004755: Therapeutic uses of selected pyrrolopyrimidine compounds with anti-mer tyrosine kinase activity
4-[2-(butylamino)-5-(4-cyclopentylsulfonylphenyl)pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	IC50	1.3 nM	US-10004755: Therapeutic uses of selected pyrrolopyrimidine compounds with anti-mer tyrosine kinase activity
4-[2-(butylamino)-5-[4-(4,4-difluoropiperidin-1-yl)sulfonylphenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	IC50	1.3 nM	US-10004755: Therapeutic uses of selected pyrrolopyrimidine compounds with anti-mer tyrosine kinase activity
CHEMBL3092796	IC50	1.3 nM
2-[4-[2-(2,3-dichloroanilino)-4-(1,2,3,4-tetrahydroisoquinolin-7-ylamino)pyrimidin-5-yl]pyrazol-1-yl]ethanol	IC50	1.3 nM	US-11053225: Pyrimidine derivative compound, optical isomer thereof, or pharmaceutically acceptable salt thereof, and composition for preventing or treating Tyro 3 related disease comprising same as active ingredient
4-[2-(butylamino)-5-[4-(3,3-difluoroazetidin-1-yl)sulfonylphenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	IC50	1.4 nM	US-10004755: Therapeutic uses of selected pyrrolopyrimidine compounds with anti-mer tyrosine kinase activity
CHEMBL6190151	IC50	1.4 nM
2-N-(4-chloro-3-methylphenyl)-5-(1-methylpyrazol-4-yl)-4-N-(1,2,3,4-tetrahydroisoquinolin-7-yl)pyrimidine-2,4-diamine	IC50	1.4 nM	US-11053225: Pyrimidine derivative compound, optical isomer thereof, or pharmaceutically acceptable salt thereof, and composition for preventing or treating Tyro 3 related disease comprising same as active ingredient
4-[[2-(4-fluoroanilino)-5-[5-(pyrrolidin-1-ylmethyl)-2-pyridinyl]pyrimidin-4-yl]amino]cyclohexan-1-ol	IC50	1.5 nM	US-9649309: Therapeutic uses of selected pyrimidine compounds with anti-Mer tyrosine kinase activity
4-[2-(butylamino)-5-[4-(4-methylpiperazin-1-yl)phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	IC50	1.5 nM	US-10004755: Therapeutic uses of selected pyrrolopyrimidine compounds with anti-mer tyrosine kinase activity
CHEMBL4283152	IC50	1.5 nM
CHEMBL6189236	IC50	1.5 nM
5-cyclopropyl-N-[3-fluoro-4-[[3-[[(2R)-1-hydroxypropan-2-yl]amino]-1H-pyrazolo[3,4-b]pyridin-4-yl]oxy]phenyl]-1-(4-fluorophenyl)-2-oxopyridine-3-carboxamide	IC50	1.5 nM	US-11104676

