UBE2D4

Summary

UBE2D4 (ubiquitin conjugating enzyme E2 D4, HGNC:21647) is a protein-coding gene on chromosome 7p13, encoding Ubiquitin-conjugating enzyme E2 D4 (Q9Y2X8). Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins.

Enables ubiquitin conjugating enzyme activity. Involved in protein polyubiquitination. Acts upstream of or within protein ubiquitination. Predicted to be active in nucleus.

Source: NCBI Gene 51619 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 26 total
• MANE Select transcript: NM_015983

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:21647
Approved symbol	UBE2D4
Name	ubiquitin conjugating enzyme E2 D4
Location	7p13
Locus type	gene with protein product
Status	Approved
Aliases	HBUCE1
Ensembl gene	ENSG00000078967
Ensembl biotype	protein_coding
Entrez	51619

Gene structure

Transcript identifiers

Ensembl transcripts: 16 — 7 protein_coding, 7 nonsense_mediated_decay, 1 protein_coding_CDS_not_defined, 1 retained_intron

ENST00000222402, ENST00000415051, ENST00000440652, ENST00000440899, ENST00000443780, ENST00000446008, ENST00000450743, ENST00000454350, ENST00000454428, ENST00000473007, ENST00000491770, ENST00000904963, ENST00000904964, ENST00000904965, ENST00000961700, ENST00000961701

RefSeq mRNA: 1 — MANE Select: NM_015983 NM_015983

CCDS: CCDS5474

Canonical transcript exons

ENST00000222402 — 7 exons

Exon	Start	End
ENSE00003488282	43950599	43950692
ENSE00003531895	43948632	43948737
ENSE00003584610	43952650	43956136
ENSE00003612436	43942954	43943031
ENSE00003623444	43938431	43938494
ENSE00003691426	43942826	43942857
ENSE00003847388	43926436	43926556

Expression profiles

Bgee: expression breadth ubiquitous, 288 present calls, max score 97.11.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 26.5991 / max 213.6083, expressed in 1810 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
78382	26.5991	1810

Top tissues by expression

293 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
pancreatic ductal cell	CL:0002079	97.11	gold quality
gastrocnemius	UBERON:0001388	96.87	gold quality
hindlimb stylopod muscle	UBERON:0004252	96.77	gold quality
muscle of leg	UBERON:0001383	96.68	gold quality
skeletal muscle organ	UBERON:0014892	95.73	gold quality
muscle organ	UBERON:0001630	95.72	gold quality
triceps brachii	UBERON:0001509	95.68	gold quality
tibialis anterior	UBERON:0001385	95.47	gold quality
gluteal muscle	UBERON:0002000	94.65	gold quality
diaphragm	UBERON:0001103	93.52	gold quality
quadriceps femoris	UBERON:0001377	93.43	gold quality
vastus lateralis	UBERON:0001379	93.16	gold quality
skeletal muscle tissue	UBERON:0001134	93.06	gold quality
deltoid	UBERON:0001476	93.00	gold quality
endothelial cell	CL:0000115	92.52	gold quality
ileal mucosa	UBERON:0000331	92.36	gold quality
heart left ventricle	UBERON:0002084	91.53	gold quality
muscle tissue	UBERON:0002385	91.46	gold quality
cardiac ventricle	UBERON:0002082	91.30	gold quality
right atrium auricular region	UBERON:0006631	91.22	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	91.07	gold quality
biceps brachii	UBERON:0001507	91.03	gold quality
apex of heart	UBERON:0002098	90.70	gold quality
cardiac atrium	UBERON:0002081	90.40	gold quality
heart	UBERON:0000948	90.28	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	90.27	gold quality
islet of Langerhans	UBERON:0000006	90.24	gold quality
prefrontal cortex	UBERON:0000451	89.94	gold quality
anterior cingulate cortex	UBERON:0009835	89.59	gold quality
cingulate cortex	UBERON:0003027	89.57	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	9.09