ChEMBL bioactivities

2055 potent at pChembl≥5 of 2273 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
11.00	IC50	0.01	nM	CHEMBL5981096
10.92	IC50	0.012	nM	CHEMBL5782595
10.92	IC50	0.012	nM	CHEMBL5873205
10.92	IC50	0.012	nM	CHEMBL5741930
10.92	IC50	0.012	nM	CHEMBL5817527
10.39	IC50	0.041	nM	CHEMBL5926926
10.39	IC50	0.041	nM	CHEMBL6060115
10.28	IC50	0.052	nM	CHEMBL5981781
10.22	IC50	0.06	nM	CHEMBL5997590
10.01	IC50	0.097	nM	CHEMBL5745182
10.00	IC50	0.1	nM	CHEMBL5908100
9.89	IC50	0.13	nM	CHEMBL5767211
9.89	IC50	0.13	nM	CHEMBL5993962
9.89	IC50	0.13	nM	CHEMBL5874363
9.85	IC50	0.14	nM	CHEMBL6022455
9.85	IC50	0.14	nM	CHEMBL5916277
9.80	IC50	0.16	nM	CHEMBL6053094
9.80	IC50	0.16	nM	CHEMBL6019126
9.80	IC50	0.16	nM	CHEMBL5986184
9.77	IC50	0.17	nM	CHEMBL5824153
9.77	IC50	0.17	nM	CHEMBL5883347
9.77	IC50	0.17	nM	CHEMBL5934278
9.72	IC50	0.19	nM	CHEMBL5846250
9.70	IC50	0.2	nM	CHEMBL5967645
9.64	IC50	0.23	nM	CHEMBL5803120
9.57	IC50	0.27	nM	CHEMBL6052995
9.57	IC50	0.27	nM	CHEMBL5822883
9.55	IC50	0.28	nM	CHEMBL5919842
9.52	IC50	0.3	nM	CHEMBL6065829
9.49	IC50	0.32	nM	CHEMBL5934837
9.47	IC50	0.34	nM	CHEMBL5913672
9.47	IC50	0.34	nM	CHEMBL5745525
9.43	IC50	0.37	nM	CHEMBL5908464
9.38	IC50	0.42	nM	CHEMBL5825584
9.32	IC50	0.48	nM	CHEMBL5741898
9.24	IC50	0.58	nM	CHEMBL5825621
9.22	IC50	0.6	nM	CHEMBL5873205
9.15	IC50	0.7	nM	CHEMBL2312654
9.05	IC50	0.9	nM	CHEMBL5814386
9.00	IC50	1	nM	CHEMBL4873571
9.00	IC50	1	nM	CHEMBL6010989
8.92	IC50	1.2	nM	CHEMBL5639725
8.92	IC50	1.2	nM	CHEMBL6005928
8.92	IC50	1.2	nM	CHEMBL4279154
8.89	IC50	1.3	nM	CHEMBL5895995
8.85	IC50	1.4	nM	CHEMBL6053185
8.84	IC50	1.45	nM	STAUROSPORINE
8.83	EC50	1.47	nM	CHEMBL6192562
8.80	IC50	1.6	nM	CHEMBL5839005
8.80	IC50	1.6	nM	CHEMBL5871911

PubChem BioAssay actives

592 with measured affinity, of 2326 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-[[2-(3-chloroanilino)-5-[1-(cyclopentylmethyl)piperidin-4-yl]pyrimidin-4-yl]amino]cyclohexan-1-ol	2262657: Displacement of tracer K-5 from TYRO3 (unknown origin) transfected in HEK293 cells by NanoBRET assay	ec50	0.0005	uM
2-N-(3,5-dichlorophenyl)-4-N-[4-(dimethylamino)cyclohexyl]-5-(3-methyl-1,2-oxazol-5-yl)pyrimidine-2,4-diamine	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0007	uM
N-[4-[[2-(cyclopropanecarbonylamino)-4-pyridinyl]oxy]-3-fluorophenyl]-3-(4-fluorophenyl)-2,4-dioxo-1-propan-2-ylpyrimidine-5-carboxamide	1764508: Inhibition of recombinant human RSE (451 to end residues) using KVEKIGEGTYGVVYK as substrate incubated for 40 mins in presence of [gamma33P]ATP by scintillation counting based radiometry assay	ic50	0.0010	uM
4-[2-(2-ethylbutylamino)-5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0012	uM
3-[[5-(4-fluorophenyl)-2H-pyrazolo[3,4-b]pyridin-3-yl]carbamoyl]benzoic acid	2144598: Inhibition of SKY (unknown origin)	ic50	0.0012	uM
(2S,3R,4R,6R)-3-methoxy-2-methyl-4-(methylamino)-29-oxa-1,7,17-triazaoctacyclo[12.12.2.12,6.07,28.08,13.015,19.020,27.021,26]nonacosa-8,10,12,14,19,21,23,25,27-nonaen-16-one	1715131: Inhibition of human TYRO3 using poly[Glu:Tyr] (4:1) as substrate by [gamma-33P]-ATP assay	ic50	0.0014	uM
4-[(4-hydroxycyclohexyl)amino]-N-(1-methylpiperidin-4-yl)-2-[4-[2-[4-(2-methylpropanoylamino)-2-pyridinyl]ethynyl]anilino]pyrimidine-5-carboxamide	2273409: Inhibition of TYRO3 (unknown origin) by cell-based NanoBRET assay	ec50	0.0015	uM
1-N’-[3-fluoro-4-[6-methoxy-7-(3-morpholin-4-ylpropoxy)quinolin-4-yl]oxyphenyl]-1-N-(4-fluorophenyl)cyclopropane-1,1-dicarboxamide	625057: Binding constant for TYRO3 kinase domain	kd	0.0020	uM
2-(3,5-dichloroanilino)-4-[[4-(dimethylamino)cyclohexyl]amino]-N-(1-methylpiperidin-4-yl)pyrimidine-5-carboxamide	721419: Inhibition of Sky (unknown origin) by ELISA kinase assay in presence of 60 uM ATP	ic50	0.0020	uM
4-[2-[3,5-bis(trifluoromethyl)anilino]-5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0021	uM
4-[2-(3-chloroanilino)-5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0021	uM
4-[[2-(4-fluoroanilino)-5-[5-(pyrrolidin-1-ylmethyl)-2-pyridinyl]pyrimidin-4-yl]amino]cyclohexan-1-ol	2262636: Inhibition of TYRO3 (unknown origin)	ic50	0.0023	uM
1-(4-fluorophenyl)-N-[4-[5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]-6-(1-methylpyrazol-4-yl)furo[2,3-d]pyrimidin-4-yl]oxyphenyl]-2-oxopyridine-3-carboxamide	2241819: Inhibition of Tyro3 (unknown origin) incubated for 3 hrs in presence of substrate/ATP by ADP-Glo assay	ic50	0.0025	uM
N-cyclopropyl-2-[2-[4-[[4-[(4-hydroxycyclohexyl)amino]-5-[5-(morpholine-4-carbonyl)-2-pyridinyl]pyrimidin-2-yl]amino]phenyl]ethynyl]pyridine-4-carboxamide	2273393: Inhibition of TYRO3 (unknown origin)	ic50	0.0026	uM
4-[2-[3,5-bis(trifluoromethyl)anilino]-5-[2-fluoro-4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0026	uM
4-[2-(3,5-dimethylanilino)-5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0026	uM
N-cyclopropyl-2-[2-[4-[[4-[(4-hydroxycyclohexyl)amino]-5-[5-(1-morpholin-4-ylcyclopropyl)-2-pyridinyl]pyrimidin-2-yl]amino]phenyl]ethynyl]pyridine-4-carboxamide	2273393: Inhibition of TYRO3 (unknown origin)	ic50	0.0027	uM