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

128 targeting UBE2D4, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4682	100.00	68.89	1258
HSA-MIR-1184	99.99	68.19	1458
HSA-MIR-196A-1-3P	99.99	72.15	2772
HSA-MIR-3185	99.99	68.12	1959
HSA-MIR-520G-5P	99.99	66.76	658
HSA-MIR-6870-5P	99.99	68.55	2115
HSA-MIR-548AN	99.97	70.91	2817
HSA-MIR-4723-5P	99.97	68.70	2034
HSA-MIR-5698	99.97	68.49	2029
HSA-MIR-7111-5P	99.97	68.48	2062
HSA-MIR-507	99.97	70.11	1915
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-6780B-5P	99.96	69.60	2562
HSA-MIR-4725-3P	99.96	69.53	2520
HSA-MIR-2110	99.96	66.68	1930
HSA-MIR-557	99.96	70.01	1640
HSA-MIR-1236-3P	99.94	68.04	1695
HSA-MIR-9718	99.94	68.91	918
HSA-MIR-335-3P	99.93	73.36	4958
HSA-MIR-450B-5P	99.92	71.48	3175
HSA-MIR-6508-5P	99.92	70.67	2465
HSA-MIR-3671	99.90	73.04	3897
HSA-MIR-153-5P	99.89	73.86	6317
HSA-MIR-4271	99.88	68.32	2244
HSA-MIR-6780A-5P	99.88	66.69	2776
HSA-MIR-8067	99.86	69.59	2260
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-6079	99.84	68.54	1170
HSA-MIR-765	99.84	68.24	2442
HSA-MIR-544A	99.84	68.66	1965

Literature-anchored findings (GeneRIF, showing 1)

• Knockdown of UBE2D4 caused an increase in p53 protein levels, and knockdown of p53 attenuated not only cadmium-induced apoptosis, but also cadmium-induced apoptosis-related gene expression. (PMID:26912277)

Cross-species orthologs

1 orthologs

Organism	Symbol	Gene ID
danio_rerio	ube2d4	ENSDARG00000015057

Paralogs (12): UBE2D1 (ENSG00000072401), UBE2D3 (ENSG00000109332), UBE2D2 (ENSG00000131508), UBE2Q2 (ENSG00000140367), UBE2L6 (ENSG00000156587), UBE2Q1 (ENSG00000160714), UBE2E3 (ENSG00000170035), UBE2E1 (ENSG00000170142), UBE2E2 (ENSG00000182247), UBE2L3 (ENSG00000185651), UBE2QL1 (ENSG00000215218), UBE2L5 (ENSG00000236444)

Protein

Protein identifiers

Ubiquitin-conjugating enzyme E2 D4 — Q9Y2X8 (reviewed: Q9Y2X8)

Alternative names: E2 ubiquitin-conjugating enzyme D4, HBUCE1, Ubiquitin carrier protein D4, Ubiquitin-protein ligase D4

All UniProt accessions (6): Q9Y2X8, C9J9H9, F2Z3J6, F8WE07, F8WEH7, H0YGA2

UniProt curated annotations — full annotation on UniProt →

Function. Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In vitro able to promote polyubiquitination using all 7 ubiquitin Lys residues, but may prefer ‘Lys-11’ and ‘Lys-48’-linked polyubiquitination.

Pathway. Protein modification; protein ubiquitination.

Similarity. Belongs to the ubiquitin-conjugating enzyme family.

RefSeq proteins (1): NP_057067* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000608	UBC	Domain
IPR016135	UBQ-conjugating_enzyme/RWD	Homologous_superfamily
IPR023313	UBQ-conjugating_AS	Active_site

Pfam: PF00179

Enzyme classification (BRENDA):

• EC 2.3.2.24 — (E3-independent) E2 ubiquitin-conjugating enzyme (BRENDA: 5 organisms, 56 substrates, 7 inhibitors, 6 Km, 6 kcat entries)

Substrate kinetics (BRENDA)

4 substrates with measured Km, best-characterized 4. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
[HISTONE H2A]-L-LYSINE	0.0008–0.0028	2
[HISTONE H2B]-L-LYSINE	0.0015–0.012	2
[CYTOCHROME C]-L-LYSINE	0.125	1
[HISTONE H3]-L-LYSINE	0.0013	1

UniProt features (3 total): chain 1, domain 1, active site 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9Y2X8-F1	96.45	0.96

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 85 (glycyl thioester intermediate)

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-983168	Antigen processing: Ubiquitination & Proteasome degradation