4-[2-(3,5-difluoroanilino)-5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0027	uM
4-[2-[3,5-bis(trifluoromethyl)anilino]-5-[4-[[2-(diethylamino)ethylamino]methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0028	uM
N-cyclopropyl-2-[2-[4-[[4-[(4-hydroxycyclohexyl)amino]-5-[5-[(4-methylpiperazin-1-yl)methyl]-2-pyridinyl]pyrimidin-2-yl]amino]phenyl]ethynyl]pyridine-4-carboxamide	2273393: Inhibition of TYRO3 (unknown origin)	ic50	0.0029	uM
Cabozantinib	2249062: Inhibition of N-terminal GST-tagged recombinant human Tyro-3 (455 to end residues) extracted from baculovirus infected Sf9 cells preincubated for 30 mins followed by substrate/ATP addition measured after 60 mins by HTRF analysis	ic50	0.0029	uM
1-[(4-aminocyclohexyl)methyl]-N-butyl-3-(4-piperazin-1-ylphenyl)pyrazolo[3,4-d]pyrimidin-6-amine	663572: Inhibition of Tyro3 using EFPIYDFLPAKKK-CONH2 as substrate after 180 mins by microfluid capillary electrophoresis assay	ic50	0.0029	uM
7-(4-aminocyclohexyl)-N-[3,5-bis(trifluoromethyl)phenyl]-5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-2-amine	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0030	uM
2-(3,5-dichloroanilino)-4-[[(2S)-1-hydroxybutan-2-yl]amino]-N-(1-methylpiperidin-4-yl)pyrimidine-5-carboxamide	721419: Inhibition of Sky (unknown origin) by ELISA kinase assay in presence of 60 uM ATP	ic50	0.0030	uM
4-[5-[4-[(4-methyl-1,4-diazepan-1-yl)methyl]phenyl]-2-[[(2S)-pentan-2-yl]amino]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	1409258: Inhibition of N-terminal GST-tagged human TYRO3 cytoplasmic domain (453 to 890 end residues) expressed in baculovirus expression system using fluorecence-labeled substrate by MCE assay	ic50	0.0031	uM
N-(1-methyl-2-oxo-3,4-dihydroquinolin-6-yl)-1H-indazole-3-carboxamide	2144598: Inhibition of SKY (unknown origin)	ic50	0.0032	uM
4-[2-(3,4-dichloroanilino)-5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0033	uM
4-[5-[4-(7-azabicyclo[2.2.1]heptan-7-ylmethyl)phenyl]-2-[[(2S)-pentan-2-yl]amino]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	1409233: Inhibition of TYRO3 (unknown origin) using 5’-FAM-EFPIYDFLPAKKK-CONH2 as substrate after 180 mins by MCE assay	ic50	0.0034	uM
2-amino-N-[(1S,2S)-2-[[4-[4-[[1-(2-hydroxyethyl)piperidin-4-yl]-methylamino]phenyl]phenyl]methoxy]cyclopentyl]-5-(1-methylpyrazol-4-yl)pyridine-3-carboxamide	2247347: Inhibition of N-terminal GST-tagged recombinant human TYRO3 (455 to end residues) expressed in baculovirus-infected Sf9 cells using biotin-labeled TK and ATP as substrate preincubated with enzyme for 30 mins followed by substrate addition and measured after 1 hr by HTRF assay	ic50	0.0036	uM
4-[2-(3,5-dichloroanilino)-5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0038	uM
4-[2-[3,5-bis(trifluoromethyl)anilino]-5-[4-[(4-methoxypiperidin-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0038	uM
4-[6-[3,5-bis(trifluoromethyl)anilino]-3-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrazolo[3,4-d]pyrimidin-1-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0040	uM
4-[2-[3,5-bis(trifluoromethyl)anilino]-5-[4-[[4-(dimethylamino)piperidin-1-yl]methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0042	uM
4-[2-[[(2S)-hexan-2-yl]amino]-5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	1409233: Inhibition of TYRO3 (unknown origin) using 5’-FAM-EFPIYDFLPAKKK-CONH2 as substrate after 180 mins by MCE assay	ic50	0.0043	uM
N-[4-[(2-amino-3-chloro-4-pyridinyl)oxy]-3-fluorophenyl]-1-(4-fluorophenyl)-4-methoxy-2-oxopyridine-3-carboxamide	1691582: Inhibition of Tyro3 (unknown origin)	ic50	0.0043	uM
4-[[2-(3,5-dichloroanilino)-5-(1-methylpiperidin-4-yl)pyrimidin-4-yl]amino]cyclohexan-1-ol	2262639: Inhibition of TYRO3 (unknown origin) using 5-FAM-EFPIYDFLPAKKK-CONH2 as substrate incubated for 180 mins in presence of ATP by MCE assay	ic50	0.0043	uM
N-[4-[(2-amino-3-chloro-4-pyridinyl)oxy]-3-fluorophenyl]-4-ethoxy-1-(4-fluorophenyl)-2-oxopyridine-3-carboxamide	2151500: Inhibition of Tyro-3 (unknown origin) by kinase profiling assay	ic50	0.0043	uM
4-[5-[4-[[2-(diethylamino)ethylamino]methyl]phenyl]-2-[[(2S)-pentan-2-yl]amino]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	1409233: Inhibition of TYRO3 (unknown origin) using 5’-FAM-EFPIYDFLPAKKK-CONH2 as substrate after 180 mins by MCE assay	ic50	0.0044	uM
2-amino-N-[(1S,2S)-2-[[4-[(5S)-5-[4-(2-hydroxyethyl)piperazin-1-yl]-5,6,7,8-tetrahydronaphthalen-2-yl]phenyl]methoxy]cyclopentyl]-5-(1-methylpyrazol-4-yl)pyridine-3-carboxamide	2247347: Inhibition of N-terminal GST-tagged recombinant human TYRO3 (455 to end residues) expressed in baculovirus-infected Sf9 cells using biotin-labeled TK and ATP as substrate preincubated with enzyme for 30 mins followed by substrate addition and measured after 1 hr by HTRF assay	ic50	0.0044	uM
2-[2-[4-[[4-[(4-hydroxycyclohexyl)amino]-5-pyridin-2-ylpyrimidin-2-yl]amino]phenyl]ethynyl]-N-propan-2-ylpyridine-4-carboxamide	2273393: Inhibition of TYRO3 (unknown origin)	ic50	0.0044	uM
4-[2-[3,5-bis(trifluoromethyl)anilino]-5-[4-(morpholin-4-ylmethyl)phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0044	uM
4-[2-[3,5-bis(trifluoromethyl)anilino]-5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrrolo[2,1-f][1,2,4]triazin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0044	uM
4-[2-[3,5-bis(trifluoromethyl)anilino]-5-[4-[(4-methyl-1,4-diazepan-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0045	uM
4-[2-[3,5-bis(trifluoromethyl)anilino]-5-[4-(4-methylpiperazin-1-yl)sulfonylphenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0045	uM
5-[[7-(4-hydroxycyclohexyl)-5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-2-yl]amino]benzene-1,3-dicarbonitrile	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0047	uM
N-[4-[5-[4-[(dimethylamino)methyl]phenyl]-6-(1-methylpyrazol-4-yl)furo[2,3-d]pyrimidin-4-yl]oxyphenyl]-1-(4-fluorophenyl)-2-oxopyridine-3-carboxamide	2241819: Inhibition of Tyro3 (unknown origin) incubated for 3 hrs in presence of substrate/ATP by ADP-Glo assay	ic50	0.0049	uM
4-[2-[3,5-bis(trifluoromethyl)anilino]-5-[4-[(4-propan-2-ylpiperazin-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0049	uM
4-[2-(1-benzothiophen-5-ylamino)-5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0050	uM
[4-[2-[3,5-bis(trifluoromethyl)anilino]-7-(4-hydroxycyclohexyl)pyrrolo[2,3-d]pyrimidin-5-yl]phenyl]-(4-methylpiperazin-1-yl)methanone	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0052	uM
4-[2-(3,5-dimethoxyanilino)-5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexan-1-ol	2246146: Inhibition of TYRO3 (unknown origin) by microcapillary electrophoresis (MCE) assay	ic50	0.0053	uM