MSigDB gene sets: 77 (showing top): REACTOME_ADAPTIVE_IMMUNE_SYSTEM, REACTOME_CLASS_I_MHC_MEDIATED_ANTIGEN_PROCESSING_PRESENTATION, REACTOME_ANTIGEN_PROCESSING_UBIQUITINATION_PROTEASOME_DEGRADATION, XU_HGF_TARGETS_REPRESSED_BY_AKT1_DN, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, GOBP_PROTEIN_K11_LINKED_UBIQUITINATION, BLALOCK_ALZHEIMERS_DISEASE_UP, GARCIA_TARGETS_OF_FLI1_AND_DAX1_DN, GOBP_POST_TRANSLATIONAL_PROTEIN_MODIFICATION, GOBP_PROTEIN_POLYUBIQUITINATION, chr7p13, GOBP_PROTEIN_K63_LINKED_UBIQUITINATION, KEGG_UBIQUITIN_MEDIATED_PROTEOLYSIS, GOBP_PROTEIN_K48_LINKED_UBIQUITINATION, GOBP_PROTEIN_CATABOLIC_PROCESS

GO Biological Process (8): ubiquitin-dependent protein catabolic process (GO:0006511), protein ubiquitination (GO:0016567), protein K29-linked ubiquitination (GO:0035519), protein K27-linked ubiquitination (GO:0044314), protein K63-linked ubiquitination (GO:0070534), protein K48-linked ubiquitination (GO:0070936), protein K11-linked ubiquitination (GO:0070979), protein K6-linked ubiquitination (GO:0085020)

GO Molecular Function (6): ubiquitin-protein transferase activity (GO:0004842), ATP binding (GO:0005524), ubiquitin conjugating enzyme activity (GO:0061631), nucleotide binding (GO:0000166), protein binding (GO:0005515), transferase activity (GO:0016740)

GO Cellular Component (1): nucleus (GO:0005634)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Class I MHC mediated antigen processing & presentation	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
protein polyubiquitination	6
protein ubiquitination	1
modification-dependent protein catabolic process	1
protein modification by small protein conjugation	1
ubiquitin-like protein transferase activity	1
adenyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
ubiquitin-protein transferase activity	1
ubiquitin-like protein conjugating enzyme activity	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
binding	1
catalytic activity	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

2113 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
UBE2D4	STUB1	Q9UNE7	495
UBE2D4	UBE2U	Q5VVX9	457
UBE2D4	UBE2Q2	Q8WVN8	419
UBE2D4	UBE2Q1	Q7Z7E8	416
UBE2D4	UBE2V2	Q15819	395
UBE2D4	CDC20	Q12834	393
UBE2D4	UBA1	P22314	367
UBE2D4	TRIP12	Q14669	356
UBE2D4	UBA7	P41226	349
UBE2D4	G3V2F7	G3V2F7	348
UBE2D4	UBE2E3	Q969T4	343
UBE2D4	INTS15	Q96N11	342
UBE2D4	MRPS24	P82668	321
UBE2D4	SPDYE1	Q8NFV5	299
UBE2D4	TRIM23	P36406	298

IntAct

258 interactions, top by confidence:

A	B	Type	Score
DTX2	UBE2D4	psi-mi:“MI:0915”(physical association)	0.880
UBE2D4	DTX2	psi-mi:“MI:0915”(physical association)	0.880
RNF11	UBE2D4	psi-mi:“MI:0915”(physical association)	0.880
UBE2D4	RNF11	psi-mi:“MI:0915”(physical association)	0.880
OTUB1	UBE2D4	psi-mi:“MI:0915”(physical association)	0.830
UBE2D4	RNF115	psi-mi:“MI:0915”(physical association)	0.830
UBE2D4	OTUB1	psi-mi:“MI:0915”(physical association)	0.830
RNF115	UBE2D4	psi-mi:“MI:0915”(physical association)	0.830
UBE2D4	RNF5	psi-mi:“MI:0915”(physical association)	0.780
RNF5	UBE2D4	psi-mi:“MI:0915”(physical association)	0.780
ZNRF1	UBE2D4	psi-mi:“MI:0915”(physical association)	0.760