CTD chemical–gene interactions

41 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
(+)-JQ1 compound	affects expression, decreases expression	4
trichostatin A	affects cotreatment, decreases expression, affects expression, decreases reaction	3
sodium arsenite	affects methylation, increases expression	3
Tretinoin	decreases expression	3
Vorinostat	affects cotreatment, decreases expression	2
Benzo(a)pyrene	affects methylation, increases expression, increases methylation	2
Cisplatin	decreases expression, increases expression	2
Tobacco Smoke Pollution	decreases methylation, increases expression	2
Valproic Acid	affects expression, increases methylation	2
aristolochic acid I	increases expression	1
methyleugenol	increases expression	1
bisphenol A	affects cotreatment, increases methylation	1
2,2’-methylenebis(4-methyl-6-tert-butylphenol)	affects expression, affects response to substance	1
aflatoxin B2	decreases methylation	1
cupric chloride	increases expression	1
epigallocatechin gallate	decreases expression	1
tamibarotene	decreases expression	1
perfluoro-n-nonanoic acid	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
abrine	decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
Temozolomide	decreases expression	1
Fulvestrant	affects cotreatment, increases methylation	1
Acetaminophen	increases expression	1
Adenosine Diphosphate	increases response to substance	1
Atrazine	increases expression	1
Caffeine	affects phosphorylation	1
Carbamazepine	affects expression	1
Dexamethasone	decreases expression	1
Doxorubicin	affects expression	1

ChEMBL screening assays

380 unique, capped per target: 376 binding, 3 functional, 1 toxicity

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1024898	Binding	Binding affinity to human TYRO3 at 10 uM relative to control	Assessment of chemical coverage of kinome space and its implications for kinase drug discovery. — *J Med Chem*
CHEMBL1963714	Functional	PUBCHEM_BIOASSAY: Navigating the Kinome. (Class of assay: other) Panel member name: TYRO3	PubChem BioAssay data set
CHEMBL6121367	Toxicity	Inhibition of N-terminal GST-tagged recombinant human TYRO3 (455 to end residues) expressed in baculovirus-infected Sf9 cells using biotin-labeled TK and ATP as substrate preincubated with enzyme for 30 mins followed by substrate addition a	Discovery of A-910, a Highly Potent and Orally Bioavailable Dual MerTK/Axl-Selective Tyrosine Kinase Inhibitor. — *J Med Chem*

Cellosaurus cell lines

4 cell lines: 3 cancer cell line, 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_D9V8	Ubigene HEK293 TYRO3 KO	Transformed cell line	Female
CVCL_TV35	HAP1 TYRO3 (-) 1	Cancer cell line	Male
CVCL_TV36	HAP1 TYRO3 (-) 2	Cancer cell line	Male
CVCL_TV37	HAP1 TYRO3 (-) 3	Cancer cell line	Male

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

51 trials:

NCT	Phase	Status	Title
NCT02562170	Phase 4	COMPLETED	Protexa® Versus TiLoopBra® in Immediate Breast Reconstruction- A Pilot Study
NCT00673335	Phase 3	COMPLETED	Letrozole in Preventing Breast Cancer in Postmenopausal Women With a BRCA1 or BRCA2 Mutation
NCT00685256	Phase 3	COMPLETED	Standard Genetic Counseling With or Without a Decision Guide in Improving Communication Between Mothers Undergoing BRCA1/2 Testing and Their Minor-Age Children
NCT03162276	Phase 3	UNKNOWN	Trial of Inquiry Based Stress Reduction (IBSR) Program for BRCA1/2 Mutation Carriers
NCT00253539	Phase 2	COMPLETED	Arzoxifene or Tamoxifen in Preventing Breast Cancer in Premenopausal Women at High Risk for Breast Cancer
NCT00305695	Phase 2	COMPLETED	Zoledronate or Observation in Maintaining Bone Mineral Density in Patients Who Are Undergoing Surgery to Remove Both Ovaries
NCT00321633	Phase 2	COMPLETED	Carboplatin or Docetaxel in Treating Women With Metastatic Genetic Breast Cancer
NCT01333748	Phase 2	COMPLETED	Search Allelic Imbalance of Expression of BRCA Genes in Hereditary Risk of Breast and/or Ovarian Cancer
NCT01367639	Phase 2	COMPLETED	Trial of Inquiry Based Stress Reduction (IBSR) Program for BRCA1/2 Mutation Carriers
NCT00535119	Phase 1	COMPLETED	Veliparib, Carboplatin, and Paclitaxel in Treating Patients With Advanced Solid Cancer
NCT00892736	Phase 1	COMPLETED	Veliparib in Treating Patients With Malignant Solid Tumors That Do Not Respond to Previous Therapy
NCT03832985	Early Phase 1	COMPLETED	Pediatric Reporting of Adult-Onset Genomic Results
NCT00005095	Not specified	RECRUITING	Specimen and Data Study for Ovarian Cancer Early Detection and Prevention
NCT00609505	Not specified	COMPLETED	Telemedicine vs. Face-to-Face Cancer Genetic Counseling
NCT01273909	Not specified	UNKNOWN	Outcomes After Perforator Flap Reconstruction for Breast Reconstruction and/or Lymphedema Treatment
NCT01445275	Not specified	WITHDRAWN	Cost of Cancer Risk Management in Women at Elevated Genetic Risk for Ovarian Cancer Who Participated on GOG-0199
NCT01608074	Not specified	ACTIVE_NOT_RECRUITING	Radical Fimbriectomy for Young BRCA Mutation Carriers
NCT02087592	Not specified	COMPLETED	Feasibility of Lifestyle Intervention in BRCA1/2 Mutation Carriers
NCT02302742	Not specified	RECRUITING	Triple Negative Breast Cancer and Germline Hereditary Breast and Ovarian Cancer Mutation Carrier Registry
NCT02324062	Not specified	COMPLETED	Cancer Genetics Hereditary Cancer Panel Testing
NCT02516540	Not specified	UNKNOWN	Efficacy of Lifestyle Intervention in BRCA1/2 Mutation Carriers
NCT02653105	Not specified	ACTIVE_NOT_RECRUITING	Women at Risk of Breast Cancer and OLFM4
NCT02705924	Not specified	TERMINATED	Impact of a Psychoeducational Intervention on Expectations and Coping in Young Women Exposed to a High HBOC Risk
NCT02760849	Not specified	ACTIVE_NOT_RECRUITING	Surgery in Preventing Ovarian Cancer in Patients With Genetic Mutations
NCT02786147	Not specified	COMPLETED	Identification and Referral of Women at Risk for Hereditary Breast/Ovarian Cancer
NCT02956681	Not specified	COMPLETED	Statewide Communication to Reach Diverse Low Income Women
NCT03015376	Not specified	UNKNOWN	Inherited Susceptible Genes Among Epithelial Ovarian Cancer
NCT03050268	Not specified	RECRUITING	Familial Investigations of Childhood Cancer Predisposition
NCT03075540	Not specified	COMPLETED	Enhancing At-risk Latina Women’s Use of Genetic Counseling for Hereditary Breast and Ovarian Cancer
NCT03124212	Not specified	RECRUITING	Cascade Genetic Testing for Hereditary Breast/Ovarian Cancer and Lynch Syndrome in Switzerland
NCT03246841	Not specified	ACTIVE_NOT_RECRUITING	Investigation of Tumour Spectrum of Germline Mutations in Breast and Ovarian Cancer Genes.
NCT03294343	Not specified	UNKNOWN	Risk-Reducing Surgeries for Hereditary Ovarian Cancer
NCT03421327	Not specified	COMPLETED	Genetic Risk: Whether, When, and How to Tell Adolescents
NCT03510689	Not specified	COMPLETED	Genetics and Heart Health After Cancer Therapy
NCT03511690	Not specified	COMPLETED	Testing an Intelligent Tutoring System to Enhance Genetic Risk Assessment
NCT03784859	Not specified	COMPLETED	Tissue Expansion in Breast Reconstruction Without Drains
NCT03979612	Not specified	UNKNOWN	Evaluation of the Adhesion to the GENEPY Network
NCT04197856	Not specified	UNKNOWN	Direct Information to At-risk Relatives
NCT04407611	Not specified	COMPLETED	Scalable Communication Modalities for Returning Genetic Research Results
NCT04508764	Not specified	TERMINATED	Implementation of the Families Accelerating Cascade Testing Toolkit (FACTT) for Hereditary Breast and Ovarian Cancer and Lynch Syndrome
NCT04544501	Not specified	COMPLETED	Enhance the Use of Genetic Counseling and Testing in Latinas
NCT04668521	Not specified	TERMINATED	Multifactorial Risk Assessment for Breast & Ovarian Cancer Risk Detection
NCT05130606	Not specified	RECRUITING	CONTIGO - A Narrative Intervention to Enhance Genetic Counseling and Testing
NCT05306002	Not specified	COMPLETED	Nutritional Intervention and DNA Damage of Patients With HBOC
NCT05409222	Not specified	UNKNOWN	Study of Quality of Life Post Salpingo-oophorectomy in BRCA1/2 & PALB2 Mutation Carriers (BRCA-HRT)
NCT05677048	Not specified	ACTIVE_NOT_RECRUITING	Feasibility Study: IGNITE-TX (Identifying Individuals for Genetic Testing & Treatment) Intervention
NCT05721326	Not specified	COMPLETED	Sequential EHR Based Interventions to Increase Genetic Testing for Breast and Ovarian Cancer Predisposition
NCT06892275	Not specified	RECRUITING	The FYI on MRI: A Multilevel Decision Support Intervention for Screening Breast MRI
NCT06914726	Not specified	ENROLLING_BY_INVITATION	Patient Centered Clinical Decision Support for Hereditary Cancer Syndromes
NCT07039552	Not specified	RECRUITING	Development and Validation of an Ovarian Cancer Risk Prediction Model for Family Members of Ovarian Cancer Probands
NCT07236359	Not specified	NOT_YET_RECRUITING	Evaluation of Well Being and Patient Reported Outcomes After Robotic Single-port Nipple Sparing Mastectomy and Implant Reconstruction

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for TYRO3 across ~30M SureChEMBL compounds — explore on Sugi Predict.