BioGRID (189): DTX2 (Two-hybrid), RNF26 (Two-hybrid), UBE2D4 (Two-hybrid), UBE2D4 (Two-hybrid), UBE2D4 (Two-hybrid), UBE2D4 (Two-hybrid), UBE2D4 (Two-hybrid), UBE2D4 (Two-hybrid), UBE2D4 (Two-hybrid), OTUB1 (Two-hybrid), TRIM39 (Two-hybrid), DTX2 (Two-hybrid), INCA1 (Two-hybrid), UBE2D4 (Two-hybrid), TRIM39 (Two-hybrid)

ESM2 similar proteins: A0A1B0GUS4, A5PJC4, A5PKP9, D3ZDK2, O13685, O14933, O74196, O74549, P15731, P15732, P25867, P35129, P35131, P35132, P35133, P35134, P35135, P43102, P51668, P52487, P60604, P60605, P61080, P62837, P62838, P62839, P62840, P68036, P68037, P70711, Q17QG5, Q1RMX2, Q21633, Q2TA10, Q3MHP1, Q3ZCF7, Q4V8J2, Q5R5I4, Q5RF84, Q6C9W0

Diamond homologs: A0A1B0GUS4, A5PJC4, A5PKP9, D3ZDK2, O13685, O14933, O74196, O74810, P0C8G3, P0C8G4, P0C8G5, P15731, P15732, P21734, P25867, P25869, P27949, P35128, P35129, P35131, P35132, P35133, P35134, P35135, P43102, P46595, P49427, P51668, P51965, P52482, P52483, P52485, P52487, P52490, P52492, P61077, P61078, P61079, P61080, P61088

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
“Ub:E1 (UBA1 substrate)”	“up-regulates activity”	UBE2D4	ubiquitination
“Ub:E1 (UBA6 substrate)”	“up-regulates activity”	UBE2D4	ubiquitination

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 95 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Class I MHC mediated antigen processing & presentation	18	19.1×	1e-16
Interferon gamma signaling	9	17.1×	2e-07
Antigen processing: Ubiquitination & Proteasome degradation	30	16.9×	1e-27
Adaptive Immune System	18	8.1×	3e-10

GO biological processes:

GO term	Partners	Fold	FDR
suppression of viral release by host	6	64.7×	1e-08
negative regulation of viral transcription	5	57.2×	8e-07
protein autoubiquitination	17	43.2×	8e-22
protein K63-linked ubiquitination	14	40.7×	2e-17
host-mediated suppression of symbiont invasion	5	38.2×	6e-06
protein polyubiquitination	23	28.9×	1e-25
ubiquitin-dependent protein catabolic process	34	27.4×	8e-38
protein K48-linked ubiquitination	14	25.6×	2e-14

Disease & clinical

Clinical variants and AI predictions

ClinVar

26 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	12
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1197 predictions. Top by Δscore:

Variant	Effect	Δscore
7:43950593:TCCCA:T	acceptor_loss	1.0000
7:43950594:CCCA:C	acceptor_loss	1.0000
7:43950595:CCA:C	acceptor_loss	1.0000
7:43950596:CAGTT:C	acceptor_loss	1.0000
7:43950597:A:AG	acceptor_gain	1.0000
7:43950597:A:C	acceptor_loss	1.0000
7:43950598:G:GT	acceptor_gain	1.0000
7:43950598:GTT:G	acceptor_gain	1.0000
7:43950598:GTTCT:G	acceptor_gain	1.0000
7:43950688:GAGAA:G	donor_gain	1.0000
7:43950690:G:GT	donor_gain	1.0000
7:43950690:GAA:G	donor_gain	1.0000
7:43950693:G:GG	donor_gain	1.0000
7:43926553:GAAG:G	donor_gain	0.9900
7:43926557:G:T	donor_loss	0.9900
7:43926558:T:G	donor_loss	0.9900
7:43927144:G:GT	donor_gain	0.9900
7:43938491:GACT:G	donor_gain	0.9900
7:43938495:G:GG	donor_gain	0.9900
7:43948734:AAAG:A	donor_loss	0.9900
7:43948735:AAG:A	donor_loss	0.9900
7:43948736:AGGTA:A	donor_loss	0.9900
7:43948737:GG:G	donor_loss	0.9900
7:43948738:GTAGA:G	donor_loss	0.9900
7:43948739:T:C	donor_loss	0.9900
7:43950598:GT:G	acceptor_gain	0.9900
7:43950598:GTTC:G	acceptor_gain	0.9900
7:43950689:AGAAG:A	donor_loss	0.9900
7:43950690:GAAGT:G	donor_loss	0.9900
7:43950692:AGT:A	donor_loss	0.9900

AlphaMissense

965 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
7:43948710:T:A	W93R	1.000
7:43948710:T:C	W93R	1.000
7:43948712:G:C	W93C	1.000
7:43948712:G:T	W93C	1.000
7:43942834:T:A	W33R	0.999
7:43942834:T:C	W33R	0.999
7:43948664:T:A	N77K	0.999
7:43948664:T:G	N77K	0.999
7:43948678:G:A	G82D	0.999
7:43948678:G:T	G82V	0.999
7:43948686:T:C	C85R	0.999
7:43948688:C:G	C85W	0.999
7:43948693:A:T	D87V	0.999
7:43950620:T:C	L109P	0.999
7:43938431:G:A	E9K	0.998
7:43942841:C:A	A35D	0.998
7:43942847:T:A	I37N	0.998
7:43942852:G:C	G39R	0.998
7:43943011:T:C	Y60H	0.998
7:43943015:C:A	P61Q	0.998
7:43943017:T:C	F62L	0.998
7:43943019:C:A	F62L	0.998
7:43943019:C:G	F62L	0.998
7:43943027:C:A	P65Q	0.998
7:43948657:A:G	H75R	0.998
7:43948660:C:A	P76H	0.998
7:43948684:T:A	I84N	0.998
7:43948687:G:A	C85Y	0.998
7:43948690:T:A	L86H	0.998
7:43948690:T:C	L86P	0.998

dbSNP variants (sampled 300 via entrez): RS1000034713 (7:43954518 T>C), RS1000333526 (7:43931282 G>GA), RS1000475857 (7:43928492 T>C), RS1000711353 (7:43936069 C>A), RS1000831721 (7:43942405 A>G), RS1000952951 (7:43941868 C>T), RS1001026965 (7:43949095 C>A,T), RS1001039206 (7:43956210 C>A,G), RS1001104311 (7:43934592 C>G,T), RS1001251426 (7:43954052 T>C,G), RS1001330151 (7:43949404 T>C), RS1001349511 (7:43953784 A>G), RS1001433873 (7:43944521 C>A), RS1001515880 (7:43948488 T>TG), RS1001589345 (7:43953668 CGGCTTTCTGCCTT>C,CGGCTTTCTGCCTTGGCTTTCTGCCTT)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

35 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Cadmium	decreases expression, increases abundance	3
bisphenol A	increases expression, affects cotreatment	2
Silicon Dioxide	increases expression, decreases expression	2
dicrotophos	increases expression	1
kojic acid	decreases expression	1
beta-lapachone	decreases expression	1
sodium arsenite	decreases expression	1
potassium chromate(VI)	affects cotreatment, decreases expression	1
epigallocatechin gallate	affects cotreatment, decreases expression	1
CGP 52608	affects binding, increases reaction	1
abrine	decreases expression	1
jinfukang	affects cotreatment, increases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	increases expression	1
Sunitinib	increases expression	1
Acetaminophen	decreases expression	1
Amphotericin B	increases expression	1
Arbutin	decreases expression	1
Carbamazepine	affects expression	1
Cisplatin	increases expression, affects cotreatment	1
Dexamethasone	affects cotreatment, increases expression	1
Bucladesine	affects cotreatment, increases expression	1
Diethylstilbestrol	increases expression	1
Doxorubicin	decreases expression	1
Estradiol	affects cotreatment, increases expression	1
Indomethacin	affects cotreatment, increases expression	1
Ketoconazole	increases expression	1
Smoke	decreases expression	1
Dronabinol	increases expression	1
Tunicamycin	decreases expression	1
1-Methyl-3-isobutylxanthine	affects cotreatment, increases expression	1

Cellosaurus cell lines

3 cell lines: 3 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B2K3	Abcam HeLa UBE2D4 KO	Cancer cell line	Female
CVCL_TV60	HAP1 UBE2D4 (-) 1	Cancer cell line	Male
CVCL_TV61	HAP1 UBE2D4 (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.